Genetic Variation Study of Several Romanian Pepper (Capsicum annuum L.) Varieties Revealed by Molecular Markers and Whole Genome Resequencing
Abstract
:1. Introduction
2. Results
2.1. Genetic Diversity Analysis
2.1.1. SSR Analysis
2.1.2. ISSR Analysis
2.2. NGS Data Analysis and Quality Control
2.2.1. Single Nucleotide Polymorphism (SNP) Detection and Annotation
2.2.2. Insertion/Deletion (InDel) Detection and Annotation
2.2.3. Structural Variant (SV) Detection and Annotation
2.2.4. Copy Number Variation (CNV) Detection and Annotation
2.3. Sanger Sequencing and Multiple Genomic Alignments
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. DNA Extraction
4.3. ISSR Analysis
4.4. SSR Analysis
4.5. Molecular Markers Data Analysis
4.6. NGS, Data Processing, and Sequencing Analysis
4.7. Cloning and Sanger Sequencing
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Paran, I.; van der Knaap, E. Genetic and molecular regulation of fruit and plant domestication traits in tomato and pepper. J. Exp. Bot. 2007, 58, 3841–3852. [Google Scholar] [CrossRef] [PubMed]
- Van Zonneveld, M.; Ramirez, M.; Williams, D.E.; Petz, M.; Meckelmann, S.; Avila, T.; Bejarano, C.; Ríos, L.; Peña, K.; Jäger, M.; et al. Screening genetic resources of Capsicum peppers in their primary center of diversity in Bolivia and Peru. PLoS ONE 2015, 10, e0134663. [Google Scholar] [CrossRef] [PubMed]
- Barcanu-Tudor, E.; Drăghici, E.M.; Vînătoru, C. New Variety of Sweet Pepper (Capsicum annuum var. Grossum) Obtained at VRDS Buzău. Bull. UASVM Hortic. 2018, 75, 1–3. [Google Scholar] [CrossRef]
- Olatunji, T.L.; Afolayan, A.J. Evaluation of genetic relationship among varieties of Capsicum annuum L. and Capsicum frutescens L. in West Africa using ISSR markers. Heliyon 2019, 5, e01700. [Google Scholar] [CrossRef] [PubMed]
- Lam, H.M.; Xu, X.; Liu, X.; Chen, W.; Yang, G.; Wong, F.L.; Li, M.W.; He, W.; Qin, N.; Wang, B.; et al. Resequencing of 31 wild and cultivated soybean genomes identifies patterns of genetic diversity and selection. Nat. Genet. 2010, 42, 1053–1059. [Google Scholar] [CrossRef]
- Solomon, A.M.; Han, K.; Lee, J.H.; Lee, H.Y.; Jang, S.; Kang, B.C. Genetic diversity and population structure of Ethiopian Capsicum germplasms. PLoS ONE 2019, 14, e0216886. [Google Scholar] [CrossRef]
- Thul, S.T.; Darokar, M.P.; Shasany, A.K.; Khanuja, S.P. Molecular profiling for genetic variability in Capsicum species based on ISSR and RAPD markers. Mol. Biotechnol. 2012, 51, 137–147. [Google Scholar] [CrossRef]
- Portis, E.; Nagy, I.; Sasvári, Z.; Stágel, A.; Barchi, L.; Lanteri, S. The design of Capsicum spp. SSR assays via analysis of in silico DNA sequence, and their potential utility for genetic mapping. Plant Sci. 2007, 172, 640–648. [Google Scholar] [CrossRef]
- Rai, M.K.; Phulwaria, M.; Shekhawat, N.S. Transferability of simple sequence repeat (SSR) markers developed in guava (Psidium guajava L.) to four Myrtaceae species. Mol. Biol. Rep. 2013, 40, 5067–5071. [Google Scholar] [CrossRef]
- Tsaballa, A.; Ganopoulos, I.; Timplalexi, A.; Aliki, X.; Bosmali, I.; Irini, N.O.; Tsaftaris, A.; Madesis, P. Molecular characteri-zation of Greek pepper (Capsicum annuum L.) landraces with neutral (ISSR) and gene-based (SCoT and EST-SSR) molecular markers. Biochem. Syst. Ecol. 2015, 59, 256–263. [Google Scholar] [CrossRef]
