Association between High HbA1c Levels and Mast Cell Phenotype in the Infrapatellar Fat Pad of Patients with Knee Osteoarthritis
Abstract
:1. Introduction
2. Results
2.1. Expression of TPSB2 and CPA3 between KOA Patients with HbA1c ≥ 6.5 and HbA1c < 6.5
2.2. Mast Cell Marker Expression in MC-Rich Fraction Derived from Normal and Diabetic Knee Osteoarthritis Patients
3. Discussion
4. Materials and Methods
4.1. Patients
4.2. Isolation of MC Using Magnetic Beads
4.3. Quantitative Polymerase Chain Reaction (qPCR) Analysis
4.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Emerging Risk Factors Collaboration; Sarwar, N.; Gao, P.; Seshasai, S.R.; Gobin, R.; Kaptoge, S.; Di Angelantonio, E.; Ingelsson, E.; Lawlor, D.A.; Selvin, E.; et al. Diabetes mellitus, fasting blood glucose concentration, and risk of vascular disease: A collaborative meta-analysis of 102 prospective studies. Lancet 2010, 375, 2215–2222. [Google Scholar] [CrossRef]
- Litwic, A.; Edwards, M.H.; Dennison, E.M.; Cooper, C. Epidemiology and burden of osteoarthritis. Br. Med. Bull. 2013, 105, 185–199. [Google Scholar] [CrossRef]
- Cui, A.; Li, H.; Wang, D.; Zhong, J.; Chen, Y.; Lu, H. Global, regional prevalence, incidence and risk factors of knee osteoarthritis in population-based studies. eClinicalMedicine 2020, 29–30, 100587. [Google Scholar] [CrossRef]
- Calders, P.; Van Ginckel, A. Presence of comorbidities and prognosis of clinical symptoms in knee and/or hip osteoarthritis: A systematic review and meta-analysis. Semin. Arthritis Rheum. 2018, 47, 805–813. [Google Scholar] [CrossRef]
- Eymard, F.; Parsons, C.; Edwards, M.H.; Petit-Dop, F.; Reginster, J.Y.; Bruyere, O.; Richette, P.; Cooper, C.; Chevalier, X. Diabetes is a risk factor for knee osteoarthritis progression. Osteoarthr. Cartil. 2015, 23, 851–859. [Google Scholar] [CrossRef]
- Li, X.; Pan, F.; Zhu, R.; Ge, L.; Zhang, X.; Wen, X.; Zhou, J.; Cheng, J.; Pan, F.; Cai, G. Cross-Sectional and Longitudinal Associations of Comorbidities with Knee Symptoms and Radiographic Abnormalities of Osteoarthritis. Rheumatol. Ther. 2023. [Google Scholar] [CrossRef]
- Singh, A.; Fraser, B.; Venn, A.; Blizzard, L.; Jones, G.; Ding, C.; Antony, B. Trajectory of metabolic syndrome and its association with knee pain in middle-aged adults. Diabetes Metab. Syndr. 2023, 17, 102916. [Google Scholar] [CrossRef]
- Abourazzak, F.E.; Talbi, S.; Lazrak, F.; Azzouzi, H.; Aradoini, N.; Keita, S.; Errasfa, M.; Harzy, T. Does Metabolic Syndrome or its Individual Components Affect Pain and Function in Knee Osteoarthritis Women? Curr. Rheumatol. Rev. 2015, 11, 8–14. [Google Scholar] [CrossRef]
- Alenazi, A.M.; Alhowimel, A.S.; Alshehri, M.M.; Alqahtani, B.A.; Alhwoaimel, N.A.; Segal, N.A.; Kluding, P.M. Osteoarthritis and Diabetes: Where Are We and Where Should We Go? Diagnostics 2023, 13, 1386. [Google Scholar] [CrossRef]
