Next Article in Journal
Assessment of Skimmed Milk Flocculation for Bacterial Enrichment from Water Samples, and Benchmarking of DNA Extraction and 16S rRNA Databases for Metagenomics
Previous Article in Journal
Genetic Diversity Analysis and Fingerprint Construction for 87 Passionfruit (Passiflora spp.) Germplasm Accessions on the Basis of SSR Fluorescence Markers
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 25
Issue 19
10.3390/ijms251910812
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization and Expression of the Cytochrome P450 Genes in Daphnia magna Exposed to Cerium Oxide Nanoparticles

by
Xinyi Kang
,
Yan Zhou
,
Qi Liu
,
Miao Liu
,
Jing Chen
,
Yuanwen Zhang
,
Jie Wei
* and
Yuan Wang
*
Key Laboratory of Hydrobiology in Liaoning Province, Dalian Ocean University, Dalian 116021, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(19), 10812; https://doi.org/10.3390/ijms251910812
Submission received: 10 September 2024 / Revised: 1 October 2024 / Accepted: 4 October 2024 / Published: 8 October 2024
(This article belongs to the Section Molecular Nanoscience)
Browse Figures
Versions Notes

Abstract

:
As cerium oxide nanoparticles (nCeO2) continue to infiltrate aquatic environments, the resulting health risks to exposed aquatic organisms are becoming evident. Cytochrome P450 (CYP) enzymes are integral to the detoxification processes in these species. Herein, we conducted a genomic analysis of CYPs in Daphnia magna, encompassing phylogenetic relationships, gene structure, and chromosomal localization. We identified twenty-six CYPs in D. magna, categorizing them into four clans and seven families, distributed across six chromosomes and one unanchored scaffold. The encoded CYP proteins varied in length from 99 to 585 amino acids, with molecular weights ranging from 11.6 kDa to 66.4 kDa. A quantitative real-time PCR analysis demonstrated a significant upregulation of CYP4C1.4, CYP4C1.5, CYP4C1.6, CYP4c3.3, and CYP4c3.6 in D. magna exposed to 150 mg/L nCeO2 for 24 h. The transcript levels of CYP4C1.3, CYP18a1, CYP4C1.1, and CYP4c3.9 were notably downregulated in D. magna exposed to 10 mg/L nCeO2 for 48 h. A further transcriptomic analysis identified differential expression patterns of eight CYP genes, including CYP4C1.3, in response to nCeO2 exposure. The differential regulation observed across most of the 26 CYPs highlights their potential role in xenobiotic detoxification in D. magna, thereby enhancing our understanding of CYP-mediated toxicological responses to metal nanoparticles in aquatic invertebrates.

1. Introduction

Cerium oxide nanoparticles (nCeO2) represent a critical class of engineered metal oxide nanomaterials [1]. nCeO2 finds extensive applications across diverse sectors such as the energy, chemical, biomedical, and environmental fields [2,3]. Projections indicate that by 2050, the annual production of nCeO2 will reach approximately 10,000 tons [4]. Consequently, it is estimated that the technosphere (e.g., landfills, waste disposal) receives up to 4000 tons of nCeO2 annually, while the ecosphere (waters, soil, air) receives up to 300 tons [5]. Once unleashed into aquatic environments, nCeO2 may exhibit potential toxicity to a wide diversity of organisms, including various invertebrates [6]. Research has demonstrated that nCeO2 exhibits both acute and chronic toxicity to a spectrum of aquatic organisms, including the cladoceran Daphnia magna [5], freshwater bivalve Dreissena polymorpha [7], rainbow trout Oncorhynchus mykiss [8], zebrafish Danio rerio [9], and microcrustacean Chydorus sphaericus [6]. nCeO2 may induce harmful effects across various trophic levels, including modifications in brain enzyme activity, genotoxicity, embryotoxicity, and histopathological damage to target organs in aquatic organisms such as the goldfish Carassius auratus [10], microalga Pseudokirchneriella subcapitata [11], D. rerio [6], planarian Dugesia japonica [12], and O. mykiss [8].
The primary adverse physiological effects observed in aquatic organisms [13] exposed to nCeO2 include detrimental impacts on fitness-related traits such as reproduction, immunity [14], swimming performance [7], growth, and development [7,15]. Owing to its redox properties, which facilitate the transition between Ce3+ and Ce4+ oxidation states, nCeO2 can function as either an antioxidant or a reactive oxygen species (ROS) producer within cells [1,7]. nCeO2 is capable of inducing ROS generation [15,16], apoptosis [17], autophagy, and inflammation [18] at the cellular level. Even at low levels, nCeO2-induced increases in ROS under oxidative stress conditions can result in premature cell cycle interruption or differentiation in progenitor cells. This leads to ROS-induced apoptosis, which in turn causes abnormal development during zebrafish embryogenesis [19]. Previous research demonstrated that exposure to nCeO2 disrupted antioxidant capacity at the molecular level, increased DNA damage, and reduced stem cell proliferation in D. japonica [12]. Transcriptomic analysis of the microalga Chlamydomonas reinhardtii exposed to nCeO2 revealed the identification of Ce ion-specific genes (Cre17g.737300, MMP6, GTR12, and HSP22E) and two oxidative stress biomarkers (APX1 and GPX5) associated with nCeO2 toxicity [20].
The cytochrome P450 (CYP) superfamily comprises heme-containing enzymes with monooxygenase, peroxidase [21], and peroxygenase activities, playing a crucial role in phase I of xenobiotic metabolism [22]. CYPs possess a heme domain and, during a catalytic cycle, utilize a redox protein or domain to facilitate the transfer of electrons from NAD(P)H to the heme iron [23]. CYPs catalyze the introduction of oxygen atoms into lipophilic compounds, thereby enhancing their solubility and facilitating excretion [24,25]. These enzymes are capable of metabolizing a variety of substances, including drugs, heavy metals, Bisphenol A (BPA) [26,27], polycyclic aromatic hydrocarbons (PAHs) [28], trichlorfon [29], and benzo[α]pyrene (B[α]P) [22,30], into nontoxic products such as dihydrodiol, phenolic, and epoxide intermediates in aquatic organisms [30]. This detoxification process is essential for safeguarding organisms against the deleterious effects of environmental contaminants. Based on amino acid sequence similarities and phylogenetic relationships [31], CYP genes are categorized hierarchically into clans, families, and subfamilies [29,32,33]. CYPs families 1–3, along with certain members of CYP4 family, are primarily responsible for the detoxification and metabolization of xenobiotics [33], including drugs, heavy metals, and chemical toxicants. CYPs families 5–51 work a vital role in the metabolic processes of endogenous molecules, including steroids and fatty acids [29,34]. Numerous CYP genes have been identified in various aquatic species, including the sea squirt Ciona robusta [35], carp Cyprinus carpio L. [36], cladoceran Diaphanosoma celebensis [22], crayfish Faxonius virilis [37], spotted sea bass Lateolabrax maculatus [29], and lobster Panulirus ornatus [33], and their roles in detoxification have been extensively studied.
Previous studies have demonstrated that CYP genes’ expression in response to various stressors, such as temperature, hypoxia [29], and toxicants [27], underscore the adaptive mechanisms of aquatic organisms. Benzophenones can significantly upregulate CYP3A65 gene expression in zebrafish larvae, potentially mediating the oxidative metabolism of estrogen, thereby increasing DNA damage [38]. Overexpression of stress-responsive genes CYP1A and CYP1B has led to the detoxification and bioactivation of B[α]P in black rockfish (Sebastes schlegelii) [30]. BPA regulated CYP1B1 expression by downregulating miR-27b-3p, inducing oxidative stress and apoptosis via the mitochondrial pathway in carp spleen lymphocytes [26]. Significant decreases in zebrafish CYP19a1a expression at 1000 µg/L concentration of BPA reduced oocyte maturation and altered normal oogenesis, demonstrating that CYP19a1a plays a crucial role in estrogen synthesis [27]. CYP18A1 and CYP15A1 can catalyze the epoxidation of methyl farnesoate to juvenile hormone in zebrafish exposed to BPA [33]. In the oyster Crassostrea brasiliana, the CYP2AU1 gene is involved in phenanthrene metabolism [39], while novel CYP3A isoforms in the marine mussel Mytilus coruscus respond to cadmium and B[α]P exposure [40]. The upregulation of four CYP1 genes, namely CYP1A, CYP1B, CYP1C1, and CYP1C2, in S. schlegelii exposed to PAHs underscores the crucial role of these enzymes in responding to toxic compounds [30]. These findings emphasize the importance of CYPs in the adaptive responses of aquatic animals to toxicants.
D. magna is a pivotal model organism in ecotoxicological studies owing to its sensitivity to environmental stressors, rapid life cycle, and ease of laboratory culture [41,42]. Previous evaluations of the toxicity effects of metal oxide nanoparticles revealed that ZnO, TiO2, CuO, CeO2, and SiO2 adversely impacted the morphology, development, reproduction, and lifespan of D. magna [5,43,44,45]. Recent studies have also explored the cytotoxicity [46] and multigenerational toxicological effects [47] of binary mixtures of silver nanoparticles and glyphosate on D. magna, revealing that co-toxicity induces significant biochemical responses indicative of oxidative damage. This damage adversely affects the acclimatization and survival of D. magna and negatively impacts the growth and reproduction of offspring [5,48]. To investigate the molecular responses of CYP genes to various xenobiotics, qPCR and RNA-seq analyses were performed on D. magna. The findings demonstrated that exposure to chlorpyrifos, a pesticide, and paraquat, a herbicide, markedly upregulated the expression of CYP360A8 [49,50], while sublethal concentrations of benzotriazole elicited a comparable upregulation of CYP4C3 expression [51]. Nevertheless, the roles of CYP genes in mediating tolerance to various metal nanoparticle stresses in aquatic organisms remain understood. Herein, we performed a comprehensive genome-wide identification of the CYP gene family in D. magna and further examined their expression profiles following exposure to nCeO2.
The objectives of this study were: (1) to characterize CYP genes in the D. magna genome based on their sequence conservation, chromosomal location, structure, and phylogenetic relationships, (2) to assess the transcriptional regulation of CYP genes in D. magna upon nCeO2 exposure through quantitative PCR and transcriptomic data, and (3) to evaluate the involvement of CYPs in the detoxification and stress response pathways of D. magna. By characterizing the transcriptional profiles of selected CYP genes, we will attempt to reveal the mechanisms underlying nCeO2-induced toxicity and define the genes that may be used as bioindicators for environmental surveillance. This research will help in the identification of the toxic effects of metal oxide nanoparticles in aquatic invertebrates.