- Ince, A.G.; Karaca, M.; Turgut, K. Development of new set of EST-SSR primer pairs for celery (Apium graveolens L.). Planta Med. 2010, 76, P036. [Google Scholar] [CrossRef]
- Zhao, Y.; Gui, L.; Hou, C.; Zhang, D.; Sun, S. GwasWA: A GWAS one-stop analysis platform from WGS data to variant effect assessment. Comput. Biol. Med. 2024, 169, 107820. [Google Scholar] [CrossRef]
- Choudhury, A.; Ramsay, M.; Hazelhurst, S.; Aron, S.; Bardien, S.; Botha, G.; Chimusa, E.R.; Christoffels, A.; Gamieldien, J.; Sefid-Dashti, M.J.; et al. Whole-genome sequencing for an enhanced understanding of genetic variation among South Africans. Nat. Commun. 2017, 8, 2062. [Google Scholar] [CrossRef] [PubMed]
- Ou, L.; Li, D.; Lv, J.; Chen, W.; Zhang, Z.; Li, X.; Yang, B.; Zhou, S.; Yang, S.; Li, W.; et al. Pan-genome of cultivated pepper (Capsicum) and its use in gene presence–absence variation analyses. New Phytol. 2018, 220, 360–363. [Google Scholar] [CrossRef]
- The Official Catalogue of Cultivated Plant Varieties in Romania for 2020 (ISTIS). Available online: https://istis.ro/wp-content/uploads/2024/07/ISTIS-CATALOG-OFICIAL-2024.pdf (accessed on 20 October 2020).
- Lee, J.M.; Nahm, S.H.; Kim, Y.M.; Kim, B.D. Characterization and molecular genetic mapping of microsatellite loci in pepper. Theor. Appl Genet. 2004, 108, 619–627. [Google Scholar] [CrossRef]
- Ibarra-Torres, P.; Valadez-Moctezuma, E.; Pérez-Grajales, M.; Rodríguez-Campos, J.; Jaramillo-Flores, M.E. Inter-and intra-specific differentiation of Capsicum annuum and Capsicum pubescens using ISSR and SSR markers. Sci. Hortic. 2015, 181, 137–146. [Google Scholar] [CrossRef]
- Sbîrciog, G.; Buzatu, A.; Mândru, I.; Scurtu, I. Achievements in pepper breeding at Research Development Institute for Vegetable and Flower Growing-Vidra. Curr. Trends Nat. Sci. 2016, 5, 33–37. [Google Scholar]
- Drăghici, M.C.; Cristea, G.M.; Popa, E.E.; Miteluț, C.A.; Popescu, A.P.; Tylewicz, U.; Rosa, D.M.; Popa, E.M. Research on blanching pretreatment and freezing technology effect on selected vegetables. AgroLife Sci. J. 2023, 12, 69–76. [Google Scholar] [CrossRef]
- Agapie, O.L.; Florin, S.; Costel, V.; Bianca, T.; Elena, B.; Geanina, N.; Ion, G. Description of valuable genotypes from germplasm collection of hot peppers set by directions of use. Bull. UASVM Hortic. 2020, 77, 117–121. [Google Scholar] [CrossRef]
- González, M.X.R.; Vicente, O. Agrobiodiversity: Conservation, threats, challenges, and strategies for the 21st century. AgroLife Sci. J. 2023, 12, 174–185. [Google Scholar] [CrossRef]
- Agapie, O.L.; Barcanu, E. A Brief Description of Cultivated Chili Peppers. Sci. Papers. Ser. B Hortic. 2024, LXVIII, 375–380. [Google Scholar]
- Iordăchescu, M.; Udriște, A.A.; Popa, V.; Bădulescu, L. Seed germination survey of Romanian tomato and pepper varieties. Res. J. Agric. Sci. 2020, 52, 47–55. [Google Scholar]
- Vintilă, M.; Niculescu, F.A. Technical aspects concerning the preservation of peppers in different storage conditions. Sci. Pap. Ser. B Hortic. 2015, 59, 281–284. [Google Scholar]
- Hoble, A.; Dirja, M.; Luca, E.; Luca, L.; Salagean, T. Technology Elements for Irrigated Pepper (Capsicum annuum L.) growth in Field Cultivation Conditions. Bull. UASVM Hortic. 2010, 67, 529. [Google Scholar] [CrossRef]
