miRNAs in Signal Transduction of SMAD Proteins in Breast Cancer
Abstract
:1. Introduction
2. Results
2.1. Gene Expression Profile Determined by mRNA Microarrays
2.2. Expression Profile of SMAD3, SMAD4, SMAD5, and SMAD7 Determined by RT-qPCR and ELISA
2.3. miRNA Target Prediction
3. Discussion
4. Materials and Methods
4.1. Patients
4.2. Total Ribonucleic Acid (RNA) Extraction
4.3. mRNA Microarray Analysis
4.4. Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR)
4.5. miRNA Profiling
4.6. Enzyme-Linked Immunosorbent Assay (ELISA)
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Wojciechowska, U.; Barańska, K.; Miklewska, M.; Didkowska, J.A. Cancer Incidence and Mortality in Poland in 2020. Nowotw. J. Oncol. 2023, 73, 129–145. [Google Scholar] [CrossRef]
- Łukasiewicz, S.; Czeczelewski, M.; Forma, A.; Baj, J.; Sitarz, R.; Stanisławek, A. Breast Cancer-Epidemiology, Risk Factors, Classification, Prognostic Markers, and Current Treatment Strategies—An Updated Review. Cancers 2021, 13, 4287. [Google Scholar] [CrossRef]
- Yang, X.; Smirnov, A.; Buonomo, O.C.; Mauriello, A.; Shi, Y.; Bischof, J.; Woodsmith, J.; Tor Centre; Melino, G.; Candi, E.; et al. A Primary Luminal/HER2 Negative Breast Cancer Patient with Mismatch Repair Deficiency. Cell Death Discov. 2023, 9, 365. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.-J.; Liu, Y.-X.; Huang, Y.; Chen, Z.-J.; Zhang, H.-Z.; Yu, Y.; Wang, X.; Cao, X.-C. The Regrouping of Luminal B (HER2 Negative), a Better Discriminator of Outcome and Recurrence Score. Cancer Med. 2023, 12, 2493–2504. [Google Scholar] [CrossRef]
- Falato, C.; Schettini, F.; Pascual, T.; Brasó-Maristany, F.; Prat, A. Clinical Implications of the Intrinsic Molecular Subtypes in Hormone Receptor-Positive and HER2-Negative Metastatic Breast Cancer. Cancer Treat. Rev. 2023, 112, 102496. [Google Scholar] [CrossRef]
- Thomas, A.; Reis-Filho, J.S.; Geyer, C.E.; Wen, H.Y. Rare Subtypes of Triple Negative Breast Cancer: Current Understanding and Future Directions. NPJ Breast Cancer 2023, 9, 55. [Google Scholar] [CrossRef]
- Deng, Z.; Fan, T.; Xiao, C.; Tian, H.; Zheng, Y.; Li, C.; He, J. TGF-β Signaling in Health, Disease, and Therapeutics. Signal Transduct. Target. Ther. 2024, 9, 61. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Wang, Y.; Lu, X.; Chen, H.; Kong, Y.; Rong, L.; Wang, G. The Immune Regulation and Therapeutic Potential of the SMAD Gene Family in Breast Cancer. Sci. Rep. 2024, 14, 6769. [Google Scholar] [CrossRef]
- Loh, C.-Y.; Chai, J.Y.; Tang, T.F.; Wong, W.F.; Sethi, G.; Shanmugam, M.K.; Chong, P.P.; Looi, C.Y. The E-Cadherin and N-Cadherin Switch in Epithelial-to-Mesenchymal Transition: Signaling, Therapeutic Implications, and Challenges. Cells 2019, 8, 1118. [Google Scholar] [CrossRef]
- Xin, X.; Cheng, X.; Zeng, F.; Xu, Q.; Hou, L. The Role of TGF-β/SMAD Signaling in Hepatocellular Carcinoma: From Mechanism to Therapy and Prognosis. Int. J. Biol. Sci. 2024, 20, 1436–1451. [Google Scholar] [CrossRef] [PubMed]
- Petersen, M.; Pardali, E.; van der Horst, G.; Cheung, H.; van den Hoogen, C.; van der Pluijm, G.; Ten Dijke, P. Smad2 and Smad3 Have Opposing Roles in Breast Cancer Bone Metastasis by Differentially Affecting Tumor Angiogenesis. Oncogene 2010, 29, 1351–1361. [Google Scholar] [CrossRef] [PubMed]