2. Results

2.1. Identification of CYP Genes Family Members in Daphnia magna

We identified CYPs in the D. magna genome based on the transcriptomic data and using BLAST and HMM methods of D. magna CYPs. The presence of the cytochrome P450 domain (PF00067) was verified in all 26 identified CYP genes using both Pfam and Conserved Domain Database (CDD) approaches (Table 1). The CYP genes molecular function in D. magna was shown in Table 1. The molecular function of the 26 CYP genes is similar in each clan: the main function of Clan 2 is steroid hydroxylase activity, Clan 3 and Clan 4 mainly exerts monooxygenase activity and oxidoreductase activity, and Mitochondrial Clan involved in ecdysone biosynthesis process and midgut development. The coding sequence lengths, molecular weights (MWs), subcellular localizations, and isoelectric points (PIs) of these CYP proteins are detailed in Table 2. Among the identified CYP proteins, CYP3A19 was the smallest, comprising only 99 amino acids (aa), while CYP18a1 was the largest with 585 aa. The MWs of these CYP proteins ranged from 11.6 kDa (CYP3A19) to 66.4 kDa (CYP306a1). Among the twenty-six CYP proteins, nine were predicted to localize to the endoplasmic reticulum, ten to the plasma membrane, three to the extracellular space, and four to the mitochondria. The PIs of these CYP proteins ranged from 5.93 (CYP4C1.3) to 9.43 (CYP2C15) (Table 2).

2.2. Chromosomal Distribution of CYPs in Daphnia magna

The CYPs of D. magna were distributed across six chromosomes and one unanchored scaffold (Figure 1). These CYP genes were unevenly distributed among the seven distinct chromosomes, with each chromosome containing between one and eighteen genes. The highest concentration of CYP genes, totaling sixteen, was found on chromosome LG7. In contrast, chromosomes LG3, LG6, LG9, and the unanchored scaffold each harbored only a single CYP gene. However, some CYP genes from the same family were dispersed across different chromosomes in D. magna. For instance, CYP4 family members were distributed across four chromosomes—LG5, LG6, LG7, LG9—and the unanchored scaffold.

2.3. Phylogenetic Analysis of CYPs

To elucidate the evolutionary relationships of the identified CYPs in D. magna and other species, a circular phylogenetic tree was constructed using MEGA 11 software, depicting the evolutionary history of CYP proteins across species including D. magna, Penaeus chinensis, Drosophila innubila, Daphnia pulex, Danio rerio, Mus musculus, Homo sapiens, and Eriocheir sinensis (Figure 2). The twenty-six CYP proteins clustered into four distinct clans (Clan 2, Clan 3, Clan 4, and the mitochondrial clan). D. magna CYP proteins were predominantly found in Clan 2 and Clan 4, comprising four and nineteen proteins, respectively, with only one protein in Clan 3 and two proteins in the mitochondrial clan. Seven CYP proteins from D. magna (CYP3A19, CYP18a1, CYP306a1, CYP2C15, CYP315a1, CYP302a1, and CYP4c3.3) were clustered within a phylogenetic clade alongside homologous CYP proteins from D. pulex. The taxonomic relationships based on CYP proteins showed that mammals such as H. sapiens and M. musculus were clustered into one distinct group, whereas D. magna and D. pulex formed another.

2.4. Motifs and Structures of CYPs in Daphnia magna

Fifteen conserved motifs were identified in the D. magna CYP proteins through MEME analysis (Figure 3A–C). The majority of these motifs were conserved throughout the D. magna CYPs, with four motifs (1, 9, 13, and 14) localized to the C-terminal and another four (6, 8, 10, and 15) situated at the N-terminal. Among the eight conserved motifs, three (motifs 1, 8, and 13) contained functionally characterized domains (Figure 3A). Motif 1 contained the core catalytic center, encompassing the heme-binding motif (FxxGxRxCxG), where cysteine (C) acts as the axial ligand to the thiolate heme. Motif 5 contained the C-helix motif (WxxxR), where the W and R residues contribute to interactions with the propionate side chain of the heme [52]. Motif 6 encompassed the consensus sequence (A/G)Gx(E/D)T(T/S) of the I-helix motif, which is involved in oxygen binding and activation. Motif 8 included a proline-rich region with the consensus sequence (P/I)PGPx(P/G)xP, considered essential as a membrane hinge critical for the proper orientation of CYP enzymes to the membrane. Motifs 11 and 13 featured the K-helix motif (ExxR) and PERF motif (PxRx), respectively (Figure 3A,B).
A phylogenetic tree was constructed for the D. magna CYP genes, with corresponding motifs and domains displayed adjacent to each gene (Figure 3C). Analysis using MEME motifs revealed that the fewest motifs were observed in proteins from Clan 2, Clan 3, and the Mitochondrial Clan. In Clan 2, only motifs 1, 2, 5, and 13 were identified. Within the Mitochondrial clan, only motifs 1, 2, 4, 13, and 15 were detected. Notably, Clan 3, containing a single member, possessed only motifs 1 and 9. Most CYP proteins within Clan 4 possessed all 15 motifs (Figure 3C). Further domain analysis showed that the majority of CYP genes contained CYP4 and cytochrome P450 superfamily domains (Figure 3C). Only two CYP genes within the Mitochondrial Clan harbored the conserved structural domain CYP24A1-like. Clan 4 exhibited the highest exon count, with CYP4C1.9 containing 18 exons, making it the longest gene among all CYP genes. The exon count within Clan 2 and the Mitochondrial Clan varied between six and nine. Genes within the same clan displayed a similar exon count (Figure 4).

2.5. Gene Expression Analysis of CYP Genes in Daphnia magna Exposed to nCeO2

We investigated the expression levels of the CYP gene family in response to nCeO2 stress in D. magna. The transcriptomic data of eight of the eleven genes belonging to the CYP family are consistent with qPCR results (Figure 5A,B). Six of these genes, CYP4C1.4, CYP18a1, CYP302a1, CYP306a1, CYP315a1, and CYP2C15, were downregulated. Two of these genes, CYP4c3.3 and CYP4C1.6, were upregulated. CYP2C15 and CYP4C1.8 were the highest expressed in nCeO2 at concentrations of 10 mg/L and 50 mg/L at 24 h, respectively (Figure 5B). CYP4C1.5 had the highest expression in nCeO2 at a concentration of 150 mg/L at 24 h; the mRNA level of CYP4C1.5 was 24-, 6-, and 5-times higher than that concentration of 0, 10, and 50 mg/L at 24 h nCeO2, respectively. However, as the exposure time progressed to nCeO2, most CYP expression levels decreased, and CYP4C1.3 showed the lowest expression in nCeO2 at a concentration of 10 mg/L at 48 h, the expression of CYP4C1.3 lower than that concentration of 0, 50, and 150 mg/L at 48 h nCeO2 by -26, -4, and 87 times, respectively. Among the 26 genes, CYP4c3.8 had a slight expression in most situations. The expression levels of all CYPs belonging to the mitochondrial clan remained low at both time points and only slightly elevated at a concentration of nCeO2 150 mg/L at 24 h (Figure 5A,B)