- Scaeteanu, V.G.; Săndulescu, E.B.; Alistar, C.F.; Croitoru, C.M.; Madjar, R.A.; Alistar, A.; Gîlea, G.C.; Stavrescu, M. A short note on water quality and some biodiversity components in Gurban valley, Giurgiu County. AgroLife Sci. J. 2023, 12, 167–180. [Google Scholar] [CrossRef]
- Dimitrova, K.; Kartalska, Y.; Panayotov, N. Effect of application of biostimulant Protifert LN 6.5 on the epiphytic and rhizosphere bacteria of pepper seedlings. Sci. Pap. Ser. B Hortic. 2024, LXVIII, 438–443. [Google Scholar]
- Stoica, V.; Hoza, D. Research on the influence of organic fertilizers on the agrochemical indicators of the soil. Sci. Pap. Ser. B Hortic. 2024, LXVIII, 188–193. [Google Scholar]
- Uleanu, F. Results on the effect of different types of Romanian native peat bio composites pots on seedling growth. Curr. Trend. Nat. Sci. 2013, 2, 92–95. [Google Scholar]
- Iordăchescu, M.; Udriște, A.A.; Jerca, O.; Bădulescu, L. Seedling Emergence Comparison of Several Romanian Tomato and Pepper Varieties. Bull. Univ. Agric. Sci. Veter Med. Cluj-Napoc. Hortic. 2021, 78, 76. [Google Scholar] [CrossRef]
- Finnegan, D.J. Retrotransposons. Curr. Biol. 2012, 22, R432–R437. [Google Scholar] [CrossRef]
- de Assis, R.; Baba, V.Y.; Cintra, L.A.; Gonçalves, L.S.A.; Rodrigues, R.; Vanzela, A.L.L. Genome relationships and LTR-retrotransposon diversity in three cultivated Capsicum, L.(Solanaceae) species. BMC Genom. 2020, 21, 237. [Google Scholar] [CrossRef] [PubMed]
- Park, M.; Choi, D. The structure of pepper genome. In Genetics, Genomics and Breeding of Peppers and Eggplants; CRC Press: Boca Raton, FL, USA, 2013; pp. 122–126. [Google Scholar] [CrossRef]
- Park, M.; Park, J.; Kim, S.; Kwon, J.-K.; Park, H.M.; Bae, I.H.; Yang, T.-J.; Lee, Y.-H.; Kang, B.-C.; Choi, D. Evolution of the large genome in Capsicum annuum occurred through accumulation of single-type long terminal repeat retrotransposons and their derivatives. Plant J. 2012, 69, 1018–1029. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Tang, X.; Cheng, Z.; Mueller, L.; Giovannoni, J.; Tanksley, S.D. Euchromatin and Pericentromeric Heterochromatin: Comparative Composition in the Tomato Genome. Genetics 2006, 172, 2529–2540. [Google Scholar] [CrossRef]
- Meyers, B.C.; Tingey, S.V.; Morgante, M. Abundance, Distribution, and Transcriptional Activity of Repetitive Elements in the Maize Genome. Genome Res. 2001, 11, 1660–1676. [Google Scholar] [CrossRef]
- Galindo-González, L.; Mhiri, C.; Deyholos, M.K.; Grandbastien, M.-A. LTR-retrotransposons in plants: Engines of evolution. Gene 2017, 626, 14–25. [Google Scholar] [CrossRef]
- Islam, M.; El-Sappah, A.H.; Ali, H.M.; Zandi, P.; Huang, Q.; Soaud, S.A.; Alazizi, E.M.; Wafa, H.A.; Hossain, A.; Liang, Y. Pathogenesis-related proteins (PRs) countering environmental stress in plants: A review. S. Afr. J. Bot. 2023, 160, 414–427. [Google Scholar] [CrossRef]
- Ali, S.; Ganai, B.A.; Kamili, A.N.; Bhat, A.A.; Mir, Z.A.; Bhat, J.A.; Tyagi, A.; Islam, S.T.; Mushtaq, M.; Yadav, P.; et al. Pathogenesis-related proteins and peptides as promising tools for engineering plants with multiple stress tolerance. Microbiol. Res. 2018, 212, 29–37. [Google Scholar] [CrossRef]
- Anisimova, O.K.; Shchennikova, A.V.; Kochieva, E.Z.; Filyushin, M.A. Pathogenesis-related genes of PR1, PR2, PR4, and PR5 families are involved in the response to Fusarium infection in garlic (Allium sativum L.). Int. J. Mol. Sci. 2021, 22, 6688. [Google Scholar] [CrossRef]
- Dos Santos, C.; Franco, O.L. Pathogenesis-related proteins (PRs) with enzyme activity activating plant defense responses. Plants 2023, 12, 2226. [Google Scholar] [CrossRef]
- Yang, J.; Zhang, J.; Du, H.; Zhao, H.; Li, H.; Xu, Y.; Mao, A.; Zhang, X.; Fu, Y.; Xia, Y.; et al. The vegetable SNP database: An integrated resource for plant breeders and scientists. Genomics 2022, 114, 110348. [Google Scholar] [CrossRef]
- Wang, S.; Yang, X.; Xu, M.; Lin, X.; Lin, T.; Qi, J.; Shao, G.; Tian, N.; Yang, Q.; Zhang, Z.; et al. A rare SNP identified a TCP transcription factor essential for tendril development in cucumber. Mol. Plant 2015, 8, 1795–1808. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.; Liu, Q.; Li, J.; Jiang, D.; Zhou, L.; Wu, P.; Lu, S.; Li, F.; Zhu, L.; Liu, Z.; et al. Photoperiod-and thermo-sensitive genic male sterility in rice are caused by a point mutation in a novel noncoding RNA that produces a small RNA. Cell Res. 2012, 22, 649–660. [Google Scholar] [CrossRef]
- Jia, J.I.A.; Huan, W.A.N.G.; Yang, X.M.; Bo, C.H.E.N.; Wei, R.Q.; Cheng, Y.B.; Hai, N.I.A.N. Identification of the long InDels through whole genome resequencing to fine map of qIF05-1 controlling seed isoflavone content in soybean (Glycine max L. Merr.). J. Integr. Agric. 2023; in press. [Google Scholar] [CrossRef]
- Fliege, C.E.; Ward, R.A.; Vogel, P.; Nguyen, H.; Quach, T.; Guo, M.; Viana, J.P.G.; dos Santos, L.B.; Specht, J.E.; Clemente, T.E.; et al. Fine mapping and cloning of the major seed protein quantitative trait loci on soybean chromosome 20. Plant J. 2022, 110, 114–128. [Google Scholar] [CrossRef]
- Moghaddam, S.M.; Song, Q.; Mamidi, S.; Schmutz, J.; Lee, R.; Cregan, P.; Osorno, J.M.; McClean, P.E. Developing market class specific InDel markers from next generation sequence data in Phaseolus vulgaris L. Front. Plant Sci. 2014, 5, 185. [Google Scholar] [CrossRef]
- Guo, G.; Zhang, G.; Pan, B.; Diao, W.; Liu, J.; Ge, W.; Gao, C.; Zhang, Y.; Jiang, C.; Wang, S. Development and Application of InDel Markers for Capsicum spp. Based on Whole-Genome Re-Sequencing. Sci. Rep. 2019, 9, 3691. [Google Scholar] [CrossRef] [PubMed]
- Britten, R.J.; Rowen, L.; Williams, J.; Cameron, R.A. Majority of divergence between closely related DNA samples is due to indels. Proc. Natl. Acad. Sci. USA 2003, 100, 4661–4665. [Google Scholar] [CrossRef] [PubMed]
- Delmore, K.E.; Van Doren, B.M.; Ullrich, K.; Curk, T.; van der Jeugd, H.P.; Liedvogel, M. Structural genomic variation and migratory behavior in a wild songbird. Evol. Lett. 2023, 7, 401–412. [Google Scholar] [CrossRef]
- Blue, Y.A.; Satake, A. Analyses of gene copy number variation in diverse epigenetic regulatory gene families across plants: Increased copy numbers of BRUSHY1/TONSOKU/MGOUN3 (BRU1/TSK/MGO3) and SILENCING DEFECTIVE 3 (SDE3) in long-lived trees. Plant Gene 2022, 32, 100384. [Google Scholar] [CrossRef]
- Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef]
- Pacheco, Á.; Alvarado, G.; Rodríguez, F.; Crossa, J.; Burgueño, J. BIO-R (Biodiversity Analysis with R for Windows), Version 3.0; International Maize and Wheat Improvement Center: Estado de México, México, 2020.
- Laval, G.; San Cristobal, M.; Chevalet, C. Measuring genetic distances between breeds: Use of some distances in various short term evolution models. Genet. Sel. Evol. 2002, 34, 481. [Google Scholar] [CrossRef]
- Nei, M. Molecular Evolutionary Genetics; Columbia University Press: New York, NY, USA, 1987. [Google Scholar]
- Serrote, C.M.L.; Reiniger, L.R.S.; Silva, K.B.; dos Santos Rabaiolli, S.M.; Stefanel, C.M. Determining the Polymorphism Information Content of a molecular marker. Gene 2020, 726, 144175. [Google Scholar] [CrossRef] [PubMed]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 2, 314. [Google Scholar]
- Roldàn-Ruiz, I.; Dendauw, J.; Van Bockstaele, E.; Depicker, A.; De Loose, M. AFLP markers reveal high polymorphic rates in ryegrasses (Lolium spp.). Molec. Breed. 2000, 6, 125–134. Available online: http://hdl.handle.net/1854/LU-133034 (accessed on 20 October 2020). [CrossRef]
- De Riek, J.; Calsyn, E.; Everaert, I.; Van Bockstaele, E.; De Loose, M. AFLP based alternatives for the assessment of distinct-ness, uniformity and stability of sugar beet varieties. Theor. Appl. Genet. 2001, 103, 1254–1265. [Google Scholar] [CrossRef]
- Cock, P.J.A.; Fields, C.J.; Goto, N.; Heuer, M.L.; Rice, P.M. The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Res. 2010, 38, 1767–1771. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Li, M.; Hakonarson, H. ANNOVAR: Functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 2010, 38, e164. [Google Scholar] [CrossRef]
- Chen, K.; Wallis, J.W.; McLellan, M.D.; Larson, D.E.; Kalicki, J.M.; Pohl, C.S.; McGrath, S.D.; Wendl, M.C.; Zhang, Q.; Locke, D.P.; et al. BreakDancer: An algorithm for high-resolution mapping of genomic structural variation. Nat. Methods 2009, 6, 677–681. [Google Scholar] [CrossRef]
- Abyzov, A.; Urban, A.E.; Snyder, M.; Gerstein, M. CNVnator: An approach to discover, genotype, and characterize typical and atypical CNVs from family and population genome sequencing. Genome Res. 2011, 21, 974–984. [Google Scholar] [CrossRef]
ID | Locus | Primer (Forward/Reverse) | Size (bp) | Tm (°C) | Total Alleles | PIC Value |
---|---|---|---|---|---|---|
SSRP3P4 | AF244121 | 5′TACCTCCTCGCCAATCCTTCTG3′/ 5′TTGAAAGTTCTTTCCATGACAACC3′ | 200–400 bp | 45 | 3 | 0.63 |
SSRP5P6 | HpmS 1–148 | 5′GGCGGAGAAGAACTAGACGATTAGC3′/ 5′TCACCCAATCCACATAGACG3′ | 150–250 bp | 45 | 4 | 0.72 |
SSRP9P10 | HpmS 1_1 | 5′TCAACCCAATATTAAGGTCACTTCC3′/ 5′CCAGGCGGGGATTGTAGATG3′ | 260 pb | 49 | NA | NA |
SSRP11P12 | HpmS 1_274 | 5′TCCCAGACCCCTCGTGATAG3′/ 5′TCCTGCTCCTTCCACAACTG3′ | 190–530 bp | 47 | 4 | 0.71 |
SSRP19P20 | HpmS 1_172 | 5′GGGTTTGCATGATCTAAGCATTTT3′/ 5′CGCTGGAATGCATTGTCAAAGA3′ | 230–420 bp | 48 | 3 | 0.66 |
ID | Primer | Tm (°C) | Total Bands (TB) | Range of the Amplification Product (bp) | PIC Value |
---|---|---|---|---|---|
P21 | 5′ACGACAGACAGACAGACA3′ | 51 | 38 | 850–4000 bp | 0.08 |
P22 | 5′ACACACACACACACACCTG3′ | 50 | 28 | 500–2800 bp | NA |
P23 | 5′GCAGACAGACAGACAGACGC3′ | 50 | 68 | 500–4000 bp | 0.28 |
P24 | 5′GAGAGAGAGAGAGAGACTC 3′ | 50 | 56 | 800–3800 bp | 0.23 |
P25 | 5′GAGAGAGAGAGAGAGACTC3′ | 50 | 80 | 550–3100 bp | 0.29 |
P26 | 5′CACACACACACACACAAGT 3′ | 51 | 27 | 1000–2500 bp | 0.26 |
P27 | 5′GACAGACAGACAGACAGT3′ | 51 | 70 | 380–4000 bp | 0.20 |
P28 | 5′TCCTCCTCCTCCTCCAGCT3′ | 50 | 34 | 350–2700 bp | 0.29 |
Genotype | gDEC | gVLA | gGAL | gSPL | gCOS | gROI | gCAN |
---|---|---|---|---|---|---|---|
Upstream | 98,681 | 93,968 | 97,182 | 104,198 | 100,293 | 95,159 | 98,084 |
Exonic Stop gain | 645 | 644 | 635 | 720 | 664 | 657 | 634 |
Exonic Stop loss | 164 | 162 | 166 | 182 | 175 | 163 | 160 |
Exonic Synonymous | 17,898 | 17,757 | 17,668 | 19,851 | 18,012 | 17,321 | 18,229 |
Exonic Non-synonymous | 29,071 | 28,736 | 29,115 | 32,146 | 29,349 | 28,540 | 29,504 |
Intronic | 255,395 | 240,657 | 249,296 | 280,766 | 262,290 | 246,344 | 260,011 |
Splicing | 307 | 286 | 308 | 353 | 303 | 295 | 319 |
Downstream | 80,621 | 77,439 | 79,503 | 86,690 | 82,171 | 77,640 | 80,567 |
Upstream/ Downstream | 5010 | 4943 | 5126 | 5596 | 5365 | 4728 | 5058 |
Intergenic | 6,899,284 | 6,009,182 | 6,706,315 | 7,209,789 | 7,383,834 | 6,528,591 | 6,955,410 |
Others | 229,351 | 213,191 | 222,529 | 244,099 | 236,949 | 214,605 | 233,623 |
ts | 5,051,787 | 4,442,276 | 4,923,303 | 5,313,137 | 5,408,262 | 4,796,597 | 5,099,410 |
tv | 2,565,834 | 2,245,868 | 2,485,560 | 2,672,644 | 2,712,300 | 2,418,530 | 2,583,426 |
ts/tv | 1.969 | 1.978 | 1.981 | 1.988 | 1.994 | 1.983 | 1.974 |
Het. rate | 0.162 | 0.636 | 0.126 | 0.764 | 0.13 | 0.116 | 0.121 |
Total | 7,617,621 | 6,688,144 | 7,408,863 | 7,985,781 | 8,120,562 | 7,215,127 | 7,682,836 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Udriște, A.A.; Iordăchescu, M.; Bădulescu, L. Genetic Variation Study of Several Romanian Pepper (Capsicum annuum L.) Varieties Revealed by Molecular Markers and Whole Genome Resequencing. Int. J. Mol. Sci. 2024, 25, 11897. https://doi.org/10.3390/ijms252211897
Udriște AA, Iordăchescu M, Bădulescu L. Genetic Variation Study of Several Romanian Pepper (Capsicum annuum L.) Varieties Revealed by Molecular Markers and Whole Genome Resequencing. International Journal of Molecular Sciences. 2024; 25(22):11897. https://doi.org/10.3390/ijms252211897
Chicago/Turabian StyleUdriște, Anca Amalia, Mihaela Iordăchescu, and Liliana Bădulescu. 2024. "Genetic Variation Study of Several Romanian Pepper (Capsicum annuum L.) Varieties Revealed by Molecular Markers and Whole Genome Resequencing" International Journal of Molecular Sciences 25, no. 22: 11897. https://doi.org/10.3390/ijms252211897
APA StyleUdriște, A. A., Iordăchescu, M., & Bădulescu, L. (2024). Genetic Variation Study of Several Romanian Pepper (Capsicum annuum L.) Varieties Revealed by Molecular Markers and Whole Genome Resequencing. International Journal of Molecular Sciences, 25(22), 11897. https://doi.org/10.3390/ijms252211897