Impact of Nordihydroguaiaretic Acid on Proliferation, Energy Metabolism, and Chemosensitization in Non-Small-Cell Lung Cancer (NSCLC) Cell Lines
Abstract
:1. Introduction
2. Results
2.1. NDGA Decreases Cell Survival of Non-Small-Cell Lung Cancer (NSCLC) Cells
2.2. High Concentration of NDGA Induces Cell Death in NSCLC Cells
2.3. NDGA Represses the Proliferative Capacity of NSCLC Cells
2.4. NDGA Treatment Differentially Modulates Glucose Uptake and Metabolic Enzymes in NSCLC Lines
2.5. NDGA Synergically Enhances the Carboplatin Effect over NSCLC Cells
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Cell Viability Assays by Resazurin Reduction
4.3. MTT Assays and In Vitro Combinations
4.4. Cell Viability Assay with Propidium Iodide
4.5. Flow Cytometry with Double Stain AnnexinV/PI
4.6. Cell Cycle Analysis Using Flow Cytometry
4.7. Caspase-3 Activity Assay
4.8. Colony-Forming Assay
4.9. 5-Bromo-2′-deoxyuridine (Brdu) Incorporation Assay
4.10. RNA Extraction and Real-Time Reverse-Transcription PCR (RT-qPCR)
4.11. Western Blotting
4.12. Glucose Uptake Assay
4.13. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Asselain, B.; Barrière, J.R.; Clarot, C.; Vabre, J.P.; Gentil Le Pecq, B.; Duval, Y.; Thomas, P.; Herman, D.; Grivaux, M.; Debieuvre, D. Metastatic NSCLC: Clinical, Molecular, and Therapeutic Factors Associated with Long-Term Survival. Respir. Med. Res. 2019, 76, 38–44. [Google Scholar] [CrossRef] [PubMed]
- Cragg, G.M.; Pezzuto, J.M. Natural Products as a Vital Source for the Discovery of Cancer Chemotherapeutic and Chemopreventive Agents. Med. Princ. Pract. 2016, 25 (Suppl. S2), 41–59. [Google Scholar] [CrossRef] [PubMed]
- Wattanathamsan, O.; Hayakawa, Y.; Pongrakhananon, V. Molecular Mechanisms of Natural Compounds in Cell Death Induction and Sensitization to Chemotherapeutic Drugs in Lung Cancer. Phytother. Res. 2019, 33, 2531–2547. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Wang, Z.; Du, Q.; Zhu, Z.; Chen, T.; Xue, Y.; Wang, Y.; Zeng, Q.; Shen, C.; Jiang, C.; et al. Pharmacological Effects and Underlying Mechanisms of Licorice-Derived Flavonoids. Evid.-Based Complement. Altern. Med. 2022, 2022, 9523071. [Google Scholar] [CrossRef]
- Deng, N.; Qiao, M.; Li, Y.; Liang, F.; Li, J.; Liu, Y. Anticancer Effects of Licochalcones: A Review of the Mechanisms. Front. Pharmacol. 2023, 14, 1074506. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.; Kumar, A. Non-Small-Cell Lung Cancer-Associated Gene Mutations and Inhibitors. Adv. Cancer Biol.-Metastasis 2022, 6, 100076. [Google Scholar] [CrossRef]
- Grodzka, A.; Knopik-Skrocka, A.; Kowalska, K.; Kurzawa, P.; Krzyżaniak, M.; Stencel, K.; Bryl, M. Molecular Alterations of Driver Genes in Non-Small Cell Lung Cancer: From Diagnostics to Targeted Therapy. EXCLI J. 2023, 22, 415–432. [Google Scholar] [CrossRef]