3. Discussion

Engineered metal oxide nanoparticles, including nCeO2, are widely employed across a range of industries and consumer products, leading to their inevitable release into the environment [53]. Once in aquatic ecosystems, nCeO2 can interact with and be absorbed by aquatic organisms, potentially leading to toxic effects [54]. Empirical studies have demonstrated that nCeO2 induces cellular damage, oxidative stress, and inflammatory responses in aquatic species [8,54]. Elucidating the molecular mechanisms underpinning these effects is pivotal for evaluating the ecological risks associated with metal oxide nanoparticle exposure [55]. CYP enzymes play a key role in the detoxification of harmful substances, including heavy metals, BPA, PAHs, B[α]P, and trichlorfon [26,27,28,29,30], in aquatic species [56]. Investigating the characterization and expression profiles of CYP genes in D. magna subjected to nCeO2 exposure offers critical insights into the molecular mechanisms underlying nanoparticle-induced toxicity.
We identified 26 CYP genes in the D. magna genome using a combination of BLAST search, HMM modeling (PF00067), and NCBI-CDD analysis. This finding is consistent with the CYP gene count observed in other invertebrates, such as the Ornate Spiny Lobster Panulirus ornatus [33] and marine rotifer Brachionus rotundiformis [25], but is lower than those found in vertebrates like zebrafish Danio rerio [34] and black rockfish Sebastes schlegelii [30]. The 26 identified CYPs, including CYP2, CYP4, and CYP316, are primarily localized in the endoplasmic reticulum, mitochondria, and Golgi apparatus (Table 2). These CYPs are hydrophilic proteins with GRAVY coefficients below zero, which is consistent with their roles in cellular detoxification and metabolic processes (Table 2). CYP3A19, the smallest member identified, consists of only 99 amino acids (aa). It is hypothesized to be either a homologous protein or a partial fragment of the CYP, necessitating further investigation to elucidate the structure and function of CYP3A19. These genes are mapped to chromosomes 1–7 and 9 of D. magna (Table 2, Figure 1). Clan 4, the largest subgroup of CYPs in D. magna, is characterized by gene clusters distributed across all five chromosomes of the species. Gene clustering, indicative of duplication events, is most pronounced in Clan 4, which is predominantly located on the LG7 chromosome linkage group in D. magna (Figure 1). This suggests that extensive duplication events have occurred within the CYP4 clan genes on these chromosomes.
Based on sequence homology and evolutionary relationships among seven species, including D. magna and D. pulex, CYP genes in D. magna are predominantly organized into four clans (namely CYP 2–4 and the mitochondrial clan), seven families, and eight subfamilies, with each CYP gene associated with distinct functions (Table 1 and Table 2). CYP genes have been more conserved throughout the evolutionary transition from invertebrates to vertebrates [57]. Additionally, it has been demonstrated that only two-thirds of the P450 gene family is shared between D. magna and D. pulex [32,58]. The clan CYP1 is absent in invertebrates [25], including D. magna. CYP1 genes have been employed as environmental biomarkers for monitoring aquatic pollution [22]. For instance, CYP1A mRNA expression was significantly elevated in the liver of juvenile Sebastes schlegelii following exposure to 100 mg/kg oil for 12 h [30]. In marine medaka (Oryzias melastigma), the transcriptional level of CYP1 has been significantly upregulated in response to β-NF and B[α]P [22]. In channel catfish (Ictalurus punctatus), CYP1B1 exhibited high levels of expression in the gills, liver, blood, and gonads following exposure to B[a]P (benzo [a]pyrene) [30]. This diversity may be attributable to the variability and extent of evolutionary divergence of CYPs among species and their involvement in diverse physiological processes. The phylogenetic tree also indicated a higher similarity between CYPs sequences of D. magna and D. pulex than other organisms; as D. magna and D. pulex are from the same Daphnia, they would be expected to have much more similarity than species (Figure 2). The D. magna CYP2C15, together with human CYP2C8, CYP2C18, CYP2C9, and CYP2C19, were classified as family 2 homologous proteins and clustered within the Clan 2 clade in the phylogenetic analysis (Figure 2). These results suggest that CYP gene clusters across species may have evolved along divergent evolutionary pathways.
CYPs constitute a biologically ubiquitous mega-protein family characterized by diverse protein structures and functions. Although the amino acid sequences of different families vary, the domain generally comprises a folded structure at the N-terminal end and a helical bundle at the C-terminal end [23,52]. The functional structural domains of CYPs are highly conserved, particularly the electron-accepting heme-binding site (Figure 3A–C), which includes an invariant cysteine residue forming a thiolate ionic bond with iron, as well as helix C, which forms an electron zipper with heme, and helix K, which stabilizes motifs 1, 3, 6, and 7, conserved motifs shared by 16 CYPs in D. magna (Figure 3C). The 17 CYPs identified in D. magna possess the CYP4 domain. By analyzing the positions of the motifs within the CYP genes sequences, we discovered that these five motifs (motif 1, 3, 7, 11, and 13) are situated within the CYP4 domain, suggesting that these sites are closely related to the biological functions of the kinases and are thus evolutionarily conserved. The CYP genes belonging to the same subfamily were similar in gene structure and conserved motifs, indicating that the genes of the same subfamily may perform similar functions in cellular activities of D. magna (Figure 4). There were obvious differences in gene structure and conserved motifs among different subfamilies, indicating that different subfamilies may play different roles in the physiological activities of D. magna (Figure 4).
Metal oxide nanoparticles can induce oxidative stress and disrupt cellular homeostasis in exposed organisms, leading to the upregulation of detoxification pathways, particularly those involving CYP enzymes [59]. RNA-seq data have facilitated the identification of numerous CYP genes in species such as the Javanese medaka (Oryzias javanicus) [28], zebrafish (Danio rerio) [27] and Spotted sea bass (Lateolabrax maculatus) [29]. Our results demonstrate significant modulation of multiple CYP genes in D. magna following exposure to nCeO2 (Figure 5A,B). Specifically, certain genes were upregulated, indicating an active response to the oxidative stress induced by metal oxide nanoparticles. Notably, the upregulation of specific CYP genes, such as CYP4 and CYP370, suggests their involvement in the organism’s detoxification processes. CYP2 and CYP4 have been identified as playing significant roles in the detoxification processes of invertebrates under xenobiotic stress [60]. Our findings demonstrate that exposure to nCeO2 induces the expression of several CYP genes in D. magna. Specifically, genes such as CYP18A1, CYP2K4, and CYP306a1, which belong to the Clan 2, exhibited downregulation at 48 h exposed to nCeO2 (Figure 5B). This downregulation at various exposure times indicates a robust detoxification response to nCeO2, suggesting that these genes play a critical role in metabolizing and mitigating the toxic effects of nCeO2. The observed dysregulation patterns align with previous studies where various CYP genes in aquatic organisms were induced by exposure to metal oxide nanoparticles, reinforcing the potential of these genes as biomarkers for environmental monitoring.
Our findings demonstrate that exposure to nCeO2 induces the expression of several CYP genes in D. magna (Figure 5A,B). CYP1A was significantly upregulated in response to gold nanoparticles [59], B[a]P [30], and oxybenzone [38] at earlier exposure times, underscoring its broad-spectrum role in detoxification processes. Cyp306A1 and Cyp307A1, conserved Halloween genes, play crucial roles in the ecdysteroid biosynthetic pathway, which is associated with molting and metamorphosis in invertebrates [22,32]. Cyp17a1, which efficiently converts progesterone and pregnenolone to androstenedione and dehydroepiandrosterone in Nile tilapia (Oreochromis niloticus), is believed to play essential roles in steroidogenesis [61]. Higher expression of CYP3C1 was detected in zebrafish brains at both 48 and 120 h of embryonic development, suggesting that CYP3C1 is associated with early brain development [34]. The observed upregulation of specific CYP genes, such as CYP4C1 and CYP4c3, in response to nCeO2 exposure is analogous to the increased expression of CYP genes in response to other stressors, such as toxicants [62] and pollutants [63], in various aquatic organisms. The CYPs are evolutionarily conserved, indicating that D. magna CYPs could be implicated in the stress response to metal oxide nanoparticles by regulating critical cell processes, such as redox balance [56], apoptosis [26], and autophagy [36].