- Alenazi, A.M.; Alshehri, M.M.; Alothman, S.; Alqahtani, B.A.; Rucker, J.; Sharma, N.; Segal, N.A.; Bindawas, S.M.; Kluding, P.M. The Association of Diabetes with Knee Pain Severity and Distribution in People with Knee Osteoarthritis using Data from the Osteoarthritis Initiative. Sci. Rep. 2020, 10, 3985. [Google Scholar] [CrossRef]
- Alenazi, A.M.; Alshehri, M.M.; Alothman, S.; Alqahtani, B.A.; Rucker, J.; Sharma, N.K.; Bindawas, S.M.; Kluding, P.M. The Association of Diabetes with Knee Pain Locations, Pain While Walking, and Walking Speed: Data from the Osteoarthritis Initiative. Phys. Ther. 2020, 100, 1977–1986. [Google Scholar] [CrossRef]
- Alenazi, A.M.; Alshehri, M.M.; Alqahtani, B.A.; Alanazi, A.D.; Bindawas, S.M. Combined diabetes and arthritis are associated with declined gait speed. Clin. Rheumatol. 2021, 40, 1593–1598. [Google Scholar] [CrossRef]
- Eitner, A.; Pester, J.; Vogel, F.; Marintschev, I.; Lehmann, T.; Hofmann, G.O.; Schaible, H.G. Pain sensation in human osteoarthritic knee joints is strongly enhanced by diabetes mellitus. Pain 2017, 158, 1743–1753. [Google Scholar] [CrossRef]
- Khor, A.; Ma, C.A.; Hong, C.; Hui, L.L.; Leung, Y.Y. Diabetes mellitus is not a risk factor for osteoarthritis. RMD Open 2020, 6, e001030. [Google Scholar] [CrossRef]
- Schett, G.; Kleyer, A.; Perricone, C.; Sahinbegovic, E.; Iagnocco, A.; Zwerina, J.; Lorenzini, R.; Aschenbrenner, F.; Berenbaum, F.; D’Agostino, M.A.; et al. Diabetes is an independent predictor for severe osteoarthritis: Results from a longitudinal cohort study. Diabetes Care 2013, 36, 403–409. [Google Scholar] [CrossRef]
- Shin, D. Association between metabolic syndrome, radiographic knee osteoarthritis, and intensity of knee pain: Results of a national survey. J. Clin. Endocrinol. Metab. 2014, 99, 3177–3183. [Google Scholar] [CrossRef]
- Jacobson, J.A.; Lenchik, L.; Ruhoy, M.K.; Schweitzer, M.E.; Resnick, D. MR imaging of the infrapatellar fat pad of Hoffa. Radiographics 1997, 17, 675–691. [Google Scholar] [CrossRef]
- Vahlensieck, M.; Linneborn, G.; Schild, H.; Schmidt, H.M. Hoffa’s recess: Incidence, morphology and differential diagnosis of the globular-shaped cleft in the infrapatellar fat pad of the knee on MRI and cadaver dissections. Eur. Radiol. 2002, 12, 90–93. [Google Scholar] [CrossRef]
- Distel, E.; Cadoudal, T.; Durant, S.; Poignard, A.; Chevalier, X.; Benelli, C. The infrapatellar fat pad in knee osteoarthritis: An important source of interleukin-6 and its soluble receptor. Arthritis Rheum. 2009, 60, 3374–3377. [Google Scholar] [CrossRef]
- Eymard, F.; Pigenet, A.; Citadelle, D.; Flouzat-Lachaniette, C.H.; Poignard, A.; Benelli, C.; Berenbaum, F.; Chevalier, X.; Houard, X. Induction of an inflammatory and prodegradative phenotype in autologous fibroblast-like synoviocytes by the infrapatellar fat pad from patients with knee osteoarthritis. Arthritis Rheumatol. 2014, 66, 2165–2174. [Google Scholar] [CrossRef]
- Klein-Wieringa, I.R.; Kloppenburg, M.; Bastiaansen-Jenniskens, Y.M.; Yusuf, E.; Kwekkeboom, J.C.; El-Bannoudi, H.; Nelissen, R.G.; Zuurmond, A.; Stojanovic-Susulic, V.; Van Osch, G.J.; et al. The infrapatellar fat pad of patients with osteoarthritis has an inflammatory phenotype. Ann. Rheum. Dis. 2011, 70, 851–857. [Google Scholar] [CrossRef]
