In Silico Structural Prediction for the Generation of Novel Performant Midi-Dystrophins Based on Intein-Mediated Dual AAV Approach
Abstract
1. Introduction
2. Results
2.1. Design of Three Novel Midi-Dystrophins Proteins Based on Intein-Mediated Reconstitution Approach
2.2. In Silico Modeling of Intein Adjacent Sites Predicts Efficacy of Protein Reconstitution
2.3. Structural Predictions of GP41-1 Split Midi-Dys Revealed Efficiency of Protein Trans-Splicing
2.4. Restoration of Midi-Dystrophin 1 and Midi-Dystrophin 2 in DBA2-Mdx Mice Following Systemic AAV9 Delivery of Split Midi-Dys
2.5. AAV9 Midi-Dys 1 and Midi-Dys 2 Systemic Delivery in DBA2 Mdx Shows Therapeutic Efficacy
3. Discussion
4. Material and Methods
4.1. Midi-Dystrophins Design and Viral Particle Preparation
4.2. Structural Prediction Using AlphaFold3
4.3. In Vitro Assessment of Protein Trans-Splicing
4.4. Capillary Western Blot and Protein Trans-Splicing Efficacy Assessment
4.5. Animal Care and Use
4.6. Genomic DNA Extraction and Viral Copy Number Analysis
4.7. Histological Staining
4.8. Fibrosis and Calcific Quantification
4.9. Dystrophin Positive Fibers Quantification
4.10. Serum Biomarkers Quantification
4.11. RNA Extraction and Gene Expression Analysis
4.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mendell, J.R.; Shilling, C.; Leslie, N.D.; Flanigan, K.M.; al-Dahhak, R.; Gastier-Foster, J.; Kneile, K.; Dunn, D.M.; Duval, B.; Aoyagi, A.; et al. Evidence-based path to newborn screening for Duchenne muscular dystrophy. Ann. Neurol. 2012, 71, 304–313. [Google Scholar] [CrossRef] [PubMed]
- Ervasti, J.; Campbell, K. A role for the dystrophin-glycoprotein complex as a transmembrane linker between laminin and actin. J. Cell Biol. 1993, 122, 809–823. [Google Scholar] [CrossRef] [PubMed]
- Hoffman, E.P.; Brown, R.H.; Kunkel, L.M. Dystrophin: The protein product of the duchenne muscular dystrophy locus. Cell 1987, 51, 919–928. [Google Scholar] [CrossRef]
- Amann, K.J.; Renley, B.A.; Ervasti, J.M. A cluster of basic repeats in the dystrophin rod domain binds F-actin through an electrostatic interaction. J. Biol. Chem. 1998, 273, 28419–28423. [Google Scholar] [CrossRef] [PubMed]
- Bhosle, R.C.; Michele, D.E.; Campbell, K.P.; Li, Z.; Robson, R.M. Interactions of intermediate filament protein synemin with dystrophin and utrophin. Biochem. Biophys. Res. Commun. 2006, 346, 768–777. [Google Scholar] [CrossRef]
- Prins, K.W.; Humston, J.L.; Mehta, A.; Tate, V.; Ralston, E.; Ervasti, J.M. Dystrophin is a microtubule-associated protein. J. Cell Biol. 2009, 186, 363–369. [Google Scholar] [CrossRef]
- Renley, B.A.; Rybakova, I.N.; Amann, K.J.; Ervasti, J.M. Dystrophin binding to nonmuscle actin. Cell Motil. Cytoskelet. 1998, 41, 264–270. [Google Scholar] [CrossRef]
- Zhao, J.; Kodippili, K.; Yue, Y.; Hakim, C.H.; Wasala, L.; Pan, X.; Zhang, K.; Yang, N.N.; Duan, D.; Lai, Y. Dystrophin contains multiple independent membrane-binding domains. Hum. Mol. Genet. 2016, 25, 3647–3653. [Google Scholar] [CrossRef]