4. Materials and Methods

4.1. Experimental Materials and Toxicity Treatment

D. magna specimens were obtained from the Key Laboratory of Hydrobiology at Dalian Ocean University, Liaoning Province, China. The adults used in the experiments were synchronously released from a laboratory-cultured clonal line, which was initiated with a single parthenogenetic female. Experiments utilized three to six brooding offspring. Neonates or adults selected for experimentation were cultured in dechlorinated water within 1000 mL glass beakers and were maintained in an illumination incubator (Thermo Fisher, Dreieich, Germany). Cultures were maintained under an 18 h: 6 h light/dark photoperiod and at a temperature of 22 ± 2 °C. The light intensity parameter of the experimental animal culture was set to 2000 lux. The total hardness, alkalinity, dissolved oxygen, and pH of culture water were 7.29 ± 0.1 mmol/L, 12.48 ± 0.4 mmol/L, 7.96 ± 0.3 mg/L, and 7.8 ± 0.2, respectively. D. magna fed 2.5 × 106 cells of the single-celled green algae Tetradesmus obliquus daily.
Cerium (IV) oxide nanoparticles (CAS No: 1306-38-3, MW: 172.11 g/mol, nominal size < 50 nm, purity 99.95%, manufacturer’s data) was bought from Sigma-Aldrich (St. Louis, MO, USA). The dry nCeO2 powder was stored in the dark at 24 °C, and stock suspensions were freshly prepared prior to each use. For whole-animal exposure treatments, stock suspensions were prepared by dispersing nCeO2 in 500 mL of dechlorinated water, followed by sonication using a KQ3200DE Sonic Dismembrator (Kunshan Ultrasound Instrument Co., Ltd. Suzhou, China) at full power for 30 min to achieve a final concentration of 1 mg/mL [11].
Experimental groups were established, including a blank control and nCeO2 treatment groups at concentrations of 10, 50, and 150 mg/L for 24 h and 48 h exposures. Each group was replicated four times to mitigate the impact of variability on the results. Approximately 50 D. magna were collected from each group and transferred to 1.5 mL EP tubes for RNA extraction. Adult D. magna specimens, with an average length of 2.67 ± 0.05 mm, were utilized for the toxicity exposure tests.

4.2. Identification of CYPs in Daphnia magna

D. magna genome sequences (assembly ASM2063170v1.1: Daphnia magna—Assembly—NCBI) were obtained from the National Center for Biotechnology Information (NCBI). To seek for candidate CYPs, first, the corresponding amino acid sequences were obtained using the BLAST search. Moreover, the HMM profile for CYP domains (PF00067) was obtained from the Pfam protein family database and used in Tbtools to search for putative D. magna CYPs. The existence of conserved CYP domains was also confirmed by using Tbtools and the Conserved Domain Database (CDD) from NCBI. The basic protein characteristics, such as the sequence length, molecular weight, and isoelectric point (pI) were predicted by using Compute pI/MW tool from the ExPASy server. The cellular compartmentalization of CYP450 proteins was predicted with WOLF PSORT. Finally, the localization of CYPs on chromosomes was determined using TBtools, with the help of genomic data from the D. magna database.

4.3. Transcriptomic Analysis of CYPs in Daphnia magna Exposed to nCeO2

The transcriptome sequencing data for D. magna have been deposited in the NCBI SRA database (PRJNA983527). This dataset provides a detailed analysis of gene expression differences in D. magna exposed to 50 mg/L of nCeO2 for 48 h. The data presented in this study are openly available in the NCBI SRA database (PRJNA983527) accessed on 2 July 2025.

4.4. Chromosomal Distribution

The chromosomal distribution of most CYPs in D. magna was mapped using TBtools based on location information obtained from the D. magna genome database.

4.5. Phylogenetic Tree

Multiple sequence alignments of predicted CYP protein sequences were performed using ClustalW and Weblogo with default settings. A phylogenetic analysis was conducted using MEGA 11 software (Pennsylvania State University, Philadelphia, PA, USA), employing the neighbor-joining method, and based on CYP amino acid sequences from eight species: D. magna, Penaeus chinensis, Drosophila innubila, Daphnia pulex, Danio rerio, Mus musculus, Homo sapiens, and Eriocheir sinensis. The robustness of the phylogenetic tree was assessed using 1000 bootstrap replicates, and the final tree was refined and visualized with the Evolview platform (https://evolgenius.info/evolview-v2/) accessed on 30 September 2024.

4.6. Structure and Motifs of CYP Genes in Daphnia magna

The gene structure of CYPs was analyzed using TBtools by examining their coding sequences. To identify the conserved motifs within the CYP protein family in D. magna, the MEME 5.5.4 tool (https://meme-suite.org/meme/tools/meme) accessed on 9 July 2024 was employed, setting the maximum number of motifs to 15, with all other parameters kept at default settings. The conserved motifs identified were subsequently visualized using TBtools 2.003 (TB-Tools, Ningbo, China) based on the output MAST.XML files generated using the MEME suite.

4.7. Quantitative Real-Time PCR (qPCR) Analysis

RNA was isolated from each D. magna sample using TRIzol reagent (Sangon Biotech, Shanghai, China) and purified with phenol–chloroform and ethanol precipitation. The concentration and quality of RNA were measured by NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Wilmington, NC, USA). Reverse transcription PCR was performed using the Evo M-MLV RT Kit (Accurate Biotechnology Co., Ltd., Changsha, China) following the manufacturer’s protocol. The qPCR analysis was conducted using an Applied Biosystems™ 7500 RT-PCR System (Agilent Technologies, Santa Clara, CA, USA) and a SYBR® Green Premix Pro Taq HS qPCR Kit (Rox Plus) obtained from Accurate Biotechnology Co., Ltd. Specific CYP gene primers were designed using the NCBI Primer-BLAST tool (Table 3). D. magna β-actin was used as the internal control gene [64]. The expression levels of the CYP genes were then compared to the control group using the 2−∆∆Ct method. All reactions were performed in three biological replicates and technical replicates for each biological replicate. Statistical analysis of CYP gene expression between the control and nCeO2-treated groups was conducted using Excel 2016 (Microsoft, Redmond, WA, USA) for the t-test and GraphPad 8.0.2 (GraphPad Software, San Diego, CA, USA) for the one-way ANOVA. A p-value of less than 0.05 was considered to indicate a statistically significant difference between the treated and control groups.

5. Conclusions

Comprehensive genome-wide identification and expression profiling of the CYPs superfamily in D. magna exposed to nCeO2 has yielded critical insights into the adaptive responses of these genes and their potential utility as biomarkers in environmental surveillance. The twenty-six identified CYP genes in D. magna are unevenly distributed across seven distinct subfamilies. CYP enzymes are implicated in diverse cellular processes such as maintaining redox homeostasis, regulating apoptosis, and inducing autophagy, playing vital roles in growth, development, and stress resilience in D. magna. nCeO2 exposure in D. magna profoundly altered the expression of several CYP genes, such as CYP4C1.3, CYP18a1, CYP4C1.1, and CYP4c3.9, which may consequently perturb critical CYP-driven physiological functions. This study establishes a foundation for further investigations into the molecular mechanisms governing xenobiotic detoxification and stress adaptation in aquatic invertebrates.

Author Contributions

Conceptualization, X.K. and Y.Z. (Yan Zhou); methodology, X.K.; software, Y.W.; validation, Y.W., J.W. and X.K.; formal analysis, Q.L. and M.L.; investigation, J.C.; resources, X.K.; data curation, X.K.; writing—original draft preparation, Y.W.; writing—review and editing, Y.W.; visualization, Y.W.; supervision, X.K., Y.Z. (Yan Zhou), Q.L., M.L., J.C., Y.Z. (Yuanwen Zhang), Y.W. and J.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the National Natural Science Foundation of China (42077226), and Research Project of Education Department of Liaoning Province (LJKMZ20221102).

Institutional Review Board Statement

This study did not involve human or animal participants and therefore did not require Institutional Review Board (IRB) review and approval.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data supporting this study’s findings are available from the corresponding authors upon reasonable request.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