- Mukai, M.; Uchida, K.; Takano, S.; Iwase, D.; Aikawa, J.; Inoue, G.; Miyagi, M.; Takaso, M. Down-regulation of microsomal prostaglandin E2 synthase-1 in the infrapatellar fat pad of osteoarthritis patients with hypercholesterolemia. Lipids Health Dis. 2018, 17, 137. [Google Scholar] [CrossRef]
- Baran, J.; Sobiepanek, A.; Mazurkiewicz-Pisarek, A.; Rogalska, M.; Gryciuk, A.; Kuryk, L.; Abraham, S.N.; Staniszewska, M. Mast Cells as a Target-A Comprehensive Review of Recent Therapeutic Approaches. Cells 2023, 12, 1187. [Google Scholar] [CrossRef]
- Dileepan, K.N.; Raveendran, V.V.; Sharma, R.; Abraham, H.; Barua, R.; Singh, V.; Sharma, R.; Sharma, M. Mast cell-mediated immune regulation in health and disease. Front. Med. (Lausanne) 2023, 10, 1213320. [Google Scholar] [CrossRef]
- Takata, K.; Uchida, K.; Mukai, M.; Takano, S.; Aikawa, J.; Iwase, D.; Sekiguchi, H.; Miyagi, M.; Inoue, G.; Takaso, M. Increase in Tryptase and Its Role in the Synovial Membrane of Overweight and Obese Patients with Osteoarthritis of the Knee. Diabetes Metab. Syndr. Obes. 2020, 13, 1491–1497. [Google Scholar] [CrossRef]
- Takata, K.; Uchida, K.; Takano, S.; Mukai, M.; Inoue, G.; Sekiguchi, H.; Aikawa, J.; Miyagi, M.; Iwase, D.; Takaso, M. Possible Regulation of bFGF Expression by Mast Cells in Osteoarthritis Patients with Obesity: A Cross-Sectional Study. Diabetes Metab. Syndr. Obes. 2021, 14, 3291–3297. [Google Scholar] [CrossRef]
- Tsukada, A.; Takata, K.; Takano, S.; Ohashi, Y.; Mukai, M.; Aikawa, J.; Iwase, D.; Inoue, G.; Takaso, M.; Uchida, K. Increased NMUR1 Expression in Mast Cells in the Synovial Membrane of Obese Osteoarthritis Patients. Int. J. Mol. Sci. 2022, 23, 11237. [Google Scholar] [CrossRef]
- Divoux, A.; Moutel, S.; Poitou, C.; Lacasa, D.; Veyrie, N.; Aissat, A.; Arock, M.; Guerre-Millo, M.; Clement, K. Mast cells in human adipose tissue: Link with morbid obesity, inflammatory status, and diabetes. J. Clin. Endocrinol. Metab. 2012, 97, E1677–E1685. [Google Scholar] [CrossRef]
- Liu, J.; Divoux, A.; Sun, J.; Zhang, J.; Clement, K.; Glickman, J.N.; Sukhova, G.K.; Wolters, P.J.; Du, J.; Gorgun, C.Z.; et al. Genetic deficiency and pharmacological stabilization of mast cells reduce diet-induced obesity and diabetes in mice. Nat. Med. 2009, 15, 940–945. [Google Scholar] [CrossRef]
- Elieh Ali Komi, D.; Ribatti, D. Mast cell-mediated mechanistic pathways in organ transplantation. Eur. J. Pharmacol. 2019, 857, 172458. [Google Scholar] [CrossRef]
- Elieh Ali Komi, D.; Shafaghat, F.; Christian, M. Crosstalk Between Mast Cells and Adipocytes in Physiologic and Pathologic Conditions. Clin. Rev. Allergy Immunol. 2020, 58, 388–400. [Google Scholar] [CrossRef]
- Poglio, S.; De Toni-Costes, F.; Arnaud, E.; Laharrague, P.; Espinosa, E.; Casteilla, L.; Cousin, B. Adipose tissue as a dedicated reservoir of functional mast cell progenitors. Stem Cells 2010, 28, 2065–2072. [Google Scholar] [CrossRef]