- Araki, T.; Kanda, S.; Horinouchi, H.; Ohe, Y. Current Treatment Strategies for EGFR-Mutated Non-Small Cell Lung Cancer: From First Line to beyond Osimertinib Resistance. Jpn. J. Clin. Oncol. 2023, 53, 547–561. [Google Scholar] [CrossRef]
- O’Sullivan, É.; Keogh, A.; Henderson, B.; Finn, S.P.; Gray, S.G.; Gately, K. Treatment Strategies for KRAS-Mutated Non-Small-Cell Lung Cancer. Cancers 2023, 15, 1635. [Google Scholar] [CrossRef]
- Stanley, R.; Flanagan, S.; Reilly, D.O.; Kearney, E.; Naidoo, J.; Dowling, C.M. Immunotherapy through the Lens of Non-Small Cell Lung Cancer. Cancers 2023, 15, 2996. [Google Scholar] [CrossRef]
- Desai, A.; Peters, S. Immunotherapy-Based Combinations in Metastatic NSCLC. Cancer Treat. Rev. 2023, 116, 102545. [Google Scholar] [CrossRef] [PubMed]
- Lü, J.-M.; Nurko, J.; Weakley, S.M.; Jiang, J.; Kougias, P.; Lin, P.H.; Yao, Q.; Chen, C. Molecular Mechanisms and Clinical Applications of Nordihydroguaiaretic Acid (NDGA) and Its Derivatives: An Update. Med. Sci. Monit. Int. Med. J. Exp. Clin. Res. 2010, 16, RA93. [Google Scholar]
- Manda, G.; Rojo, A.I.; Martínez-Klimova, E.; Pedraza-Chaverri, J.; Cuadrado, A. Nordihydroguaiaretic Acid: From Herbal Medicine to Clinical Development for Cancer and Chronic Diseases. Front. Pharmacol. 2020, 11, 151. [Google Scholar] [CrossRef] [PubMed]
- Hernández-Damián, J.; Andérica-Romero, A.C.; Pedraza-Chaverri, J. Paradoxical Cellular Effects and Biological Role of the Multifaceted Compound Nordihydroguaiaretic Acid. Arch. Pharm. 2014, 347, 685–697. [Google Scholar] [CrossRef]
- Leon, D.; Parada, D.; Vargas-Uribe, M.; Perez, A.A.; Ojeda, L.; Zambrano, A.; Reyes, A.M.; Salas, M. Effect of Nordihydroguaiaretic Acid on Cell Viability and Glucose Transport in Human Leukemic Cell Lines. FEBS Open Bio 2016, 6, 1000–1007. [Google Scholar] [CrossRef] [PubMed]
- Youngren, J.F.; Gable, K.; Penaranda, C.; Maddux, B.A.; Zavodovskaya, M.; Lobo, M.; Campbell, M.; Kerner, J.; Goldfine, I.D. Nordihydroguaiaretic Acid (NDGA) Inhibits the IGF-1 and c-ErbB2/HER2/Neu Receptors and Suppresses Growth in Breast Cancer Cells. Breast Cancer Res. Treat. 2005, 94, 37–46. [Google Scholar] [CrossRef]
- Tong, W.G.; Ding, X.Z.; Adrian, T.E. The Mechanisms of Lipoxygenase Inhibitor-Induced Apoptosis in Human Breast Cancer Cells. Biochem. Biophys. Res. Commun. 2002, 296, 942–948. [Google Scholar] [CrossRef]
- Li, X.; Fan, S.; Pan, X.; Xiaokaiti, Y.; Duan, J.; Shi, Y.; Pan, Y.; Tie, L.; Wang, X.; Li, Y.; et al. Nordihydroguaiaretic Acid Impairs Prostate Cancer Cell Migration and Tumor Metastasis by Suppressing Neuropilin 1. Oncotarget 2016, 7, 86225–86238. [Google Scholar] [CrossRef]
- Ryan, C.J.; Zavodovskaya, M.; Youngren, J.F.; Campbell, M.; Diamond, M.; Jones, J.; Shiry, L.; Allan, G.; Maddux, B.A.; Goldfine, I.D. Inhibitory Effects of Nordihydroguaiaretic Acid (NDGA) on the IGF-1 Receptor and Androgen Dependent Growth of LAPC-4 Prostate Cancer Cells. Prostate 2008, 68, 1232–1240. [Google Scholar] [CrossRef]