- Jung, D.; Yang, B.; Meyer, J.; Chamberlain, J.S.; Campbell, K.P. Identification and characterization of the dystrophin anchoring site on beta-dystroglycan. J. Biol. Chem. 1995, 270, 27305–27310. [Google Scholar] [CrossRef]
- Brenman, J.E.; Chao, D.S.; Xia, H.; Aldape, K.; Bredt, D.S. Nitric oxide synthase complexed with dystrophin and absent from skeletal muscle sarcolemma in Duchenne muscular dystrophy. Cell 1995, 82, 743–752. [Google Scholar] [CrossRef]
- Dumont, N.A.; Wang, Y.X.; von Maltzahn, J.; Pasut, A.; Bentzinger, C.F.; Brun, C.E.; Rudnicki, M.A. Dystrophin expression in muscle stem cells regulates their polarity and asymmetric division. Nat. Med. 2015, 21, 1455–1463. [Google Scholar] [CrossRef] [PubMed]
- Koo, T.; Malerba, A.; Athanasopoulos, T.; Trollet, C.; Boldrin, L.; Ferry, A.; Popplewell, L.; Foster, H.; Foster, K.; Dickson, G. Delivery of AAV2/9-microdystrophin genes incorporating helix 1 of the coiled-coil motif in the C-terminal domain of dystrophin improves muscle pathology and restores the level of α1-syntrophin and α-dystrobrevin in skeletal muscles of mdx mice. Hum. Gene Ther. 2011, 22, 1379–1388. [Google Scholar] [CrossRef] [PubMed]
- Birch, S.M.; Lawlor, M.W.; Conlon, T.J.; Guo, L.-J.; Crudele, J.M.; Hawkins, E.C.; Nghiem, P.P.; Ahn, M.; Meng, H.; Beatka, M.J.; et al. Assessment of systemic AAV-microdystrophin gene therapy in the GRMD model of Duchenne muscular dystrophy. Sci. Transl. Med. 2023, 15, eabo1815. [Google Scholar] [CrossRef]
- Bostick, B.; Shin, J.-H.; Yue, Y.; Wasala, N.B.; Lai, Y.; Duan, D. AAV micro-dystrophin gene therapy alleviates stress-induced cardiac death but not myocardial fibrosis in > 21-m-old mdx mice, an end-stage model of Duchenne muscular dystrophy cardiomyopathy. J. Mol. Cell. Cardiol. 2012, 53, 217–222. [Google Scholar] [CrossRef] [PubMed]
- Le Guiner, C.; Servais, L.; Montus, M.; Larcher, T.; Fraysse, B.; Moullec, S.; Allais, M.; François, V.; Dutilleul, M.; Malerba, A.; et al. Long-term microdystrophin gene therapy is effective in a canine model of Duchenne muscular dystrophy. Nat. Commun. 2017, 8, 16105. [Google Scholar] [CrossRef]
- Hoy, S.M. Delandistrogene Moxeparvovec: First Approval. Drugs 2023, 83, 1323–1329. [Google Scholar] [CrossRef]
- Harper, S.Q.; Hauser, M.A.; DelloRusso, C.; Duan, D.; Crawford, R.W.; Phelps, S.F.; Harper, H.A.; Robinson, A.S.; Engelhardt, J.F.; Brooks, S.V.; et al. Modular flexibility of dystrophin: Implications for gene therapy of Duchenne muscular dystrophy. Nat. Med. 2002, 8, 253–261. [Google Scholar] [CrossRef]
- Hart, C.C.; Lee, Y.I.; Xie, J.; Gao, G.; Lin, B.L.; Hammers, D.W.; Sweeney, H.L. Potential limitations of micro-dystrophin gene therapy for Duchenne muscular dystrophy. JCI Insight. 2024, 9, e165869. [Google Scholar] [CrossRef]
- Albini, S.; Palmieri, L.; Dubois, A.; Bourg, N.; Lostal, W.; Richard, I. Assessment of Therapeutic Potential of a Dual AAV Approach for Duchenne Muscular Dystrophy. Int. J. Mol. Sci. 2023, 24, 11421. [Google Scholar] [CrossRef]
- Koo, T.; Popplewell, L.; Athanasopoulos, T.; Dickson, G. Triple trans-splicing adeno-associated virus vectors capable of transferring the coding sequence for full-length dystrophin protein into dystrophic mice. Hum. Gene Ther. 2014, 25, 98–108. [Google Scholar] [CrossRef]