- Bacchus, R.A.; Bell, J.L.; Madkour, M.; Kilshaw, B. The prevalence of diabetes mellitus in male Saudi Arabs. Diabetologia 1982, 23, 330–332. [Google Scholar] [CrossRef]
- Fatani, H.H.; Mira, S.A.; el-Zubier, A.G. Prevalence of diabetes mellitus in rural Saudi Arabia. Diabetes Care 1987, 10, 180–183. [Google Scholar] [CrossRef]
- Hedley, A.A.; Ogden, C.L.; Johnson, C.L.; Carroll, M.D.; Curtin, L.R.; Flegal, K.M. Prevalence of overweight and obesity among US children, adolescents, and adults, 1999–2002. JAMA 2004, 291, 2847–2850. [Google Scholar] [CrossRef]
- Uchida, K.; Takano, S.; Inoue, G.; Iwase, D.; Aikawa, J.; Takata, K.; Tazawa, R.; Kawakubo, A.; Sekiguchi, H.; Takaso, M. Increase in mast cell marker expression in the synovium of obese patients with osteoarthritis of the knee. Diabetes Metab. Syndr. Obes. 2019, 12, 377–382. [Google Scholar] [CrossRef]
- Fenger, R.V.; Linneberg, A.; Vidal, C.; Vizcaino, L.; Husemoen, L.L.; Aadahl, M.; Gonzalez-Quintela, A. Determinants of serum tryptase in a general population: The relationship of serum tryptase to obesity and asthma. Int. Arch. Allergy Immunol. 2012, 157, 151–158. [Google Scholar] [CrossRef]
- Moreno, M.; Puig, J.; Serrano, M.; Moreno-Navarrete, J.M.; Ortega, F.; Ricart, W.; Fernandez-Real, J.M. Circulating tryptase as a marker for subclinical atherosclerosis in obese subjects. PLoS ONE 2014, 9, e97014. [Google Scholar] [CrossRef]
- Das, N.; de Almeida, L.G.N.; Derakhshani, A.; Young, D.; Mehdinejadiani, K.; Salo, P.; Rezansoff, A.; Jay, G.D.; Sommerhoff, C.P.; Schmidt, T.A.; et al. Tryptase beta regulation of joint lubrication and inflammation via proteoglycan-4 in osteoarthritis. Nat. Commun. 2023, 14, 1910. [Google Scholar] [CrossRef]
- Hickey, F.B.; Martin, F. Role of the Immune System in Diabetic Kidney Disease. Curr. Diab Rep. 2018, 18, 20. [Google Scholar] [CrossRef]
- Liao, B.; Ouyang, Q.; Song, H.; Wang, Z.; Ou, J.; Huang, J.; Liu, L. The transcriptional characteristics of mast cells derived from skin tissue in type 2 diabetes patients at the single-cell level. Acta Histochem. 2021, 123, 151789. [Google Scholar] [CrossRef] [PubMed]
- Spinas, E.; Kritas, S.K.; Saggini, A.; Mobili, A.; Caraffa, A.; Antinolfi, P.; Pantalone, A.; Tei, M.; Speziali, A.; Saggini, R.; et al. Role of mast cells in atherosclerosis: A classical inflammatory disease. Int. J. Immunopathol. Pharmacol. 2014, 27, 517–521. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Shi, G.P. Mast cells and metabolic syndrome. Biochim. Biophys. Acta 2012, 1822, 14–20. [Google Scholar] [CrossRef]
- Tsuchiya, M.; Fukushima, K.; Takata, K.; Ohashi, Y.; Uchiyama, K.; Takahira, N.; Saito, H.; Tsukada, A.; Inoue, G.; Takaso, M.; et al. Increase in TPSB2 and TPSD1 Expression in Synovium of Hip Osteoarthritis Patients Who Are Overweight. Int. J. Mol. Sci. 2023, 24, 11532. [Google Scholar] [CrossRef] [PubMed]
Before Match | After Match | |||||
---|---|---|---|---|---|---|
Normal (N = 128) | High (N = 28) | p Values | Normal (N = 27) | High (N = 27) | p Values | |