- Niu, H.; Huang, Y.; Yan, L.; Zhang, L.; Zhao, M.; Lu, T.; Yang, X.; Chen, Z.; Zhan, C.; Shi, Y.; et al. Knockdown of SMAD3 inhibits the growth and enhances the radiosensitivity of lung adenocarcinoma via p21 in vitro and in vivo. Int. J. Biol. Sci. 2020, 16, 1010–1022. [Google Scholar] [CrossRef] [PubMed]
- Liu, B.; Li, J.; Cairns, M.J. Identifying miRNAs, Targets and Functions. Brief. Bioinform. 2014, 15, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Ghafouri-Fard, S.; Khanbabapour Sasi, A.; Abak, A.; Shoorei, H.; Khoshkar, A.; Taheri, M. Contribution of miRNAs in the Pathogenesis of Breast Cancer. Front. Oncol. 2021, 11, 768949. [Google Scholar] [CrossRef] [PubMed]
- Kim, V.N.; Nam, J.-W. Genomics of microRNA. Trends Genet. 2006, 22, 165–173. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Mo, Y.-Y. Role of microRNAs in Breast Cancer. Cancer Biol. Ther. 2013, 14, 201–212. [Google Scholar] [CrossRef]
- Singha, P.K.; Pandeswara, S.; Geng, H.; Lan, R.; Venkatachalam, M.A.; Dobi, A.; Srivastava, S.; Saikumar, P. Increased Smad3 and Reduced Smad2 Levels Mediate the Functional Switch of TGF-β from Growth Suppressor to Growth and Metastasis Promoter through TMEPAI/PMEPA1 in Triple Negative Breast Cancer. Genes Cancer 2019, 10, 134–149. [Google Scholar] [CrossRef]
- Yang, W.; Feng, W.; Wu, F.; Gao, Y.; Sun, Q.; Hu, N.; Lu, W.; Zhou, J. MiR-135-5p Inhibits TGF-β-Induced Epithelial-Mesenchymal Transition and Metastasis by Targeting SMAD3 in Breast Cancer. J. Cancer 2020, 11, 6402–6412. [Google Scholar] [CrossRef]
- Manvati, S.; Mangalhara, K.C.; Kalaiarasan, P.; Chopra, R.; Agarwal, G.; Kumar, R.; Saini, S.K.; Kaushik, M.; Arora, A.; Kumari, U.; et al. miR-145 Supports Cancer Cell Survival and Shows Association with DDR Genes, Methylation Pattern, and Epithelial to Mesenchymal Transition. Cancer Cell Int. 2019, 19, 230. [Google Scholar] [CrossRef]
- Zhao, H.; Kang, X.; Xia, X.; Wo, L.; Gu, X.; Hu, Y.; Xie, X.; Chang, H.; Lou, L.; Shen, X. miR-145 Suppresses Breast Cancer Cell Migration by Targeting FSCN-1 and Inhibiting Epithelial-Mesenchymal Transition. Am. J. Transl. Res. 2016, 8, 3106–3114. [Google Scholar] [PubMed]
- Sheng, N.; Tan, G.; You, W.; Chen, H.; Gong, J.; Chen, D.; Zhang, H.; Wang, Z. MiR-145 Inhibits Human Colorectal Cancer Cell Migration and Invasion via PAK4-Dependent Pathway. Cancer Med. 2017, 6, 1331–1340. [Google Scholar] [CrossRef] [PubMed]
- Lu, Q.; Shan, S.; Li, Y.; Zhu, D.; Jin, W.; Ren, T. Long Noncoding RNA SNHG1 Promotes Non-Small Cell Lung Cancer Progression by up-Regulating MTDH via Sponging miR-145-5p. FASEB J. 2018, 32, 3957–3967. [Google Scholar] [CrossRef]
- Opyrchal, M.; Gil, M.; Salisbury, J.L.; Goetz, M.P.; Suman, V.; Degnim, A.; McCubrey, J.; Haddad, T.; Iankov, I.; Kurokawa, C.B.; et al. Molecular Targeting of the Aurora-A/SMAD5 Oncogenic Axis Restores Chemosensitivity in Human Breast Cancer Cells. Oncotarget 2017, 8, 91803–91816. [Google Scholar] [CrossRef]
- Wang, Q.; Xiong, F.; Wu, G.; Wang, D.; Liu, W.; Chen, J.; Qi, Y.; Wang, B.; Chen, Y. SMAD Proteins in TGF-β Signalling Pathway in Cancer: Regulatory Mechanisms and Clinical Applications. Diagnostics 2023, 13, 2769. [Google Scholar] [CrossRef]