- Meyer, G.E.; Chesler, L.; Liu, D.; Gable, K.; Maddux, B.A.; Goldenberg, D.D.; Youngren, J.F.; Goldfine, I.D.; Weiss, W.A.; Matthay, K.K.; et al. Nordihydroguaiaretic Acid Inhibits Insulin-like Growth Factor Signaling, Growth, and Survival in Human Neuroblastoma Cells. J. Cell Biochem. 2007, 102, 1529–1541. [Google Scholar] [CrossRef]
- Seufferlein, T.; Seckl, M.J.; Schwarz, E.; Beil, M.; v Wichert, G.; Baust, H.; Lührs, H.; Schmid, R.M.; Adler, G. Mechanisms of Nordihydroguaiaretic Acid-Induced Growth Inhibition and Apoptosis in Human Cancer Cells. Br. J. Cancer 2002, 86, 1188–1196. [Google Scholar] [CrossRef] [PubMed]
- Park, S.; Lee, J. Inhibitory Effect of Nordihydroguaiaretic Acid on β-Catenin/Tcf Signalling in β-Catenin-Activated Cells. Cell Biochem. Funct. 2011, 29, 22–29. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Pham, J.D.; Anderson, M.O.; Youngren, J.F. Nordihydroguaiaretic Acid Inhibits Transforming Growth Factor Beta Type 1 Receptor Activity and Downstream Signaling. Eur. J. Pharmacol. 2009, 616, 31–37. [Google Scholar] [CrossRef]
- Qin, P.; Li, Q.; Zu, Q.; Dong, R.; Qi, Y. Natural Products Targeting Autophagy and Apoptosis in NSCLC: A Novel Therapeutic Strategy. Front. Oncol. 2024, 14, 1379698. [Google Scholar] [CrossRef]
- Fink, S.L.; Cookson, B.T. Caspase-1-Dependent Pore Formation during Pyroptosis Leads to Osmotic Lysis of Infected Host Macrophages. J. Immunol. 2006, 202, 1913–1926. [Google Scholar] [CrossRef]
- El-Far, A.H.; Al Jaouni, S.K.; Li, X.; Fu, J. Cancer Metabolism Control by Natural Products: Pyruvate Kinase M2 Targeting Therapeutics. Phytother. Res. 2022, 36, 3181–3201. [Google Scholar] [CrossRef] [PubMed]
- Mali, S.B. Cancer Treatment: Role of Natural Products. Time to Have a Serious Rethink. Oral Oncol. Rep. 2023, 6, 100040. [Google Scholar] [CrossRef]
- Zheng, S.; Wang, W.; Aldahdooh, J.; Malyutina, A.; Shadbahr, T.; Tanoli, Z.; Pessia, A.; Tang, J. SynergyFinder Plus: Toward Better Interpretation and Annotation of Drug Combination Screening Datasets. Genom. Proteom. Bioinform. 2022, 20, 587–596. [Google Scholar] [CrossRef]
- Di Veroli, G.Y.; Fornari, C.; Wang, D.; Mollard, S.; Bramhall, J.L.; Richards, F.M.; Jodrell, D.I. Combenefit: An Interactive Platform for the Analysis and Visualization of Drug Combinations. Bioinformatics 2016, 32, 2866–2868. [Google Scholar] [CrossRef]
- Moody, T.W.; Leyton, J.; Martinez, A.; Hong, S.; Malkinson, A.; Mulshine, J.L. Lipoxygenase Inhibitors Prevent Lung Carcinogenesis and Inhibit Non-Small Cell Lung Cancer Growth. Exp. Lung Res. 1998, 24, 617–628. [Google Scholar] [CrossRef]