Sex, female/male, N | 97/31 | 21/7 | 0.93 | 19/8 | 20/7 | 0.761 |
Age, years | 73.5 ± 8.5 | 71.7 ± 8.3 | 0.485 | 73.7 ± 7.9 | 71.9 ± 8.4 | 0.562 |
NW/OW/OB | 52/55/21 | 7/11/10 | 0.053 | 7/15/5 | 7/10/10 | 0.264 |
BMI, kg/m2 | 26.3 ± 4.2 | 28.1 ± 4.0 * | 0.028 | 27.8 ± 4.0 | 28.1 ± 4 | 0.869 |
TCHO (mg/dL) | 209 ± 37 | 182 ± 34 * | <0.001 | 185 ± 41 | 184 ± 33 | 0.815 |
Triglyceride(mg/dL) | 133 ± 84 | 179 ± 104 | 0.11 | 157 ± 90 | 180 ± 106 | 0.373 |
HbA1c | 5.9 ± 0.3 | 7.0 ± 0.5 * | <0.01 | 5.9 ± 0.4 | 7.0 ± 0.5 | <0.001 * |
KL (2/3/4) | 2/33/93 | 1/3/24 | 0.195 | 0/9/18 | 1/3/23 | 0.1 |
Before Match | After Match | |||||
---|---|---|---|---|---|---|
Normal | High | p | Normal | High | p | |
(N = 22) | (N = 12) | Values | (N = 8) | (N = 8) | Values | |
Sex, female/male, N | 6/16 | 1/11 | 0.378 | 8/0 | 8/0 | 1.000 |
Age, years | 72.2 ± 7.0 | 76.4 ± 5.3 | 0.080 | 74.0 ± 4.6 | 75.3 ± 5.4 | 0.626 |
NW/OW/OB | 15/6/1 | 6/4/2 | 0.405 | 7/1/0 | 6/2/0 | 0.522 |
BMI, kg/m2 | 24.4 ± 2.7 | 26.3 ± 5.3 | 0.171 | 23.1 ± 1.9 | 24.0 ± 3.5 | 0.566 |
TCHO (mg/dL) | 200 ± 32 | 191 ± 33 | 0.474 | 195 ± 32 | 202 ± 31 | 0.682 |
Triglyceride(mg/dL) | 137 ± 62 | 150 ± 70 | 0.571 | 133 ± 57 | 155 ± 82 | 0.54 |
HbA1c | 5.9 ± 0.3 | 6.8 ± 0.6 * | <0.001 | 5.8 ± 0.3 | 6.8 ± 0.2 * | <0.001 |
KL (2/3/4) | 1/1/20 | 0/2/10 | 0.389 | 0/1/7 | 0/2/6 | 0.522 |
Primer | Sequence (5′-3′) | Product Size (bp) |
---|---|---|
TPSB2-F | CGCAAAATACCACCTTGGCG | 138 |
TPSB2-R | GTGCCATTCACCTTGCACAC | |
CPA3-F | GGCACTGACCTCAACAGGAA | 71 |
CPA3-R | TCTGCACATGGGTCATTGGT | |
ARG1-F | ACTCGAACAGTGAACACAGCA | 71 |
ARG1-R | TTGTGATTACCCTCCCGAGC | |
IL3RA-F | AGGCGTCAACAGTACGAGTG | 157 |
IL3RA-R | CTGTGCAGGGGATACCGAAG | |
PAXIP1-F | GGAGGTCAAGTATTACGCGGT | 132 |
PAXIP1-R | TCTGGATTGTCCCCATCCTCT | |
HAS1-F | TTGCAGCAGTTTCTTGAGGC | 130 |
HAS1-R | GGGACCTGGAGGTGTACTTG | |
GAPDH-F | TGCCACTCAGAAGACTGTGG | 129 |
GAPDH-R | TTCAGCTCTGGGATGACCTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsukada, A.; Takata, K.; Aikawa, J.; Iwase, D.; Mukai, M.; Uekusa, Y.; Metoki, Y.; Inoue, G.; Miyagi, M.; Takaso, M.; et al. Association between High HbA1c Levels and Mast Cell Phenotype in the Infrapatellar Fat Pad of Patients with Knee Osteoarthritis. Int. J. Mol. Sci. 2024, 25, 877. https://doi.org/10.3390/ijms25020877
Tsukada A, Takata K, Aikawa J, Iwase D, Mukai M, Uekusa Y, Metoki Y, Inoue G, Miyagi M, Takaso M, et al. Association between High HbA1c Levels and Mast Cell Phenotype in the Infrapatellar Fat Pad of Patients with Knee Osteoarthritis. International Journal of Molecular Sciences. 2024; 25(2):877. https://doi.org/10.3390/ijms25020877
Chicago/Turabian StyleTsukada, Ayumi, Ken Takata, Jun Aikawa, Dai Iwase, Manabu Mukai, Yui Uekusa, Yukie Metoki, Gen Inoue, Masayuki Miyagi, Masashi Takaso, and et al. 2024. "Association between High HbA1c Levels and Mast Cell Phenotype in the Infrapatellar Fat Pad of Patients with Knee Osteoarthritis" International Journal of Molecular Sciences 25, no. 2: 877. https://doi.org/10.3390/ijms25020877