- Wang, J.; Wang, Q.; Guan, Y.; Sun, Y.; Wang, X.; Lively, K.; Wang, Y.; Luo, M.; Kim, J.A.; Murphy, E.A.; et al. Breast Cancer Cell-Derived microRNA-155 Suppresses Tumor Progression via Enhancing Immune Cell Recruitment and Antitumor Function. J. Clin. Investig. 2022, 132, e157248. [Google Scholar] [CrossRef] [PubMed]
- Stolfi, C.; Marafini, I.; De Simone, V.; Pallone, F.; Monteleone, G. The Dual Role of Smad7 in the Control of Cancer Growth and Metastasis. Int. J. Mol. Sci. 2013, 14, 23774–23790. [Google Scholar] [CrossRef]
- Ryu, T.Y.; Kim, K.; Kim, S.-K.; Oh, J.-H.; Min, J.-K.; Jung, C.-R.; Son, M.-Y.; Kim, D.-S.; Cho, H.-S. SETDB1 Regulates SMAD7 Expression for Breast Cancer Metastasis. BMB Rep. 2019, 52, 139–144. [Google Scholar] [CrossRef]
- Smith, A.L.; Iwanaga, R.; Drasin, D.J.; Micalizzi, D.S.; Vartuli, R.L.; Tan, A.-C.; Ford, H.L. The miR-106b-25 Cluster Targets Smad7, Activates TGF-β Signaling, and Induces EMT and Tumor Initiating Cell Characteristics Downstream of Six1 in Human Breast Cancer. Oncogene 2012, 31, 5162–5171. [Google Scholar] [CrossRef]
- Qi, L.-Q.; Sun, B.; Yang, B.-B.; Lu, S. MiR-15b Facilitates Breast Cancer Progression via Repressing Tumor Suppressor PAQR3. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 740–748. [Google Scholar] [CrossRef]
- Wu, B.; Liu, G.; Jin, Y.; Yang, T.; Zhang, D.; Ding, L.; Zhou, F.; Pan, Y.; Wei, Y. miR-15b-5p Promotes Growth and Metastasis in Breast Cancer by Targeting HPSE2. Front. Oncol. 2020, 10, 108. [Google Scholar] [CrossRef] [PubMed]
- Liang, F.; Yang, M.; Tong, N.; Fang, J.; Pan, Y.; Li, J.; Zhang, X. Identification of Six Key miRNAs Associated with Breast Cancer through Screening Large-Scale Microarray Data. Oncol. Lett. 2018, 16, 4159–4168. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Tan, Z.; Hu, H.; Liu, H.; Wu, T.; Zheng, C.; Wang, X.; Luo, Z.; Wang, J.; Liu, S.; et al. microRNA-21 Promotes Breast Cancer Proliferation and Metastasis by Targeting LZTFL1. BMC Cancer 2019, 19, 738. [Google Scholar] [CrossRef] [PubMed]
- Mi, H.; Thomas, P. PANTHER Pathway: An Ontology-Based Pathway Database Coupled with Data Analysis Tools. Methods Mol. Biol. 2009, 563, 123–140. [Google Scholar] [CrossRef]
- Chen, Y.; Wang, X. miRDB: An Online Database for Prediction of Functional microRNA Targets. Nucleic Acids Res. 2020, 48, D127–D131. [Google Scholar] [CrossRef]
- Kalkulator Doboru Próby. Available online: https://www.naukowiec.org/dobor.html (accessed on 19 April 2022).
- Krajowy Rejestr Nowotworów. Nowotwór Piersi—2019. Available online: https://onkologia.org.pl/sites/default/files/Pier%C5%9B.pdf (accessed on 1 February 2024).
Gene Symbol | Fold Enrichment | p-Value |
---|---|---|
GDF5, GDF6, INHBA, SMAD1, SMAD2, SMAD3, SMAD4, SMAD5, SMAD6, SMAD7, SMAD9, TGFBR2 | >100 | <0.0001 |
ID | mRNA | Fold Change | ||||
---|---|---|---|---|---|---|
LumA vs. C | LumB HER2− vs. C | LumB HER2+ vs. C | Non-Luminal HER2+ vs. C | TNBC | ||
218284_at | SMAD3 | 2.29 | 2.56 | 2.81 | 2.69 | 4.22 |
202527_s_at 235725_at | SMAD4 | 2.05 2.12 | 2.48 3.17 | 3.34 2.49 | 3.04 3.90 | 4.01 4.38 |
205188_s_at 235451_at | SMAD5 | 2.08 2.04 | 2.32 2.12 | 2.32 2.17 | 2.97 3.68 | 3.15 3.72 |
204790_at | SMAD7 | −3.43 | −3.75 | −3.86 | −3.66 | −4.63 |
mRNA | Fold Change | ||||