References

  1. Milenković, I.; Radotić, K.; Despotović, J.; Lončarević, B.; Lješević, M.; Spasić, S.Z.; Nikolić, A.; Beškoski, V.P. Toxicity investigation of CeO2 nanoparticles coated with glucose and exopolysaccharides levan and pullulan on the bacterium Vibrio fischeri and aquatic organisms Daphnia magna and Danio rerio. Aquat. Toxicol. 2021, 236, 105867. [Google Scholar] [CrossRef] [PubMed]
  2. Guo, C.; Robertson, S.; Weber, R.J.M.; Buckley, A.; Warren, J.; Hodgson, A.; Rappoport, J.Z.; Ignatyev, K.; Meldrum, K.; Römer, I.; et al. Pulmonary toxicity of inhaled nano-sized cerium oxide aerosols in Sprague–Dawley rats. Nanotoxicology 2019, 13, 733–750. [Google Scholar] [CrossRef] [PubMed]
  3. Liu, Y.; Ma, Y.; Jiao, C.; Liu, M.; Luo, W.; Dong, C.; Fan, S.; He, X.; Yang, F.; Zhang, Z. Comparative toxicity of rod-shaped nano-CeO2 and nano-CePO4 to lettuce. Metallomics 2021, 13, mfab033. [Google Scholar] [CrossRef] [PubMed]
  4. Mauro, M.; Crosera, M.; Monai, M.; Montini, T.; Fornasiero, P.; Bovenzi, M.; Adami, G.; Turco, G.; Larese Filon, F. Cerium Oxide Nanoparticles Absorption through Intact and Damaged Human Skin. Molecules 2019, 24, 3759. [Google Scholar] [CrossRef]
  5. Villa, S.; Maggioni, D.; Hamza, H.; Di Nica, V.; Magni, S.; Morosetti, B.; Parenti, C.C.; Finizio, A.; Binelli, A.; Della Torre, C. Natural molecule coatings modify the fate of cerium dioxide nanoparticles in water and their ecotoxicity to Daphnia magna. Environ. Pollut. 2020, 257, 113597. [Google Scholar] [CrossRef]
  6. Yu, Q.; Wang, Z.; Zhai, Y.; Zhang, F.; Vijver, M.G.; Peijnenburg, W.J.G.M. Effects of humic substances on the aqueous stability of cerium dioxide nanoparticles and their toxicity to aquatic organisms. Sci. Total Environ. 2021, 781, 146583. [Google Scholar] [CrossRef]
  7. Della Torre, C.; Maggioni, D.; Nigro, L.; Farè, F.; Hamza, H.; Protano, G.; Magni, S.; Fontana, M.; Riccardi, N.; Chiara, M.; et al. Alginate coating modifies the biological effects of cerium oxide nanoparticles to the freshwater bivalve Dreissena polymorpha. Sci. Total Environ. 2021, 773, 145612. [Google Scholar] [CrossRef]
  8. Correia, A.T.; Rodrigues, S.; Ferreira-Martins, D.; Nunes, A.C.; Ribeiro, M.I.; Antunes, S.C. Multi-biomarker approach to assess the acute effects of cerium dioxide nanoparticles in gills, liver and kidney of Oncorhynchus mykiss. Comp. Biochem. Physiol. C 2020, 238, 108842. [Google Scholar] [CrossRef] [PubMed]
  9. Jemec, A.; Djinović, P.; Tišler, T.; Pintar, A. Effects of four CeO2 nanocrystalline catalysts on early-life stages of zebrafish Danio rerio and crustacean Daphnia magna. J. Hazard. Mater. 2012, 219–220, 213–220. [Google Scholar] [CrossRef]
  10. Xia, J.; Zhao, H.Z.; Lu, G.H. Effects of selected metal oxide nanoparticles on multiple biomarkers in Carassius auratus. Biomed. Environ. Sci. BES 2013, 26, 742–749. [Google Scholar]
  11. Mahaye, N.; Musee, N. Evaluation of Apical and Molecular Effects of Algae Pseudokirchneriella subcapitata to Cerium Oxide Nanoparticles. Toxics 2023, 11, 283. [Google Scholar] [CrossRef] [PubMed]
  12. Xie, C.; Li, X.; Hei, L.; Chen, Y.; Dong, Y.; Zhang, S.; Ma, S.; Xu, J.; Pang, Q.; Lynch, I.; et al. Toxicity of ceria nanoparticles to the regeneration of freshwater planarian Dugesia japonica: The role of biotransformation. Sci. Total Environ. 2023, 857, 159590. [Google Scholar] [CrossRef] [PubMed]
  13. Issac, M.N.; Kandasubramanian, B. Effect of microplastics in water and aquatic systems. Environ. Sci. Pollut. Res. 2021, 28, 19544–19562. [Google Scholar] [CrossRef]
  14. Gaiser, B.K.; Biswas, A.; Rosenkranz, P.; Jepson, M.A.; Lead, J.R.; Stone, V.; Tyler, C.R.; Fernandes, T.F. Effects of silver and cerium dioxide micro- and nano-sized particles on Daphnia magna. J. Environ. Monit. 2011, 13, 1227–1235. [Google Scholar] [CrossRef]
  15. Savuca, A.; Nicoara, M.N.; Ciobica, A.; Gorgan, D.L.; Ureche, D.; Balmus, I.M. Current Aspects on the Plastic Nano- and Microparticles Toxicity in Zebrafish—Focus on the Correlation between Oxidative Stress Responses and Neurodevelopment. Animals 2023, 13, 1810. [Google Scholar] [CrossRef] [PubMed]
  16. Sugantharaj David, E.M.D.; Madurantakam Royam, M.; Rajamani Sekar, S.K.; Manivannan, B.; Jalaja Soman, S.; Mukherjee, A.; Natarajan, C. Toxicity, uptake, and accumulation of nano and bulk cerium oxide particles in Artemia salina. Environ. Sci. Pollut. Res. 2017, 24, 24187–24200. [Google Scholar] [CrossRef]
  17. Liu, Z.; Wang, X.; Xing, Z.; Xu, P.; Sun, J. Nano-Cerium Oxide Promotes Proliferation of Hepatoma Cells and Regulates mRNA Expression of Apoptosis-Related Genes Bcl-2 and Bax, as Detected Through Real-Time Fluorescent Quantitative Polymerase Chain Reaction. J. Nanosci. Nanotechnol. 2020, 20, 7457–7463. [Google Scholar] [CrossRef]
  18. Yao, M.; Ji, X.; Zhang, Y.; Mao, Z.; Chi, X. miR-99 family is potential target to reverse cerium dioxide nanoparticle-induced placental cell dysfunction. Ann. Transl. Med. 2022, 10, 402. [Google Scholar] [CrossRef]
  19. Sökmen, T.Ö.; Sulukan, E.; Türkoğlu, M.; Baran, A.; Özkaraca, M.; Ceyhun, S.B. Polystyrene nanoplastics (20 nm) are able to bioaccumulate and cause oxidative DNA damages in the brain tissue of zebrafish embryo (Danio rerio). Neurotoxicology 2020, 77, 51–59. [Google Scholar] [CrossRef]
  20. Morel, E.; Dozois, J.; Slaveykova, V.I.; Wilkinson, K.J. Distinguishing the effects of Ce nanoparticles from their dissolution products: Identification of transcriptomic biomarkers that are specific for ionic Ce in Chlamydomonas reinhardtii. Metallomics 2021, 13, mfaa005. [Google Scholar] [CrossRef]
  21. Zhang, Z.; Wen, Z.; Li, K.; Xu, W.; Liang, N.; Yu, X.; Li, C.; Chu, D.; Guo, L. Cytochrome P450 Gene, CYP6CX3, Is Involved in the Resistance to Cyantraniliprole in Bemisia tabaci. J. Agric. Food Chem. 2022, 70, 12398–12407. [Google Scholar] [CrossRef] [PubMed]
  22. Han, J.; Lee, K.W. Identification and response of cytochrome P450 genes in the brackish water flea Diaphanosoma celebensis after exposure to benzo[α]pyrene and heavy metals. Mol. Biol. Rep. 2021, 48, 657–664. [Google Scholar] [CrossRef]
  23. Zhang, L.; Xie, Z.; Liu, Z.; Zhou, S.; Ma, L.; Liu, W.; Huang, J.-W.; Ko, T.-P.; Li, X.; Hu, Y.; et al. Structural insight into the electron transfer pathway of a self-sufficient P450 monooxygenase. Nat. Commun. 2020, 11, 2676. [Google Scholar] [CrossRef] [PubMed]
  24. Zhao, M.; Ma, J.; Li, M.; Zhang, Y.; Jiang, B.; Zhao, X.; Huai, C.; Shen, L.; Zhang, N.; He, L.; et al. Cytochrome P450 Enzymes and Drug Metabolism in Humans. Int. J. Mol. Sci. 2021, 22, 12808. [Google Scholar] [CrossRef] [PubMed]
  25. Han, J.; Park, J.C.; Hagiwara, A.; Park, H.G.; Lee, J.-S. Identification of the full 26 cytochrome P450 (CYP) genes and analysis of their expression in response to benzo[α]pyrene in the marine rotifer Brachionus rotundiformis. Comp. Biochem. Physiol. Part D Genom. Proteom. 2019, 29, 185–192. [Google Scholar] [CrossRef]
  26. Liu, Q.; Wang, W.; Zhang, Y.; Cui, Y.; Xu, S.; Li, S. Bisphenol A regulates cytochrome P450 1B1 through miR-27b-3p and induces carp lymphocyte oxidative stress leading to apoptosis. Fish Shellfish Immunol. 2020, 102, 489–498. [Google Scholar] [CrossRef]