- Wagenknecht, B.; Schulz, J.B.; Gulbins, E.; Weller, M. Crm-A, Bcl-2 and NDGA Inhibit CD95L-Induced Apoptosis of Malignant Glioma Cells at the Level of Caspase 8 Processing. Cell Death Differ. 1998, 5, 894–900. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Chen, X.; Gueydan, C.; Han, J. Plasma Membrane Changes during Programmed Cell Deaths. Cell Res. 2017, 28, 9–21. [Google Scholar] [CrossRef]
- Rochette, L.; Dogon, G.; Rigal, E.; Zeller, M.; Cottin, Y.; Vergely, C. Lipid Peroxidation and Iron Metabolism: Two Corner Stones in the Homeostasis Control of Ferroptosis. Int. J. Mol. Sci. 2022, 24, 449. [Google Scholar] [CrossRef]
- Shah, R.; Shchepinov, M.S.; Pratt, D.A. Resolving the Role of Lipoxygenases in the Initiation and Execution of Ferroptosis. ACS Cent. Sci. 2018, 4, 387–396. [Google Scholar] [CrossRef] [PubMed]
- Tao, N.; Li, K.; Liu, J. Molecular Mechanisms of Ferroptosis and Its Role in Pulmonary Disease. Oxid. Med. Cell Longev. 2020, 2020, 9547127. [Google Scholar] [CrossRef] [PubMed]
- Lu, L.; Zhang, Y.; Tan, X.; Merkher, Y.; Leonov, S.; Zhu, L.; Deng, Y.; Zhang, H.; Zhu, D.; Tan, Y.; et al. Emerging Mechanisms of Pyroptosis and Its Therapeutic Strategy in Cancer. Cell Death Discov. 2022, 8, 338. [Google Scholar] [CrossRef]
- Ros, U.; Peña-Blanco, A.; Hänggi, K.; Kunzendorf, U.; Krautwald, S.; Wong, W.W.L.; García-Sáez, A.J. Necroptosis Execution Is Mediated by Plasma Membrane Nanopores Independent of Calcium. Cell Rep. 2017, 19, 175–187. [Google Scholar] [CrossRef]
- Avis, I.M.; Jett, M.; Boyle, T.; Vos, M.D.; Moody, T.; Treston, A.M.; Martínez, A.; Mulshine, J.L. Growth Control of Lung Cancer by Interruption of 5-Lipoxygenase-Mediated Growth Factor Signaling. J. Clin. Invest. 1996, 97, 806–813. [Google Scholar] [CrossRef]
- Gao, P.; Zhai, F.; Guanand, L.; Zheng, J. Nordihydroguaiaretic Acid Inhibits Growth of Cervical Cancer SiHa Cells by Up-Regulating P21. Oncol. Lett. 2011, 2, 123. [Google Scholar] [CrossRef]
- Zhao, Q.W.; Lin, Y.; Xu, C.R.; Yao, Y.L.; Cui, Y.H.; Zhang, X.; Bian, X.W. NDGA-P21, a Novel Derivative of Nordihydroguaiaretic Acid, Inhibits Glioma Cell Proliferation and Stemness. Lab. Investig. 2017, 97, 1180–1187. [Google Scholar] [CrossRef]
- Zavodovskaya, M.; Campbell, M.J.; Maddux, B.A.; Shiry, L.; Allan, G.; Hodges, L.; Kushner, P.; Kerner, J.A.; Youngren, J.F.; Goldfine, I.D. Nordihydroguaiaretic Acid (NDGA), an Inhibitor of the HER2 and IGF-1 Receptor Tyrosine Kinases, Blocks the Growth of HER2-Overexpressing Human Breast Cancer Cells. J. Cell Biochem. 2008, 103, 624–635. [Google Scholar] [CrossRef] [PubMed]
- Synergistic Effects of New Chemopreventive Agents and Conventional Cytotoxic Agents against Human Lung Cancer Cell Lines1|Cancer Research|American Association for Cancer Research. Available online: https://aacrjournals.org/cancerres/article/59/24/6178/505702/Synergistic-Effects-of-New-Chemopreventive-Agents (accessed on 21 September 2024).
- Xu, L.; Shi, F.; Wu, Y.; Yao, S.; Wang, Y.; Jiang, X.; Su, L.; Liu, X. Gasdermin E Regulates the Stability and Activation of EGFR in Human Non-Small Cell Lung Cancer Cells. Cell Commun. Signal. 2023, 21, 83. [Google Scholar] [CrossRef] [PubMed]
- Chen, P.H.; Cai, L.; Huffman, K.; Yang, C.; Kim, J.; Faubert, B.; Boroughs, L.; Ko, B.; Sudderth, J.; McMillan, E.A.; et al. Metabolic Diversity in Human Non-Small Cell Lung Cancer Cells. Mol. Cell 2019, 76, 838–851.e5. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.-Q.; Li, M.-X.; Li, C.; Gu, X.-X.; Zheng, M.-Z.; Chen, L.-X.; Li, H. Natural Products and Derivatives Targeting at Cancer Energy Metabolism: A Potential Treatment Strategy. Curr. Med. Sci. 2020, 40, 205–217. [Google Scholar] [CrossRef]
- Lu, H.; Li, X.; Luo, Z.; Liu, J.; Fan, Z. Cetuximab Reverses the Warburg Effect by Inhibiting HIF-1-Regulated LDH-A. Mol. Cancer Ther. 2013, 12, 2187–2199. [Google Scholar] [CrossRef]
- Wang, K.; Lu, H.; Wang, X.; Liu, Q.; Hu, J.; Liu, Y.; Jin, M.; Kong, D. Simultaneous Suppression of PKM2 and PHGDH Elicits Synergistic Anti-Cancer Effect in NSCLC. Front. Pharmacol. 2023, 14, 1200538. [Google Scholar] [CrossRef]
- Roell, K.R.; Reif, D.M.; Motsinger-Reif, A.A. An Introduction to Terminology and Methodology of Chemical Synergy-Perspectives from across Disciplines. Front. Pharmacol. 2017, 8, 241453. [Google Scholar] [CrossRef]
- Ma, J.; Motsinger-Reif, A. Prediction of Synergistic Drug Combinations Using PCA-Initialized Deep Learning. BioData Min. 2021, 14, 1–15. [Google Scholar] [CrossRef]
- Resveratrol Enhanced Anticancer Effects of Cisplatin on Non-Small Cell Lung Cancer Cell Lines by Inducing Mitochondrial Dysfunction and Cell Apoptosis. Available online: https://www.spandidos-publications.com/10.3892/ijo.2015.3124 (accessed on 19 October 2024).
- Liu, Y.; He, C.; Huang, X.; Liu, Y.; He, C.; Huang, X. Metformin Partially Reverses the Carboplatin-Resistance in NSCLC by Inhibiting Glucose Metabolism. Oncotarget 2017, 8, 75206–75216. [Google Scholar] [CrossRef]
- Zhang, T.; Wan, B.; Zhao, Y.; Li, C.; Liu, H.; Lv, T.; Zhan, P.; Song, Y. Treatment of Uncommon EGFR Mutations in Non-Small Cell Lung Cancer: New Evidence and Treatment. Transl. Lung Cancer Res. 2019, 8, 302. [Google Scholar] [CrossRef]
- Fois, S.S.; Paliogiannis, P.; Zinellu, A.; Fois, A.G.; Cossu, A.; Palmieri, G. Molecular Epidemiology of the Main Druggable Genetic Alterations in Non-Small Cell Lung Cancer. Int. J. Mol. Sci. 2021, 22, 612. [Google Scholar] [CrossRef] [PubMed]
- Pao, W.; Wang, T.Y.; Riely, G.J.; Miller, V.A.; Pan, Q.; Ladanyi, M.; Zakowski, M.F.; Heelan, R.T.; Kris, M.G.; Varmus, H.E. KRAS Mutations and Primary Resistance of Lung Adenocarcinomas to Gefitinib or Erlotinib. PLoS Med. 2005, 2, 0057–0061. [Google Scholar] [CrossRef] [PubMed]
- Meyer, A.N.; McAndrew, C.W.; Donoghue, D.J. Nordihydroguaiaretic Acid Inhibits an Activated Fibroblast Growth Factor Receptor 3 Mutant and Blocks Downstream Signaling in Multiple Myeloma Cells. Cancer Res. 2008, 68, 7362–7370. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Han, C.Y.; Duan, F.G.; Fan, X.X.; Yao, X.J.; Parks, R.J.; Tang, Y.J.; Wang, M.F.; Liu, L.; Tsang, B.K.; et al. P53 Sensitizes Chemoresistant Non-Small Cell Lung Cancer via Elevation of Reactive Oxygen Species and Suppression of EGFR/PI3K/AKT Signaling. Cancer Cell Int. 2019, 19, 1–13. [Google Scholar] [CrossRef]
- Wang, B.; Yu, S.-C.; Jiang, J.-Y.; Porter, G.W.; Zhao, L.-T.; Wang, Z.; Tan, H.; Cui, Y.-H.; Qian, C.; Ping, Y.-F.; et al. An Inhibitor of Arachidonate 5-Lipoxygenase, Nordy, Induces Differentiation and Inhibits Self-Renewal of Glioma Stem-like Cells. Stem Cell Rev. Rep. 2011, 7, 458–470. [Google Scholar] [CrossRef]
- Bibikova, M.V.; Spiridonova, N.A.; Korystova, A.F.; Kublik, L.N.; Levitman, M.K.; Shaposhnikova, V.V.; Korystov, Y.N. Lipoxygenase Inhibitors Nordihydroguaiaretic Acid and Fungus Lecanicillum Lecanii Extract Induce Death of Lymphoid Leukemia Cells. Bull. Exp. Biol. Med. 2017, 163, 330–333. [Google Scholar] [CrossRef]
- Huang, J.K.; Chen, W.C.; Huang, C.J.; Hsu, S.S.; Chen, J.S.; Cheng, H.H.; Chang, H.T.; Jiann, B.P.; Jan, C.R. Nordihydroguaiaretic Acid-Induced Ca2+ Handling and Cytotoxicity in Human Prostate Cancer Cells. Life Sci. 2004, 75, 2341–2351. [Google Scholar] [CrossRef]
- Rowe, D.L.; Ozbay, T.; Bender, L.M.; Nahta, R. Nordihydroguaiaretic Acid, a Cytotoxic Insulin-like Growth Factor-I Receptor/HER2 Inhibitor in Trastuzumab-Resistant Breast Cancer. Mol. Cancer Ther. 2008, 7, 1900–1908. [Google Scholar] [CrossRef] [PubMed]
- Zúñiga-Toalá, A.; Zatarain-Barrón, Z.L.; Hernández-Pando, R.; Negrette-Guzmán, M.; Huerta-Yepez, S.; Torres, I.; Pinzón, E.; Tapia, E.; Pedraza-Chaverri, J. Nordihydroguaiaretic Acid Induces Nrf2 Nuclear Translocation in Vivo and Attenuates Renal Damage and Apoptosis in the Ischemia and Reperfusion Model. Phytomedicine 2013, 20, 775–779. [Google Scholar] [CrossRef]
- Park, R.; Chang, C.C.; Liang, Y.C.; Chung, Y.; Henry, R.A.; Lin, E.; Mold, D.E.; Huang, R.C.C. Systemic Treatment with Tetra-O-Methyl Nordihydroguaiaretic Acid Suppresses the Growth of Human Xenograft Tumors. Clin. Cancer Res. 2005, 11, 4601–4609. [Google Scholar] [CrossRef]
- Vázquez-Cervantes, G.I.; Villaseñor-Aguayo, K.; Hernández-Damián, J.; Aparicio-Trejo, O.E.; Medina-Campos, O.N.; López-Marure, R.; Pedraza-Chaverri, J. Antitumor Effects of Nordihydroguaiaretic Acid (NDGA) in Bladder T24 Cancer Cells Are Related to Increase in ROS Production and Mitochondrial Leak Respiration. Nat. Prod. Commun. 2018, 13, 1523–1526. [Google Scholar] [CrossRef]
- Gordon, D.W.; Baker, A.L.; Rosenthal, G.; Hart, J.; Sirota, R. Chaparral Ingestion: The Broadening Spectrum of Liver Injury Caused by Herbal Medications. JAMA 1995, 273, 489–490. [Google Scholar] [CrossRef] [PubMed]
- Friedlander, T.W.; Weinberg, V.K.; Huang, Y.; Mi, J.T.; Formaker, C.G.; Small, E.J.; Harzstark, A.L.; Lin, A.M.; Fong, L.; Ryan, C.J. A Phase II Study of Insulin-like Growth Factor Receptor Inhibition with Nordihydroguaiaretic Acid in Men with Non-Metastatic Hormone-Sensitive Prostate Cancer. Oncol. Rep. 2012, 27, 3–9. [Google Scholar] [CrossRef]
- Foucquier, J.; Guedj, M. Analysis of Drug Combinations: Current Methodological Landscape. Pharmacol. Res. Perspect. 2015, 3, e00149. [Google Scholar] [CrossRef] [PubMed]
- Castro-Guarda, M.; Arancibia, Y.; Chipón, C.; Matamala, C.; Oyarzo, P.; Vargas, G.; Reyes, A.; Salas, M.; Morera, F.J.; Zambrano, A. Metabolic Changes Induced by DNA Damage in Ramos Cells: Exploring the Role of MTORC1 Complex. FEBS Open Bio 2022, 12, 1509–1522. [Google Scholar] [CrossRef]
Cell Line | IC50 (µM) 24 h |
---|---|
H1975 | 90.8 ± 18 |
H1299 | 89.5 ± 15 |
A549 | 99.4 ± 19 |
Primers | Sequence 5′-3′ |
---|---|
ACTh Forward | AGATCAAGATCATTGCTCCTC |
ACTh Reverse | GGGTGTAACGCAACTAAGTC |
BAX Forward | GGCAGCTGACATGTTTTCTGAC |
BAX Reverse | CACCCAACCACCCTGGTCTT |
BCL2 Forward | TTGAGTTCGGTGGGGTCAT |
BCL2 Reverse | GACTTCACTTGTGGCCCAG |
GLUT1 Forward | CTTCACTGTCGTGTCGCTGT |
GLUT1 Reverse | CCAGGACCCACTTCAAAGAAA |
GLUT3 Forward | GCTATGGCCGCTGCTACTGGG |
GLUT3 Reverse | CCACAACCGCTGGAGGATCTGC |
LDH Forward | ATCTTGACCTACGTGGCTTGGA |
LDH Reverse | CCATACAGGCACACTGGAATCTC |
HIF1 Forward | CGTTCCTCCGATCAGTTGTC |
HIF1 Reverse | TCAGTGGTGGCAGTGGTAGT |
KI67 Forward | CGTCCCAGTGGAAGAGTTGT |
KI67 Reverse | CGACCCCGCTCCTTTTGATA |
PKM2 Forward | ATTATTTGAGGAACTCCGCCGCCT |
PKM2 Reverse | ATTCCGGGTCACAGCAATGATGG |
IL-1β Forward | TCCTGTCCTGCGTGTTTGAA |
IL-1β Reverse | TCTTTGGGTAATTTTTGGGATCT |
IL-18 Forward | TGCATCAACTTTGTGGCAAT |
IL-18 Reverse | ATAGAGGCCGATTTCCTTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chipón, C.; Riffo, P.; Ojeda, L.; Salas, M.; Burgos, R.A.; Ehrenfeld, P.; López-Muñoz, R.; Zambrano, A. Impact of Nordihydroguaiaretic Acid on Proliferation, Energy Metabolism, and Chemosensitization in Non-Small-Cell Lung Cancer (NSCLC) Cell Lines. Int. J. Mol. Sci. 2024, 25, 11601. https://doi.org/10.3390/ijms252111601
Chipón C, Riffo P, Ojeda L, Salas M, Burgos RA, Ehrenfeld P, López-Muñoz R, Zambrano A. Impact of Nordihydroguaiaretic Acid on Proliferation, Energy Metabolism, and Chemosensitization in Non-Small-Cell Lung Cancer (NSCLC) Cell Lines. International Journal of Molecular Sciences. 2024; 25(21):11601. https://doi.org/10.3390/ijms252111601
Chicago/Turabian StyleChipón, Carina, Paula Riffo, Loreto Ojeda, Mónica Salas, Rafael A. Burgos, Pamela Ehrenfeld, Rodrigo López-Muñoz, and Angara Zambrano. 2024. "Impact of Nordihydroguaiaretic Acid on Proliferation, Energy Metabolism, and Chemosensitization in Non-Small-Cell Lung Cancer (NSCLC) Cell Lines" International Journal of Molecular Sciences 25, no. 21: 11601. https://doi.org/10.3390/ijms252111601
APA StyleChipón, C., Riffo, P., Ojeda, L., Salas, M., Burgos, R. A., Ehrenfeld, P., López-Muñoz, R., & Zambrano, A. (2024). Impact of Nordihydroguaiaretic Acid on Proliferation, Energy Metabolism, and Chemosensitization in Non-Small-Cell Lung Cancer (NSCLC) Cell Lines. International Journal of Molecular Sciences, 25(21), 11601. https://doi.org/10.3390/ijms252111601