- Lostal, W.; Kodippili, K.; Yue, Y.; Duan, D. Full-Length Dystrophin Reconstitution with Adeno-Associated Viral Vectors. Hum. Gene Ther. 2014, 25, 552–562. [Google Scholar] [CrossRef] [PubMed]
- Odom, G.L.; Gregorevic, P.; Allen, J.M.; Chamberlain, J.S. Gene Therapy of mdx Mice With Large Truncated Dystrophins Generated by Recombination Using rAAV6. Mol. Ther. 2011, 19, 36–45. [Google Scholar] [CrossRef] [PubMed]
- Tasfaout, H.; Halbert, C.L.; McMillen, T.S.; Allen, J.M.; Reyes, T.R.; Flint, G.V.; Grimm, D.; Hauschka, S.D.; Regnier, M.; Chamberlain, J.S. Split intein-mediated protein trans-splicing to express large dystrophins. Nature 2024, 632, 192–200. [Google Scholar] [CrossRef] [PubMed]
- Yan, Z.; Zhang, Y.; Duan, D.; Engelhardt, J.F. Trans-splicing vectors expand the utility of adeno-associated virus for gene therapy. Proc. Natl. Acad. Sci. USA 2000, 97, 6716–6721. [Google Scholar] [CrossRef]
- Yan, Z.; Lei-Butters, D.C.M.; Zhang, Y.; Zak, R.; Engelhardt, J.F. Hybrid adeno-associated virus bearing nonhomologous inverted terminal repeats enhances dual-vector reconstruction of minigenes in vivo. Hum. Gene Ther. 2007, 18, 81–87. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhang, C.; Xiao, W.; Herzog, R.W.; Han, R. Systemic delivery of full-length dystrophin in Duchenne muscular dystrophy mice. Nat. Commun. 2024, 15, 6141. [Google Scholar] [CrossRef]
- Lai, Y.; Yue, Y.; Liu, M.; Ghosh, A.; Engelhardt, J.F.; Chamberlain, J.S.; Duan, D. Efficient in vivo gene expression by trans-splicing adeno-associated viral vectors. Nat. Biotechnol. 2005, 23, 1435–1439. [Google Scholar] [CrossRef]
- Zhang, Y.; Yue, Y.; Li, L.; Hakim, C.H.; Zhang, K.; Thomas, G.D.; Duan, D. Dual AAV therapy ameliorates exercise-induced muscle injury and functional ischemia in murine models of Duchenne muscular dystrophy. Hum. Mol. Genet. 2013, 22, 3720–3729. [Google Scholar] [CrossRef]
- Duan, D.; Yue, Y.; Yan, Z.; Engelhardt, J.F. A new dual-vector approach to enhance recombinant adeno-associated virus-mediated gene expression through intermolecular cis activation. Nat. Med. 2000, 6, 595–598. [Google Scholar] [CrossRef]
- Ertl, H.C.J. Immunogenicity and toxicity of AAV gene therapy. Front. Immunol. 2022, 13, 975803. [Google Scholar] [CrossRef]
- Saleh, L.; Perler, F.B. Protein splicing in cis and in trans. Chem. Rec. 2006, 6, 183–193. [Google Scholar] [CrossRef] [PubMed]
- Esposito, F.; Lyubenova, H.; Tornabene, P.; Auricchio, S.; Iuliano, A.; Nusco, E.; Merlin, S.; Olgasi, C.; Manni, G.; Gargaro, M.; et al. Liver gene therapy with intein-mediated F8 trans-splicing corrects mouse haemophilia A. EMBO Mol. Med. 2022, 14, e15199. [Google Scholar] [CrossRef] [PubMed]
- Padula, A.; Petruzzelli, R.; Philbert, S.A.; Church, S.J.; Esposito, F.; Campione, S.; Monti, M.; Capolongo, F.; Perna, C.; Nusco, E.; et al. Full-length ATP7B reconstituted through protein trans-splicing corrects Wilson disease in mice. Mol. Ther. Methods Clin. Dev. 2022, 26, 495–504. [Google Scholar] [CrossRef] [PubMed]