  27. Risalde, M.A.; Molina, A.M.; Lora, A.J.; Ayala, N.; Gómez-Villamandos, J.C.; Moyano, M.R. Immunohistochemical expression of aromatase cyp19a1a and cyp19a1b in the ovary and brain of zebrafish (Danio rerio) exposed to different concentrations of bisphenol A. Aquat. Toxicol. 2021, 237, 105876. [Google Scholar] [CrossRef]
  28. Rusni, S.; Sassa, M.; Takagi, T.; Kinoshita, M.; Takehana, Y.; Inoue, K. Establishment of cytochrome P450 1a gene-knockout Javanese medaka, Oryzias javanicus, which distinguishes toxicity modes of the polycyclic aromatic hydrocarbons, pyrene and phenanthrene. Mar. Pollut. Bull. 2022, 178, 113578. [Google Scholar] [CrossRef]
  29. Liu, C.; Li, J.; Qi, X.; Wang, L.; Sun, D.; Zhang, J.; Zhang, K.; Li, J.; Li, Y.; Wen, H. Cytochrome P450 superfamily in spotted sea bass: Genome-wide identification and expression profiles under trichlorfon and environmental stresses. Comp. Biochem. Physiol. D 2023, 46, 101078. [Google Scholar] [CrossRef]
  30. Woo, S.J.; Chung, J.K. Cytochrome P450 1 enzymes in black rockfish, Sebastes schlegelii: Molecular characterization and expression patterns after exposure to benzo[a]pyrene. Aquat. Toxicol. 2020, 226, 105566. [Google Scholar] [CrossRef]
  31. Pandian, B.A.; Sathishraj, R.; Djanaguiraman, M.; Prasad, P.V.V.; Jugulam, M. Role of Cytochrome P450 Enzymes in Plant Stress Response. Antioxidants 2020, 9, 454. [Google Scholar] [CrossRef]
  32. Baldwin, W.S.; Marko, P.B.; Nelson, D.R. The cytochrome P450 (CYP) gene superfamily in Daphnia pulex. BMC Genom. 2009, 10, 169. [Google Scholar] [CrossRef] [PubMed]
  33. Lewis, C.L.; Fitzgibbon, Q.P.; Smith, G.G.; Elizur, A.; Ventura, T. Ontogeny of the Cytochrome P450 Superfamily in the Ornate Spiny Lobster (Panulirus ornatus). Int. J. Mol. Sci. 2024, 25, 1070. [Google Scholar] [CrossRef] [PubMed]
  34. Loerracher, A.-K.; Braunbeck, T. Cytochrome P450-dependent biotransformation capacities in embryonic, juvenile and adult stages of zebrafish (Danio rerio)—A state-of-the-art review. Arch. Toxicol. 2021, 95, 2299–2334. [Google Scholar] [CrossRef] [PubMed]
  35. Vizzini, A.; Bonura, A.; La Paglia, L.; Fiannaca, A.; La Rosa, M.; Urso, A.; Mauro, M.; Vazzana, M.; Arizza, V. Transcriptomic Analyses Reveal 2 and 4 Family Members of Cytochromes P450 (CYP) Involved in LPS Inflammatory Response in Pharynx of Ciona robusta. Int. J. Mol. Sci. 2021, 22, 11141. [Google Scholar] [CrossRef] [PubMed]
  36. Xu, T.; Liu, Q.; Chen, D.; Liu, Y. Atrazine exposure induces necroptosis through the P450/ROS pathway and causes inflammation in the gill of common carp (Cyprinus carpio L.). Fish Shellfish Immunol. 2022, 131, 809–816. [Google Scholar] [CrossRef]
  37. Awali, S.; Abdulelah, S.A.; Crile, K.G.; Yacoo, K.E.; Almouseli, A.; Torres, V.C.; Dayfield, D.J.; Evans, K.R.; Belanger, R.M. Cytochrome P450 and Glutathione-S-Transferase Activity are Altered Following Environmentally Relevant Atrazine Exposures in Crayfish (Faxoniusvirilis). Bull. Environ. Contam. Toxicol. 2019, 103, 579–584. [Google Scholar] [CrossRef]
  38. Meng, Q.; Yeung, K.; Kwok, M.L.; Chung, C.T.; Hu, X.L.; Chan, K.M. Toxic effects and transcriptome analyses of zebrafish (Danio rerio) larvae exposed to benzophenones. Environ. Pollut. 2020, 265, 114857. [Google Scholar] [CrossRef]
  39. Zacchi, F.L.; de Lima, D.; Flores-Nunes, F.; Mattos, J.J.; Lüchmann, K.H.; de Miranda Gomes, C.H.A.; Bícego, M.C.; Taniguchi, S.; Sasaki, S.T.; Dias Bainy, A.C. Transcriptional changes in oysters Crassostrea brasiliana exposed to phenanthrene at different salinities. Aquat. Toxicol. 2017, 183, 94–103. [Google Scholar] [CrossRef]
  40. Zhang, J.; He, Y.; Yan, X.; Qu, C.; Li, J.; Zhao, S.; Wang, X.; Guo, B.; Liu, H.; Qi, P. Two novel CYP3A isoforms in marine mussel Mytilus coruscus: Identification and response to cadmium and benzo[a]pyrene. Aquat. Toxicol. 2019, 214, 105239. [Google Scholar] [CrossRef]
  41. Wang, Y.; Qin, S.; Li, Y.; Wu, G.; Sun, Y.; Zhang, L.; Huang, Y.; Lyu, K.; Chen, Y.; Yang, Z. Combined effects of ZnO nanoparticles and toxic Microcystis on life-history traits of Daphnia magna. Chemosphere 2019, 233, 482–492. [Google Scholar] [CrossRef] [PubMed]
  42. Choi, T.J.; An, H.E.; Kim, C.B. Machine Learning Models for Identification and Prediction of Toxic Organic Compounds Using Daphnia magna Transcriptomic Profiles. Life 2022, 12, 1443. [Google Scholar] [CrossRef]
  43. Renzi, M.; Blašković, A. Ecotoxicity of nano-metal oxides: A case study on Daphnia magna. Ecotoxicology 2019, 28, 878–889. [Google Scholar] [CrossRef] [PubMed]
  44. Andreani, T.; Nogueira, V.; Gavina, A.; Fernandes, S.; Rodrigues, J.L.; Pinto, V.V.; Ferreira, M.J.; Silva, A.M.; Pereira, C.M.; Pereira, R. Ecotoxicity to Freshwater Organisms and Cytotoxicity of Nanomaterials: Are We Generating Sufficient Data for Their Risk Assessment? Nanomaterials 2020, 11, 66. [Google Scholar] [CrossRef] [PubMed]
  45. Eghan, K.; Lee, S.; Kim, W.K. Cardio- and neuro-toxic effects of four parabens on Daphnia magna. Ecotoxicol. Environ. Saf. 2023, 268, 115670. [Google Scholar] [CrossRef]
  46. Silva, M.L.N.d.; Nogueira, D.J.; Vicentini, D.S.; Puerari, R.C.; Alves, P.R.L.; Fuzinatto, C.F.; Matias, W.G. Rapid Communication: Oxidative stress induced by mixed exposure to glyphosate and silver nanoparticles. J. Toxicol. Environ. Health A 2022, 85, 586–590. [Google Scholar] [CrossRef] [PubMed]
  47. da Silva, M.L.N.; Nogueira, D.J.; Köerich, J.S.; Vaz, V.P.; Justino, N.M.; Schmidt, J.R.A.; Vicentini, D.S.; Matias, M.S.; de Castilhos, A.B.; Fuzinatto, C.F.; et al. Multigenerational Toxic Effects on Daphnia magna Induced by Silver Nanoparticles and Glyphosate Mixture. Environ. Toxicol. Chem. 2021, 40, 1123–1131. [Google Scholar] [CrossRef]
  48. Shen, C.; Wei, J.; Wang, T.; Wang, Y. Acute toxicity and responses of antioxidant systems to dibutyl phthalate in neonate and adult Daphnia magna. PeerJ 2019, 7, e6584. [Google Scholar] [CrossRef]
  49. Religia, P.; Nguyen, N.D.; Nong, Q.D.; Matsuura, T.; Kato, Y.; Watanabe, H. Mutation of the Cytochrome P450 CYP360A8 Gene Increases Sensitivity to Paraquat in Daphnia magna. Environ. Toxicol. Chem. 2021, 40, 1279–1288. [Google Scholar] [CrossRef]
  50. Ohnuki, S.; Tokishita, S.; Kojima, M.; Fujiwara, S. Effect of chlorpyrifos-exposure on the expression levels of CYP genes in Daphnia magna and examination of a possibility that an up-regulated clan 3 CYP, CYP360A8, reacts with pesticides. Environ. Toxicol. 2024, 39, 3641–3653. [Google Scholar] [CrossRef]
  51. Im, H.; Kang, J.; Jacob, M.F.; Bae, H.; Oh, J.-E. Transgenerational effects of benzotriazole on the gene expression, growth, and reproduction of Daphnia magna. Environ. Pollut. 2023, 323, 121211. [Google Scholar] [CrossRef] [PubMed]
  52. Liu, X.; Gong, Q.; Zhao, C.; Wang, D.; Ye, X.; Zheng, G.; Wang, Y.; Cao, J.; Sun, C. Genome-wide analysis of cytochrome P450 genes in Citrus clementina and characterization of a CYP gene encoding flavonoid 3′-hydroxylase. Hortic. Res. 2023, 10, uhac283. [Google Scholar] [CrossRef] [PubMed]
  53. Garaud, M.; Trapp, J.; Devin, S.; Cossu-Leguille, C.; Pain-Devin, S.; Felten, V.; Giamberini, L. Multibiomarker assessment of cerium dioxide nanoparticle (nCeO2) sublethal effects on two freshwater invertebrates, Dreissena polymorpha and Gammarus roeseli. Aquat. Toxicol. 2015, 158, 63–74. [Google Scholar] [CrossRef]
  54. Rundle, A.; Robertson, A.B.; Blay, A.M.; Butler, K.M.A.; Callaghan, N.I.; Dieni, C.A.; MacCormack, T.J. Cerium oxide nanoparticles exhibit minimal cardiac and cytotoxicity in the freshwater fish Catostomus commersonii. Comp. Biochem. Physiol. C 2016, 181–182, 19–26. [Google Scholar] [CrossRef]