---|---|---|---|---|---|
LumA vs. C | LumB HER2− vs. C | LumB HER2+ vs. C | Non-Luminal HER2+ vs. C | TNBC | |
SMAD3 | 2.99 | 3.64 | 4.22 | 3.96 | 6.13 |
SMAD4 | 3.35 | 3.95 | 4.45 | 5.09 | 4.82 |
SMAD5 | 3.88 | 3.97 | 3.73 | 4.27 | 4.38 |
SMAD7 | −6.15 | −7.33 | −8.45 | −8.58 | −12.02 |
Protein [ng/mL] | Control | Luminal A | Luminal B HER2− | Luminal B HER2+ | Non-Luminal HER2+ | TNBC |
---|---|---|---|---|---|---|
SMAD3 | 1.82 ± 0.13 | 3.15 ± 0.13 * | 3.82 ± 0.14 * | 4.21 ± 0.13 * | 4.65 ± 0.11 * | 5.38 ± 0.11 * |
SMAD4 | 1.16 ± 0.08 | 1.34 ± 0.06 * | 1.76 ± 0.06 * | 1.82 ± 0.05 * | 1.91 ± 0.08 * | 4.37 ± 0.07 * |
SMAD5 | 0.93 ± 0.06 | 1.51 ± 0.09 * | 1.84 ± 0.1 * | 1.85 ± 0.05 * | 1.99 ± 0.09 * | 3.87 ± 0.1 * |
SMAD7 | 1.38 ± 0.16 | 0.48 ± 0.04 * | below detection threshold * | below detection threshold * | below detection threshold * | below detection threshold * |
mRNA | miRNA | Target Score | Fold Change | ||||
---|---|---|---|---|---|---|---|
LumA vs. C | LumB HER2− vs. C | LumB HER2+ vs. C | Non-Luminal HER2+ vs. C | TNBC | |||
SMAD4 | miR-155 | 83 | −2.02 | −2.12 | −2.07 | −2.77 | −5.99 |
SMAD3 SMAD5 | miR-145 | 98 93 | −2.17 | −2.01 | −2.54 | −2.81 | −3.7 |
SMAD7 | miR-15b | 92 | 2.27 | 2.42 | 2.49 | 2.92 | 4.66 |
miR-21b | 92 | 2.16 | 2.70 | 2.67 | 2.55 | 4.19 |
Molecular Type | Grade | Age | BMI [kg/m2] | |||
---|---|---|---|---|---|---|
G1 | G2 | G3 | <50 Years | >50 Years | ||
Luminal A | 23 (18%) | 48 (37%) | 59 (45%) | 43 (33%) | 87 (67%) | 30.78 ± 2.76 |
Luminal B HER2− | 31 (31%) | 57 (57%) | 12 (12%) | 32 (32%) | 68 (68%) | 30.18 ± 4.56 |
Luminal B HER2+ | 23 (24%) | 57 (59%) | 16 (17%) | 19 (20%) | 77 (80%) | 32.09 ± 6.19 |
Non-luminal HER2+ | 9 (25%) | 12 (33%) | 15 (42%) | 9 (25%) | 27 (75%) | 33.18 ± 5.67 |
TNBC | 14 (32%) | 21 (49%) | 8 (19%) | 10 (23%) | 33 (77%) | 34.67 ± 2.98 |
mRNA | RT-qPCR Amplification Primers (5′-3′) |
---|---|
SMAD3 | Forward: CTACCAGAGAGTAGAGACAC Reverse: TCTCTGGAATATTGCTCTGG |
SMAD4 | Forward: AAAGGTCTTTGATTTGCGTC Reverse: CTATTCCACCTACTGATCCTG |
SMAD5 | Forward: CCAGTCTTACCTCCAGTATTAG Reverse: TCCTAAACTGAACCAGAAGG |
SMAD7 | Forward: CAGATTCCCAACTTCTTCTG Reverse: CTCTTGTTGTCCGAATTGAG |
ACTB | Forward: TCACCCACACTGTGCCCATCTACGA Reverse: CAGCGGAACCGCTCATTGCCAATGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sirek, T.; Sirek, A.; Borawski, P.; Zmarzły, N.; Sułkowska, J.; Król-Jatręga, K.; Opławski, M.; Boroń, D.; Chalcarz, M.; Ossowski, P.; et al. miRNAs in Signal Transduction of SMAD Proteins in Breast Cancer. Int. J. Mol. Sci. 2024, 25, 10088. https://doi.org/10.3390/ijms251810088
Sirek T, Sirek A, Borawski P, Zmarzły N, Sułkowska J, Król-Jatręga K, Opławski M, Boroń D, Chalcarz M, Ossowski P, et al. miRNAs in Signal Transduction of SMAD Proteins in Breast Cancer. International Journal of Molecular Sciences. 2024; 25(18):10088. https://doi.org/10.3390/ijms251810088
Chicago/Turabian StyleSirek, Tomasz, Agata Sirek, Przemysław Borawski, Nikola Zmarzły, Joanna Sułkowska, Katarzyna Król-Jatręga, Marcin Opławski, Dariusz Boroń, Michał Chalcarz, Piotr Ossowski, and et al. 2024. "miRNAs in Signal Transduction of SMAD Proteins in Breast Cancer" International Journal of Molecular Sciences 25, no. 18: 10088. https://doi.org/10.3390/ijms251810088