- Tornabene, P.; Trapani, I.; Minopoli, R.; Centrulo, M.; Lupo, M.; de Simone, S.; Tiberi, P.; Dell’Aquila, F.; Marrocco, E.; Iodice, C.; et al. Intein-mediated protein trans-splicing expands adeno-associated virus transfer capacity in the retina. Sci. Transl. Med. 2019, 11, eaav4523. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Yang, H.T.; Wasala, L.; Zhang, K.; Yue, Y.; Duan, D.; Lai, Y. Dystrophin R16/17 protein therapy restores sarcolemmal nNOS in trans and improves muscle perfusion and function. Mol. Med. 2019, 25, 31. [Google Scholar] [CrossRef]
- Abramson, J.; Adler, J.; Dunger, J.; Evans, R.; Green, T.; Pritzel, A.; Ronneberger, O.; Willmore, L.; Ballard, A.J.; Bambrick, J.; et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 2024, 630, 493–500. [Google Scholar] [CrossRef]
- Xu, J.; Zhang, Y. How significant is a protein structure similarity with TM-score = 0.5? Bioinformatics 2010, 26, 889–895. [Google Scholar] [CrossRef]
- Pinto, F.; Thornton, E.L.; Wang, B. An expanded library of orthogonal split inteins enables modular multi-peptide assemblies. Nat. Commun. 2020, 11, 1529. [Google Scholar] [CrossRef]
- Carvajal-Vallejos, P.; Pallissé, R.; Mootz, H.D.; Schmidt, S.R. Unprecedented rates and efficiencies revealed for new natural split inteins from metagenomic sources. J. Biol. Chem. 2012, 287, 28686–28696. [Google Scholar] [CrossRef]
- Shah, N.H.; Eryilmaz, E.; Cowburn, D.; Muir, T.W. Extein residues play an intimate role in the rate-limiting step of protein trans-splicing. J. Am. Chem. Soc. 2013, 135, 5839–5847. [Google Scholar] [CrossRef]
- Aranko, A.S.; Züger, S.; Buchinger, E.; Iwaï, H. In vivo and in vitro protein ligation by naturally occurring and engineered split DnaE inteins. PLoS ONE 2009, 4, e5185. [Google Scholar] [CrossRef] [PubMed]
- Himeda, C.L.; Chen, X.; Hauschka, S.D. Design and testing of regulatory cassettes for optimal activity in skeletal and cardiac muscles. Methods Mol. Biol. 2011, 709, 3–19. [Google Scholar] [CrossRef] [PubMed]
- Manini, A.; Abati, E.; Nuredini, A.; Corti, S.; Comi, G.P. Adeno-Associated Virus (AAV)-Mediated Gene Therapy for Duchenne Muscular Dystrophy: The Issue of Transgene Persistence. Front. Neurol. 2021, 12, 814174. [Google Scholar] [CrossRef] [PubMed]
- Rouillon, J.; Poupiot, J.; Zocevic, A.; Amor, F.; Léger, T.; Garcia, C.; Camadro, J.-M.; Wong, B.; Pinilla, R.; Cosette, J.; et al. Serum proteomic profiling reveals fragments of MYOM3 as potential biomarkers for monitoring the outcome of therapeutic interventions in muscular dystrophies. Hum. Mol. Genet. 2015, 24, 4916–4932. [Google Scholar] [CrossRef]
- Hakim, C.H.; Wasala, N.B.; Pan, X.; Kodippili, K.; Yue, Y.; Zhang, K.; Yao, G.; Haffner, B.; Duan, S.X.; Ramos, J.; et al. A Five-Repeat Micro-Dystrophin Gene Ameliorated Dystrophic Phenotype in the Severe DBA/2J-mdx Model of Duchenne Muscular Dystrophy. Mol. Ther.-Methods Clin. Dev. 2017, 6, 216–230. [Google Scholar] [CrossRef]
- Lai, Y.; Thomas, G.D.; Yue, Y.; Yang, H.T.; Li, D.; Long, C.; Judge, L.; Bostick, B.; Chamberlain, J.S.; Terjung, R.L.; et al. Dystrophins carrying spectrin-like repeats 16 and 17 anchor nNOS to the sarcolemma and enhance exercise performance in a mouse model of muscular dystrophy. J. Clin. Investig. 2009, 119, 624–635. [Google Scholar] [CrossRef]
- Wasala, L.P.; Watkins, T.B.; Wasala, N.B.; Burke, M.J.; Yue, Y.; Lai, Y.; Yao, G.; Duan, D. The Implication of Hinge 1 and Hinge 4 in Micro-Dystrophin Gene Therapy for Duchenne Muscular Dystrophy. Hum. Gene Ther. 2023, 34, 459–470. [Google Scholar] [CrossRef]
- Bönnemann, C.G.; Belluscio, B.A.; Braun, S.; Morris, C.; Singh, T.; Muntoni, F. Dystrophin Immunity after Gene Therapy for Duchenne’s Muscular Dystrophy. N. Engl. J. Med. 2023, 388, 2294–2296. [Google Scholar] [CrossRef]





| Antigene | Epitope | Ref | Diluition | ||
|---|---|---|---|---|---|
| Capillary Western Blot | Immunofluore-Scence | ELISA | |||
| Dystrophin | N-term specific antibody | Leica Cat#NCL-DYSB, RRID:AB_563691 | 1/20 | 1/10 | / |
| C-term specific antibody | DSHB Cat#MANCHO11(9F2), RRID:AB_2618131 | 1/100 | / | / | |
| Laminin | Polyclonal | Thermo Fisher Scientific Cat# PA5-115490, RRID:AB_2900126 | / | 1/100 | / |
| Myomesin-3 | Polyclonal | Proteintech Cat#17692-1-AP, RRID:AB_2146624 | / | / | 1/100 |
| Amplified Region | Name | Sequence (5′->3′) | Probe | Target Vector |
|---|---|---|---|---|
| Spectrin-like region 1 | R1_Forward | CCAGGGAGAGATCAGCAATG | / | Midi-Dys 1 Midi-Dys 2 Midi-Dys 3 |
| R1_Reverse | GGCTGTTAGGTCCATCATGTAG | / | ||
| R1_Probe | GGCTGTTAGGTCCATCATGTAG | FAM | ||
| Spectrin-like region 24 | R24_Forward | ACAGATGAGCTGGACCTGAA | / | Midi-Dys 1 Midi-Dys 2 Midi-Dys 3 |
| R24_Reverse | TGGTCCTGTAGGCTGTCAAT | / | ||
| R24_Probe | CTGAGGCAGGCTGAGGTGATCAAG | VIC | ||
| Mouse Titin exon 5 | TitinMex5_Forward | TTCAGTCATGCTGCTAGCGC | / | genomic DNA |
| TitinMex5_Reverse | AAAACGAGCAGTGACGTGAGC | / | ||
| TitinMex5_Probe | TGCACGGAAGCGTCTCGTCTCAGTC | 5Cy5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Palmieri, L.; Ferrand, M.; Vu Hong, A.; Richard, I.; Albini, S. In Silico Structural Prediction for the Generation of Novel Performant Midi-Dystrophins Based on Intein-Mediated Dual AAV Approach. Int. J. Mol. Sci. 2024, 25, 10444. https://doi.org/10.3390/ijms251910444
Palmieri L, Ferrand M, Vu Hong A, Richard I, Albini S. In Silico Structural Prediction for the Generation of Novel Performant Midi-Dystrophins Based on Intein-Mediated Dual AAV Approach. International Journal of Molecular Sciences. 2024; 25(19):10444. https://doi.org/10.3390/ijms251910444
Chicago/Turabian StylePalmieri, Laura, Maxime Ferrand, Ai Vu Hong, Isabelle Richard, and Sonia Albini. 2024. "In Silico Structural Prediction for the Generation of Novel Performant Midi-Dystrophins Based on Intein-Mediated Dual AAV Approach" International Journal of Molecular Sciences 25, no. 19: 10444. https://doi.org/10.3390/ijms251910444
APA StylePalmieri, L., Ferrand, M., Vu Hong, A., Richard, I., & Albini, S. (2024). In Silico Structural Prediction for the Generation of Novel Performant Midi-Dystrophins Based on Intein-Mediated Dual AAV Approach. International Journal of Molecular Sciences, 25(19), 10444. https://doi.org/10.3390/ijms251910444