  55. Guo, H.; Kuang, Y.; Ouyang, K.; Zhang, C.; Yang, H.; Chen, S.; Tang, R.; Zhang, X.; Li, D.; Li, L. Ammonia in the presence of nano titanium dioxide (nano-TiO2) induces greater oxidative damage in the gill and liver of female zebrafish. Ecotoxicol. Environ. Saf. 2022, 236, 113458. [Google Scholar] [CrossRef] [PubMed]
  56. Lim, S.Y.M.; Alshagga, M.; Kong, C.; Alshawsh, M.A.; Alshehade, S.A.; Pan, Y. CYP35 family in Caenorhabditis elegans biological processes: Fatty acid synthesis, xenobiotic metabolism, and stress responses. Arch. Toxicol. 2022, 96, 3163–3174. [Google Scholar] [CrossRef]
  57. Dermauw, W.; Van Leeuwen, T.; Feyereisen, R. Diversity and evolution of the P450 family in arthropods. Insect Biochem. Mol. Biol. 2020, 127, 103490. [Google Scholar] [CrossRef] [PubMed]
  58. Wu, D.; Liu, Z.; Cai, M.; Jiao, Y.; Li, Y.; Chen, Q.; Zhao, Y. Molecular characterisation of cytochrome P450 enzymes in waterflea (Daphnia pulex) and their expression regulation by polystyrene nanoplastics. Aquat. Toxicol. 2019, 217, 105350. [Google Scholar] [CrossRef] [PubMed]
  59. Pan, Y.; Ong, C.E.; Pung, Y.F.; Chieng, J.Y. The current understanding of the interactions between nanoparticles and cytochrome P450 enzymes—A literature-based review. Xenobiotica 2018, 49, 863–876. [Google Scholar] [CrossRef]
  60. Melo de Almeida, E.; Tisserand, F.; Faria, M.; Chèvre, N. Efficiency of Several Cytochrome P450 Biomarkers in Highlighting the Exposure of Daphnia magna to an Organophosphate Pesticide. Toxics 2022, 10, 482. [Google Scholar] [CrossRef]
  61. Yang, L.; Zhang, X.; Liu, S.; Zhao, C.; Miao, Y.; Jin, L.; Wang, D.; Zhou, L. Cyp17a1 is Required for Female Sex Determination and Male Fertility by Regulating Sex Steroid Biosynthesis in Fish. Endocrinology 2021, 162, bqab205. [Google Scholar] [CrossRef] [PubMed]
  62. Zhu, P.; Wang, H.; Zeng, Q. Comparative transcriptome reveals the response of oriental river prawn (Macrobrachium nipponense) to sulfide toxicity at molecular level. Aquat. Toxicol. 2021, 230, 105700. [Google Scholar] [CrossRef] [PubMed]
  63. Zhang, C.; Liu, P.; Sun, L.; Cao, C. Integration of miRNA and mRNA expression profiles in Asian spongy moth Lymantria dispar in response to cyantraniliprole. Pestic. Biochem. Physiol. 2023, 191, 105364. [Google Scholar] [CrossRef]
  64. Duan, Y.; Zhang, W.; Chen, X.; Wang, M.; Zhong, L.; Liu, J.; Bian, W.; Zhang, S. Genome-wide identification and expression analysis of mitogen-activated protein kinase (MAPK) genes in response to salinity stress in channel catfish (Ictalurus punctatus). J. Fish Biol. 2022, 101, 972–984. [Google Scholar] [CrossRef] [PubMed]
Ijms 25 10812 g001
Figure 1. Chromosomal location of the 26 Cytochrome P450s in Daphnia magna. The genes with the same color indicate that they belong to the same CYP family based on the phylogenetic tree.
Figure 1. Chromosomal location of the 26 Cytochrome P450s in Daphnia magna. The genes with the same color indicate that they belong to the same CYP family based on the phylogenetic tree.
Ijms 25 10812 g001
Ijms 25 10812 g002
Figure 2. Phylogenetic analysis of Cytochrome P450 proteins in Daphnia magna. Clan 2, 3, 4, and Mitochondrial Clan are shown in red, brown, blue, green colors, respectively. D. magna CYP proteins are marked by green rectangle.
Figure 2. Phylogenetic analysis of Cytochrome P450 proteins in Daphnia magna. Clan 2, 3, 4, and Mitochondrial Clan are shown in red, brown, blue, green colors, respectively. D. magna CYP proteins are marked by green rectangle.
Ijms 25 10812 g002
Ijms 25 10812 g003aIjms 25 10812 g003b
Figure 3. Distribution of conserved motifs and domains within Daphnia magna Cytochrome P450s. (A) A schematic diagram showcases the conserved motifs within D. magna’s CYP proteins, using CYP4C1.2 as a reference. It delineates the signature motifs that encompass functionally significant domains, with the 5′ and 3′ indicating the N-terminal and C-terminal regions. (B) Fifteen conserved motif proteins of the CYPs, each small box indicating a motif. (C) Distribution of 26 CYPs Phylogenetic tree, 15 conserved motifs, and the domain in D. magna.
Figure 3. Distribution of conserved motifs and domains within Daphnia magna Cytochrome P450s. (A) A schematic diagram showcases the conserved motifs within D. magna’s CYP proteins, using CYP4C1.2 as a reference. It delineates the signature motifs that encompass functionally significant domains, with the 5′ and 3′ indicating the N-terminal and C-terminal regions. (B) Fifteen conserved motif proteins of the CYPs, each small box indicating a motif. (C) Distribution of 26 CYPs Phylogenetic tree, 15 conserved motifs, and the domain in D. magna.
Ijms 25 10812 g003aIjms 25 10812 g003b
Ijms 25 10812 g004
Figure 4. Gene structure analysis of Cytochrome P450s in Daphnia magna. The structures of intron and exon and untranslated regions (UTR) are shown with a black line and yellow and green boxes, respectively. The scale is helpful for gene length estimation.
Figure 4. Gene structure analysis of Cytochrome P450s in Daphnia magna. The structures of intron and exon and untranslated regions (UTR) are shown with a black line and yellow and green boxes, respectively. The scale is helpful for gene length estimation.
Ijms 25 10812 g004
Ijms 25 10812 g005
Figure 5. Expression profiles of CYP genes in Daphnia magna upon nCeO2 exposure. Blue and red colors show low and high relative expression levels, respectively. (A) The CYP genes of transcriptomic data in D. magna exposed to nCeO2 at concentrations of 0 and 50 mg/L at 48 h. (B) The CYP gene expression profiles of D. magna after 24 and 48 h of exposure to nCeO2 (0, 10, 50, and 150 mg/L) were analyzed using qPCR.
Figure 5. Expression profiles of CYP genes in Daphnia magna upon nCeO2 exposure. Blue and red colors show low and high relative expression levels, respectively. (A) The CYP genes of transcriptomic data in D. magna exposed to nCeO2 at concentrations of 0 and 50 mg/L at 48 h. (B) The CYP gene expression profiles of D. magna after 24 and 48 h of exposure to nCeO2 (0, 10, 50, and 150 mg/L) were analyzed using qPCR.
Ijms 25 10812 g005
Table 1. Annotated molecular function of Cytochrome P450s in Daphnia magna.
Table 1. Annotated molecular function of Cytochrome P450s in Daphnia magna.
ClanGene NameGene IDMolecular Function
Clan 2CYP2C15LOC116918329steroid hydroxylase activity
CYP2K4LOC116923437steroid hydroxylase activity
CYP18a1LOC116919046steroid hydroxylase activity
CYP306a1LOC116918853steroid hydroxylase activity; steroid hydroxylase activity
Clan 3CYP3A19LOC116928063heme binding, iron ion binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen
Clan 4CYP4C1.1LOC116927068heme binding, iron ion binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen
CYP4C1.2LOC116926713heme binding, iron ion binding, methyltransferase activity, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen,
CYP4C1.3LOC116926407iron ion binding; oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen; heme binding; oxidation-reduction process
CYP4C1.4LOC116926406iron ion binding; oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen; heme binding; oxidation-reduction process; oxidation-reduction process
CYP4C1.5LOC116926459heme binding, iron ion binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen
CYP4C1.6LOC116928122iron ion binding; oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen; heme binding; oxidation-reduction process
CYP4C1.7LOC116927585heme binding, iron ion binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen
CYP4C1.8LOC116928121heme binding, iron ion binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen
CYP4C1.9LOC116927935heme binding, iron ion binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen
CYP4C1.10LOC116930969iron ion binding; oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen; heme binding; oxidation-reduction process; oxidation-reduction process
CYP4c3.1LOC116929157heme binding, iron ion binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen
CYP4c3.2LOC116922314heme binding, iron ion binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen
CYP4c3.3LOC116925875iron ion binding; oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen; heme binding; oxidation-reduction process
CYP4c3.4LOC116926314heme binding, iron ion binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen
CYP4c3.5LOC116934506heme binding, iron ion binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen
CYP4c3.6LOC116934248heme binding, iron ion binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen
CYP4c3.7LOC116926402iron ion binding; oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen; heme binding; oxidation-reduction process
CYP4c3.8LOC116926463heme binding, iron ion binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen
CYP4c3.9LOC116926461heme binding, iron ion binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen
Mitochondrial clanCYP302a1LOC116927720iron ion binding; mitochondrion; ecdysone biosynthetic process; dorsal closure; central nervous system development; midgut development; head involution; chitin-based embryonic cuticle biosynthetic process; electron transfer activity; oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen; heme binding; ecdysteroid 22-hydroxylase activity; oxidation-reduction process
CYP315a1LOC116926680iron ion binding; mitochondrion; ecdysone biosynthetic process; dorsal closure; central nervous system development; midgut development; motor neuron axon guidance; head involution; oxidoreductase activity, acting on paired donors, with incorporation or reduction in molecular oxygen; heme binding; ecdysteroid 2-hydroxylase activity; oxidation-reduction process
Table 2. Physicochemical properties of Cytochrome P450s in Daphnia magna.
Table 2. Physicochemical properties of Cytochrome P450s in Daphnia magna.
Gene NameChromosome
Location		Length
(aa)		Isoelectric PointsMolecular Weight/DaSubcellular
Localizations		Exon CountGravy
CYP18a1LG15518.3563,170.02extracellular6−0.122
CYP4C1.9LG75068.7258,694.89plasma membrane18−0.17
CYP2C15LG35079.1958,789.94endoplasmic reticulum9−0.181
CYP4C1.6LG75046.5558,039.1plasma membrane12−0.119
CYP4c3.1Unknown5148.2358,912.73mitochondrion13−0.13
CYP4C1.4LG74448.4350,380.05mitochondrion14−0.15
CYP4c3.4LG75287.1760,877.57endoplasmic reticulum13−0.141
CYP4c3.7LG75266.359,991.96plasma membrane14−0.18
CYP306a1LG15858.4566,441.76plasma membrane9−0.159
CYP4C1.1LG75206.2260,095.44plasma membrane16−0.114
CYP4C1.2LG75096.7558,800.96endoplasmic reticulum11−0.173
CYP4c3.5LG74907.8755,885.2plasma membrane15−0.097
CYP4C1.10LG95277.6160,180.6endoplasmic reticulum12−0.054
CYP3A19LG7999.1611,683.6extracellular4−0.363
CYP4c3.9LG75286.160,656.91endoplasmic reticulum11−0.15
CYP4C1.3LG75095.9358,157.05plasma membrane12−0.053
CYP4c3.8LG75348.5862,191.37endoplasmic reticulum13−0.159
CYP4c3.3LG65146.959,866.09endoplasmic reticulum11−0.263
CYP2K4LG55037.1758,164.88endoplasmic reticulum9−0.191
CYP4c3.6LG75206.4458,821.43plasma membrane140.058
CYP4C1.8LG75077.658,335.33plasma membrane11−0.173
CYP4C1.7LG75138.4358,957.01endoplasmic reticulum13−0.209
CYP4C1.5LG75336.6560,999.32plasma membrane11−0.135
CYP4c3.2LG52565.9828,663.33extracellular6−0.001
CYP315a1LG74918.7756,522.29mitochondrion8−0.229
CYP302a1LG75329.4360,986.62mitochondrion8−0.269
Table 3. Primers sequence for qPCR.
Table 3. Primers sequence for qPCR.
Gene IDDescriptionGeneForward Primer (5′-3′)
Reverse Primer (3′-5′)
Beta-actinBeta-actinCCCCATTTATGAAGGTTACGC
CCTTGATGTCACGGACGATTT
116919046cytochrome P450 18a1CYP18a1TCACCATACCGAAAGGCACC
ACGCCGAACGGAATGAAGTA
116927935cytochrome P450 4C1.9CYP4C1.9ATATGCCCTCCACCACAACG
TCCAATGCAGTTCCTCGGTC
116918329cytochrome P450 2C15CYP2C15TCATACTCACAGCGAACGCA
ATCATGCCAAAGGGCAGTGT
116928122cytochrome P450 4C1.6CYP4C1.6TTCGGCAAGTGGACGACATC
CCTCGACATCGGAAGGAGAC
116929157cytochrome P450 4c3.1CYP4c3.1TGGCTTCGATTGGATTGGCT
ACCAATTCACGGCGATGTCT
116926406cytochrome P450 4C1.4CYP4C1.4ATCACCAGAATTTATGGAGGTAAGT
CCGGGACTAATAAGAAGCCCT
116926314cytochrome P450 4c3.4CYP4c3.4TACCTGATGGCGAAGCATCC
GGATGCCAGGGTACAACCTC
116926402cytochrome P450 4c3.7CYP4c3.7CAGAGAACAGCATCGGTCGT
CATAGCTGGATCAGAGGCGG
116918853cytochrome P450 306a1CYP306a1TTTGCCCAGTTACCCAGTTGT
TGCAACCACCATACGGCGA
116927068cytochrome P450 4C1.1CYP4C1.1TAATAACGCGGGGCTGAGTG
TCGCTGATGTTGTCGTGTCA
116926713cytochrome P450 4C1.2CYP4C1.2CATCAAGCGCCGTGTTAGTG
ACGGAACGAAGGCAAATGGA
116934506cytochrome P450 4c3.5CYP4c3.5GTCGGTGCTGTGGGATTGTT
CGTATCTTCCCGTCCACGTT
116930969cytochrome P450 4C1.10CYP4C1.10TGGAAACCCAAAAGGACGGT
ACAGCTTGAGGGTATTCGCC
116928063cytochrome P450 3A19CYP3A19ATGCCGGCGTATGCTCTC
TTTCAGCGCACCATCTTTCG
116926461cytochrome P450 4c3.9CYP4c3.9CCGGAGAACAGTATCGGACG
TCATGGGCTGTGAGGAATCG
116926407cytochrome P450 4C1.3CYP4C1.3TCTTGATGATATGTGCGCGTC
GCGCGTTTATTCTTGTCCCC
116926463cytochrome P450 4c3.8CYP4c3.8TAACACCGGCATTCCACGTT
ATGTCAAGGGCGTGTTCCAT
116925875cytochrome P450 4c3.3CYP4c3.3CTGACTCCGGCCTTCCATTT
ATGTCGAGGGTGCATCGTTT
116923437cytochrome P450 2K4CYP2K4CTGAAGCTCGCCAAATGGTC
CTCGCTAAACTTGTCCGCCT
116934248cytochrome P450 4c3.6CYP4c3.6GGTCCCAGGT
TCTACTTGCC
TAGCAATGCGAGCCAAGGAA
116928121cytochrome P450 4C1.8CYP4C1.8AATTTGGCCGCATCTACCGA
TTCCACTTAGCCCCTGTTGC
116927585cytochrome P450 4C1.7CYP4C1.7AGGGTGGAGTGGAGCTTAGT
TGATGCCCTGGATTCGTAGC
116926459cytochrome P450 4C1.5CYP4C1.5CAAGCGTCGGAGAATGGAGA
AGAAACCAACTCATCGCCGT
116922314cytochrome P450 4c3.2CYP4c3.2AGAACATGCACGCTGAACAAC
CTGGATCAGGGCTAACCTCC
116926680cytochrome P450 315a1CYP315a1AATGGAACGACCACCACCAT
TGCACTTGGAACGTGCAATC
16927720cytochrome P450 302a1CYP302a1TTGGGACGGTCTCTGTGTTG
GGTAGTGGTTTAGGGCAAGGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kang, X.; Zhou, Y.; Liu, Q.; Liu, M.; Chen, J.; Zhang, Y.; Wei, J.; Wang, Y. Characterization and Expression of the Cytochrome P450 Genes in Daphnia magna Exposed to Cerium Oxide Nanoparticles. Int. J. Mol. Sci. 2024, 25, 10812. https://doi.org/10.3390/ijms251910812

AMA Style

Kang X, Zhou Y, Liu Q, Liu M, Chen J, Zhang Y, Wei J, Wang Y. Characterization and Expression of the Cytochrome P450 Genes in Daphnia magna Exposed to Cerium Oxide Nanoparticles. International Journal of Molecular Sciences. 2024; 25(19):10812. https://doi.org/10.3390/ijms251910812

Chicago/Turabian Style

Kang, Xinyi, Yan Zhou, Qi Liu, Miao Liu, Jing Chen, Yuanwen Zhang, Jie Wei, and Yuan Wang. 2024. "Characterization and Expression of the Cytochrome P450 Genes in Daphnia magna Exposed to Cerium Oxide Nanoparticles" International Journal of Molecular Sciences 25, no. 19: 10812. https://doi.org/10.3390/ijms251910812

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop