Next Article in Journal
USP8 Mutations Associated with Cushing’s Disease Alter Protein Structure Dynamics
Next Article in Special Issue
Momordica charantia Extract Ameliorates Melanoma Cell Proliferation and Invasion into Mouse Lungs by Suppressing PAX3 Expression
Previous Article in Journal
Sustainable Solid-State Sodium-Ion Batteries Featuring Ferroelectric Electrolytes
Previous Article in Special Issue
Assessment of the Antioxidant and Photoprotective Properties of Cornus mas L. Extracts on HDF, HaCaT and A375 Cells Exposed to UVA Radiation
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Biosynthesis of Phenolic Compounds of Medicago truncatula After Inoculation with Selected PGPR Strains

1
Institute of Marine and Environmental Sciences, University of Szczecin, Wąska 13, 71-415 Szczecin, Poland
2
Polish Society of Bioinformatics and Data Science BIODATA, Popiełuszki 4C, 71-214 Szczecin, Poland
3
Faculty of Data Science and Information, INTI International University, Nilai 71800, Negeri Sembilan, Malaysia
4
Institute of Biology, University of Szczecin, Wąska 13, 71-415 Szczecin, Poland
5
Doctoral School of the University of Szczecin, 71-412 Szczecin, Poland
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(23), 12684; https://doi.org/10.3390/ijms252312684
Submission received: 22 October 2024 / Revised: 5 November 2024 / Accepted: 22 November 2024 / Published: 26 November 2024
(This article belongs to the Special Issue Bioactive Compounds of Natural Origin)

Abstract

:
The phenylpropanoid biosynthesis pathway is involved in the response of plants to stress factors, including microorganisms. This paper presents how free-living strains of rhizobacteria Pseudomonas brassicacearum KK5, P. corrugata KK7, Paenibacillus borealis KK4, and the symbiotic strain Sinorhizobium meliloti KK13 affect the expression of genes encoding phenylalanine ammonia-lyase (PAL), the activity of this enzyme, and the production of phenolic compounds in Medicago truncatula. Seedlings were inoculated with rhizobacteria, then at T0, T24, T72, and T168 after inoculation, the leaves and roots were analyzed for gene expression, enzyme activity, and the content of phenolic compounds. All bacteria affected PAL gene expression, in particular, MtPAL2, MtPAL3, and MtPAL4. Pseudomonas strains had the greatest impact on gene expression. The inoculation affected PAL activity causing it to increase or decrease. The most stimulating effect on enzyme activity was observed 168 h after inoculation. A varied effect was also observed in the case of the content of phenolic compounds. The greatest changes were observed 24 h after inoculation, especially with the KK7 strain. The influence of the studied rhizobacteria on the biosynthesis of phenolic compounds at the molecular level (expression of MtPAL genes) and biochemical level (PAL activity and content of phenolic compounds) was confirmed. The MtPAL3 gene underwent the most significant changes after inoculation and can be used as a marker to assess the interaction between M. truncatula and rhizobacteria. The Pseudomonas strains had the greatest influence on the biosynthesis pathway of phenolic compounds.

1. Introduction

Plants live in a complex and dynamic microbial environment [1,2]. The microbiome (microbiota and their genomes) inhabits the soil, the rhizosphere, roots, and all plant tissues. So, it is no surprise that microorganisms play a key role in soil health, nutrient cycling, and plant growth and development. They also modulate the plant’s response to biotic and abiotic environments [2,3,4,5]. Plant–microbe interactions can be beneficial, neutral, or harmful, depending on the specific microbes involved and the context of the interaction [6,7].
Harmful interactions between plants and microbes can have serious consequences for plant and crop health. Pathogenic microbes can cause plant diseases, leading to stunted growth, reduced yields, and even death [8]. However, there are also many others that are beneficial for plants, like rhizobacteria (PGPRs: plant growth-promoting bacteria; PGPRs: plant growth-promoting rhizobacteria), which can improve plant growth and benefit the adaptation of plants to adverse conditions [9,10]. These bacteria can be used as biofertilizers (increase the availability of nutrients for plants), biostimulators (produce hormones or modify their levels in plants), and biopesticides (fight diseases mainly by producing antibiotics, antifungal metabolites, and fungal cell lysis enzymes and inducing systemic resistance) depending on their modes of action [10,11,12]. Bacteria can use single mechanisms to promote plant growth, but usually, multiple mechanisms are activated simultaneously [13]. Inoculation with beneficial microbes can improve plant growth and development, enhance nutrient uptake, and increase disease resistance [14]. For example, inoculation with plant growth-promoting rhizobacteria (PGPR) has been shown to improve the growth and yield of a wide range of crops, including wheat, soybean, maize, and others [11,15]. Inoculation with microbes can also help plants tolerate abiotic stress, such as drought or high salinity [16].
Plants respond to stress signals, both abiotic and biotic (including growth-promoting and plant-pathogenic microorganisms). Some of these reactions are local, while others are systemic in nature, trigger plant-wide defenses, and may lead to induced resistance. Depending on the type of elicitor, we distinguish two basic types of systemic resistance, SAR (Systemic Acquired Resistance), triggered by plant pathogens, and ISR, triggered by mutualistic microorganisms that colonize roots [14,17,18,19,20,21]. PGPRs induce early plant ISR events, including, but not limited to, increased expression of PR genes related to pathogenesis, increased activity of defense-related substances such as polyphenol oxidase, peroxidase, β-1,3-glucanase, and chitinase, and accumulation of reactive oxygen species as well as phenylalanine ammonia-lyase [22,23,24,25]. Phenylalanine ammonia-lyase (PAL) is the first and one of the key enzymes in the biosynthesis of phenolic compounds. PAL catalyzes the non-oxidative deamination of phenylalanine to trans-cinnamic acid and ammonia. Trans-cinnamic acid, in turn, is a common precursor of lignin, and the biosynthesis pathway of flavonoids, the phenylpropanoid pathway, is one of the most important pathways of plant metabolism and is responsible for the production of many secondary metabolites [26,27,28,29,30]. PAL activity depends on the developmental stage, the degree of differentiation of cells and tissues, and exposure to various stress stimuli. In addition, there are many reports of PAL stimulation by infection, mechanical trauma, UV radiation, drought, and temperature changes, as well as induction with methyl jasmonate or methyl salicylate [31]. Increased PAL activity has been correlated with increased production of phenylpropanoid compounds. These compounds, in turn, play defensive or signaling roles in the plant, including antibacterial activity and the synthesis of signaling compounds such as salicylic acid [31]. PAL occurs in all higher plants as well as in yeasts and fungi [32]. It is usually encoded by a small polygenic family of two to five members [33,34]. Four PAL isoforms have been detected in Arabidopsis thaliana L. [35,36], five in Populus [37], thirteen in Cucumis sativus L. [38] and Cucumis melo L., sixteen in Vitis vinifera L. [39], seven in Medicago sativa L. [40], and six in Medicago truncatula Gaertn [41].
The use of Medicago truncatula as a model organism offers several advantages for studying plant–microbe interactions and the phenylpropanoid pathway. Its short life cycle and ability to form symbiotic relationships with nitrogen-fixing bacteria make it a valuable tool for understanding the complex interactions between plants and microbes [42,43]. Additionally, the Medicago truncatula genome has been sequenced and is well annotated, making it a valuable resource for functional genomics and comparative analysis [44].
Understanding the interactions between plants and microbes is therefore crucial for improving plant health and disease resistance, as well as for developing sustainable agricultural practices. By studying the specific mechanisms of plant–microbial interactions, scientists can identify potential intervention targets and develop new strategies to improve yields and reduce the use of synthetic fertilizers and pesticides [45].
The study was aimed at examining the effect of inoculation with free-living and symbiotic rhizobacteria on the biosynthesis of phenolic compounds in Medicago truncatula plants, with particular emphasis on the expression of genes encoding PAL, PAL enzyme activity, and the total content of phenolic compounds in leaves and roots. It was hypothesized that inoculation with different strains of rhizobacteria would affect the pathway of biosynthesis of phenolic compounds, starting from the expression of key genes in this pathway, through enzymatic activity, up to the total content of phenolic compounds. Although there is knowledge about the response of the phenylpropanoid pathway in the context of biotic and abiotic stress, there is still limited knowledge about the mechanisms involved in the interaction between plants and rhizobacteria, in particular regarding the comprehensive approach to this interaction at the molecular and biochemical level. The present study aimed to fill this knowledge gap and provide insight into the potential impact of free-living and symbiotic rhizobacteria on the phenylpropanoid pathway.

2. Results

2.1. Effect of Rhizobacteria on the Expression of Phenylalanine Ammonia-Lyase (PAL) Genes

The genes encoding phenylalanine ammonia-lyase from M. truncatula were shown to be similar to genes encoding this enzyme in other plants. It should be noted that the description of the affiliation of individual PALs to the appropriate classes requires unification. The M. truncatula amino acid sequences for PAL1 and PAL6 were similar and belonged to one clade. PAL 2 was in the next clade, and PAL3 and PAL4 were in the last one (Figure 1).
In the roots and leaves of both inoculated and non-inoculated plants, expression of all five MtPAL genes was found, with the expression of MtPAL3 and MtPAL4 genes becoming visible a little later. In non-inoculated seedlings of M. truncatula, higher expressions of MtPAL1, MtPAL2, MtPAL3, and MtPAL4 genes were observed in the roots, while the MtPAL6 gene was expressed at a similar level in leaves and roots (Figure S1). The expression of all tested MtPAL genes in the leaves of 5-week-old M. truncatula seedlings changed after inoculation with bacteria. The increase in expression of these genes was especially evident after 72 h (Figure S1). Also, in the roots of inoculated seedlings, changes in the expression of genes encoding phenylalanine ammonia-lyase were observed, often visible after 24 h (Figure S1). At the same time, it was observed that the expression of the two genes, MtPAL1 and MtPAL6, is constantly at a fairly high level, which may indicate that these genes are leading in the biosynthesis of phenolic compounds. Although they also reacted to inoculation with bacteria, it was to a small extent. Out of five genes for quantitative qPCR analysis, MtPAL2, MtPAL3, and MtPAL4 were selected due to the observed change in their expression profile in leaves and roots of M. truncatula seedlings inoculated with bacteria in relation to untreated plants. They can be markers of induced systemic resistance.
The results obtained with the qPCR method confirmed those previously obtained with the semi-quantitative PCR method and indicated that the expression level of MtPAL2, MtPAL4, and MtPAL3 genes in the roots of non-inoculated plants is higher than in the leaves (Figure 2A, Figure 3A and Figure 4A), which was also confirmed by hierarchical cluster analysis (Figure 5). The level of MtPAL2 gene expression in the roots at T0 and T24 was about 4 times higher, and after 168 h, about 1.7 times higher than in leaves (Figure 2A). Inoculation of seedlings with the bacterial suspension had no effect on the level of MtPAL2 expression in leaves after 24 h (Figure 2B), while after 72 h, a 1.5-fold increase in the level of gene expression was observed under the influence of Pseudomonas brassicacearum KK5 (Figure 2B). In the roots, 24 h after inoculation of the seedlings with a suspension of two strains of P. brassicacearum KK5 and Sinorhizobium meliloti KK13, a significant decrease in MtPAL2 gene expression was observed or, as in the case of inoculation with other strains, no effect. However, 72 h after inoculation of P. brassicacearum KK5 and P. corrugata KK7, the amount of MtPAL2 gene transcript in the roots increased almost 8-fold and 1.8-fold, respectively (Figure 2C). Another PAL3 gene showed strong root specificity because its expression level in the root at times T0, T24, T72, and T168 was higher than that in the leaf by 12, 340, 74, and 238 times, respectively, while in the leaves, it showed a constant low level (Figure 3A). On the other hand, inoculation of seedlings with a suspension of Pseudomonas bacteria i.e., P. corrugata KK7 and P. brassicacearum KK5, and the symbiotic strain Sinorhizobium meliloti KK13 resulted in a significant increase in the expression of the MtPAL3 gene in the leaves. The P. corrugata KK7 strain caused a very large increase in the expression of this gene after 24 h and 72 h, by 71- and 17-fold, respectively, and the inoculation of P. brassicacearum KK5 and Sinorhizobium meliloti KK13 resulted in an increase in expression, respectively, by 38- and 32-fold after 72 h (Figure 3B). In the roots, a decrease in MtPAL3 gene expression was observed 24 h after inoculation of P. brassicacearum KK5, P. corrugata KK7, and S. meliloti KK13, followed by an increase 72 h after inoculation of P. brassicacearum KK5 (58 times) and P. corrugata KK7 (6.7 times)—Figure 3C.
The MtPAL4 gene, like MtPAL2, showed a higher level of expression in the roots. The expression level of MtPAL4 in the roots at T0, T24, and T72 was 6-, 23-, and 4-fold higher, respectively, than in leaves. As in the case of the MtPAL2 gene, the expression of MtPAL4 in the leaves increased steadily and reached a 2.8-fold increase in 6-week-old plants (168 h) compared to leaves from 5-week-old plants (Figure 4A). In leaves 24 h after inoculation of Pseudomonas corrugata KK7, P. brassicacearum KK5, and Sinorhizobium meliloti KK13, the expression level increased 5.7-, 4.7-, and 4-fold (Figure 4B). In the roots, the amount of transcript of this gene 24 h after inoculation of P. brassicacearum KK5 and S. meliloti KK13 decreased by about 0.3 times, and after 72 h after inoculation of P. brassicacearum KK5 and P. corrugata KK7 seedlings, it increased 21 and 3 times, respectively (Figure 4C).
The results of the conducted experiments indicate that the inoculation of M. truncatula seedlings with suspensions of selected bacteria caused changes, increases or decreases, in the expression of the three analyzed MtPAL genes both in leaves and roots. Of the four strains used for the analysis, i.e., Paenibacillus borealis KK4, Pseudomonas brassicacearum KK5, Pseudomonas corrugata KK7, and Sinorhizobium meliloti KK13, only P. borealis KK4 had little effect on the expression of the MtPAL2, MtPAL3, and MtPAL4 genes in both the roots and leaves of M. truncatula. The remaining three strains were able to induce very high expressions of genes, especially MtPAL3 (Figure 5), which may indicate a systemic response to the inoculation of M. truncatula seedlings with these bacteria. It seems that the MtPAL3 gene may be an indicator for the analysis of interactions between rhizobacteria and M. truncatula.

2.2. Effect of Rhizobacteria on Phenylalanine Ammonia-Lyase Activity

Phenylalanine ammonia-lyase (PAL) is one of the first enzymes in the pathway of biosynthesis of phenolic compounds. It converts phenylalanine to cinnamic acid and is one of the markers of plant systemic resistance. The activity of this enzyme was checked in the leaves and roots of 5-week-old M. truncatula seedlings just before and 24, 72, and 168 h after inoculation with rhizobacteria (Figure 6). The activity of the PAL enzyme was approximately 5-fold higher in the leaves compared to the roots, and in addition, the activity in the leaves, which resulted from the systemic response after inoculation of the roots with rhizobacteria, was very stable. A 2-fold increase in the activity of this enzyme was observed in the leaves of non-inoculated plants that were 38 days old (72 h), which was maintained for the next 4 days (168 h)—Figure 6A. In the roots of non-inoculated 38-day-old plants, an increase in the activity of this enzyme was observed by 47%, and in the 6-week-old plants, it decreased by 25% (Figure 6A,B).
Changes in the activity of this enzyme in leaves and roots after treatment with rhizobacteria were visible (Figure 6). Slight changes were observed in the leaves 24 h after inoculation, with three strains inducing PAL activity: most effectively Sinorhizobium meliloti KK13—27%; then Pseudomonas corrugata KK7—7.1%; and Paenibacillus borealis KK4—5.2%. Three days after inoculation, only one strain, P. brassicacearum KK5, slightly increased PAL activity by 7%, while the others decreased it by 39 to 55%, and after another 4 days, most of the strains significantly decreased enzyme activity (from 35 to 39%). It should be noted, however, that taking into account the dynamics of changes, the activity of the PAL enzyme in the leaves of plants treated with three strains (KK4, KK7, and KK13) remained at a similar level, while inoculation with P. brassicacearum KK5 increased the activity between days 1 and 3 by 145% and reached a level close to the control (Figure 6A and Figure 7).
In roots, PAL activity increased 24 h after inoculation with P. corrugata KK7 and S. meliloti KK13, by 9.4 and 7.3%, respectively. After 72 h, the P. brassicacearum KK5 strain induced resistance by 28.4%, while P. corrugata KK7 inhibited PAL activity by 31.3%. Inoculation with all strains increased PAL enzyme activity in roots 168 h after inoculation. In particular, P. corrugata KK7 increased activity by 162%, followed by S. meliloti KK13 by 93%, P. borealis KK4 by 88%, and P. brassicacearum KK5 by 72% (Figure 6B). The effect of these strains on PAL activity in the roots was also confirmed by hierarchical cluster analysis (Figure 7).

2.3. Effect on the Content of Phenolic Compounds

Five-week-old leaves of M. truncatula control seedlings contained four times more phenolic compounds than the roots of these seedlings (Figure 8 and Figure 9), which was therefore consistent with the previously described PAL activity.
After inoculation with bacteria, changes in the total content of phenolic compounds were observed in the leaves and roots of the seedlings compared to the control (Figure 8). In the leaves 24 h after the inoculation of Pseudomonas corrugata KK7, P. brassicacearum KK5, and Sinorhizobium meliloti KK13, an increase in the content of phenolic compounds by 378, 157, and 88% was observed, respectively. After 72 h, an increase in the content of phenols was visible after treatment with the suspension of P. corrugata KK7 by 93% and S. meliloti KK13 by 99%. The increase in the content of these compounds in the leaves by 38% was also caused by the inoculation of Paenibacillus borealis KK4 after 168 h, while the inoculation of Pseudomonas corrugata KK7 reduced the content of phenolic compounds in the leaves (Figure 8A). Inoculation of seedlings with a suspension of P. brassicacearum KK5 and P. corrugata KK7 resulted in an increase in the content of phenols after 24 h by 130 and 390%, respectively, and Paenibacillus borealis KK4 increased after 72 and 168 h by 267 and 49%, respectively (Figure 8B).

3. Discussion

Phenolic compounds play a key role in plant interactions with the environment, including microorganisms. Due to their high biological activity and the ability to be secreted from root tissues into the environment, they are the first line of defense against pathogens. The first enzyme in the biosynthesis of the phenylpropanoid pathway is phenylalanine ammonia-lyase—PAL [34]. The products of this pathway are soluble phenols, flavonoids, and lignins, which are key factors in plant disease resistance [41]. PAL is also a key enzyme in the biosynthesis of salicylic acid (SA), which is responsible for triggering systemic acquired immunity (SAR) in plants [46]. PAL gene expression in plants can be increased by various environmental factors including pathogen infection, insect bites, UV radiation, and extreme temperatures [26,47]. In addition, it is believed that the production of phenolic compounds and the activity of phenylalanine ammonia-lyase (PAL) can serve as markers for the induction of systemic immunity [26,31,48,49].
Therefore, it was analyzed whether the expression of genes encoding PAL, the activity of this enzyme, and the content of its products, i.e., phenols, change after 1, 3, and 7 days after inoculation with selected strains of rhizobacteria in the roots and leaves of 5-week-old M. truncatula seedlings. The influence of free-living and symbiotic rhizobacteria on the biosynthesis pathway of phenolic compounds of M. truncatula plants at the molecular and biochemical levels was confirmed [41,46,48].
In the genome of Medicago truncatula, six genes encoding phenylalanine ammonia-lyase were found [41], which is two more than in Arabidopsis thaliana—four PAL genes [47]—and three less than in Oryza sativa—nine PAL genes [50]. The similarity of five genes from M. truncatula to homologous genes from other plants of the Fabaceae family was also confirmed (Figure 1) such as Trifolium pratense, Cicer arietinum, and Glycine max. It was observed that the MtPAL1, MtPAL2, MtPAL3, and MtPAL4 genes show higher expressions in the roots, while the MtPAL6 gene expression was at a similar level in the leaves and roots of 35–42-day-old M. truncatula J5 seedlings (Figure S1, Figure 2 and Figure 4). In turn, Ren et al. (2019) [41] tested M. truncatula A17 seedlings during flowering using a microarray and they found that the roots had a higher expression of MtPAL2, MtPAL1, and MtPAL6 genes in the leaves, and the expression of MtPAL4 was visible at a similar level in these organs. However, it should be remembered that a different line of M. truncatula at a different age was analyzed for the presented study. The response of PAL genes to drought stress and salinity in M. truncatula was demonstrated. Their role in response to environmental stress has also been proven in Arabidopsis. In addition, the knockout of four genes encoding PAL resulted in susceptibility to Pseudomonas syringae [47]. Similarly, the PAL genes from Medicago sativa have been shown to respond to salinity [40]. The other studies have demonstrated the induction of PAL genes by pathogens [27,51,52,53]. However, there are not many reports on the induction of PAL genes in plants after inoculation with rhizobacteria. All five MtPAL genes tested in M. truncatula were upregulated after inoculation with rhizobacteria, although the increase in expression of three (MtPAL2, MtPAL3, and MtPAL4) was particularly noticeable. The other two genes (MtPAL1 and MtPAL6) were characterized by a relatively constant, high level of expression in the observed time interval between 35 and 42 days of plant development and were slightly affected by bacterial inoculation (Figure S1). Therefore, it can be considered that these are the lead genes responsible for maintaining the production of phenolic compounds in M. truncatula. A significant effect of inoculation of seedlings with rhizobacteria on the increase in expression of MtPAL2, MtPAL3, and MtPAL4 genes in roots was confirmed, especially after treatment of seedlings with strains belonging to Pseudomonas (P. brassicacearum KK5 and P. corrugata KK7)—Figure 2, Figure 3, Figure 4 and Figure 5. The greatest induction of expression after inoculation with rhizobacteria was observed for the MtPAL3 gene, which also showed strong root specificity; however, induction of expression was also seen in leaves (Figure 4 and Figure 5). The increase in the expression level of this gene in the roots 72 h after inoculation with Pseudomonas brassicacearum KK5 strain was 58-fold (Figure 4). The MtPAL3 gene can therefore be considered the best marker of M. truncatula interaction with free-living rhizobacteria. Previously, one of the rice PAL genes was observed to be differentially expressed in rice roots during association with Azospirillum brasilense [54]. The expression pattern of these flavonoid synthesis genes further suggests that flavonoids likely play a key role in the beneficial associations of rice with bacteria. S. Jain [55] found induction of the pal2 gene from Glycine max (which is in the same clade as MtPAL2Figure 1) after inoculation with Bacillus sp. rhizobacteria. They noted the greatest increase in gene expression after Bacillus sp. and Fusarium oxysporum co-inoculation. In addition, this was higher than pathogen-only inoculation. This may indicate that earlier induction with rhizobacteria increases the response against pathogens and may be related to the induction of resistance in plants. In Lotus japonicus, the PAL gene (LjPAL1) has been shown to be induced by Mesorhizobium loti infection and has been found to influence rhizobium infection progression and nodule structure [56]. The MtPAL1 gene was also tested after inoculation with Sinorhizobium meliloti and a minimal reduction in expression was observed in the roots of Medicago truncatula, which decreased more after pathogen treatment. They concluded that rhizobacteria inhibit the immune response caused by bacterial pathogens [57]. We also did not observe an increase in expression of this gene after inoculation of S. meliloti (Figure S1). These and previous studies indicate the functional diversity of this family of genes.
Increased expression of MtPAL genes (mainly MtPAL3) by some strains, i.e., P. brassicacearum KK5 and P. corrugata KK7, was accompanied by increased activity of PAL enzymes and production of phenols, compounds known to have antifungal activity (Figure 6, Figure 7, Figure 8 and Figure 9). However, it is noteworthy that the enzymatic activity in the leaves is higher than in the root, which does not correlate with the results of expression of the MtPAL2, MtPAL3, and MtPAL4 genes (Figure 2, Figure 3 and Figure 4). This may be related to the high levels of expression of the leading genes MtPAL1 and MtPAL6 (Figure S1) in the leaves observed in the semi-quantitative analysis (expression of these genes was not quantified), as well as post-translational changes. Ali and McNear (2014) [58] showed an increase in the content of flavonoids, as well as a significant activation of genes for the biosynthesis of phenolic compounds (such as chalcone synthase and isomerase, flavonoid hydroxylase, or flavonol synthase) in Arabidopsis thaliana leaves after treatment with Soil-Builders AF microbiological preparation containing rhizobacteria, with no induction of expression for all four PAL genes. Inoculation of rice with thirty isolates of rhizobacteria (most of which belonged to the genus Bacillus, then to Staphylococcus) showed that most of the isolates resulted in an increase in PAL enzyme activity, with 86.6% in shoots and 53.3% in roots [59]. An increase in PAL activity was also observed after wheat inoculation with Stenotrophomonas maltophilia rhizobacteria. The further increase in PAL activity was influenced by the subsequent contact of the plant with the pathogen [60]. However, after inoculation by means of microinjections and spraying of leaves of 4-week-old chickpea seedlings with both Pseudomonas fluorescens and P. aeruginosa strains, an increase in PAL activity was noted after 1, 2, and 3 days after the treatment, with the largest approx. increase for the control observed after the first day, and the maximum activity of the PAL enzyme observed after 2 days [61]. Subsequently, in studies conducted on chickpeas, a higher collection of phenolics was observed 1 to 3 days after treatment of four-week-old seedlings with PGPR strains (especially in the presence of the pathogen—Sclerotinia sclerotinum), which was attributed to the activation of the ISR mechanism by bacterial strains [61]. An increase in the content of phenolic acids and the total content of phenols was also noted by Bahadur et al. (2007) [62] 48 and 96 h after inoculation of pea leaves with strains belonging to Pseudomonas fluorescens or Pseudomonas aeruginosa. The same strains used to inoculate chickpea seeds caused an increase in the content of phenolic compounds in 4-week-old leaves of seedlings, and this increase was especially significant when both strains were used together. In addition, the authors found a correlation between the accumulation of phenols and the protection of chickpeas against infection by the fungus Sclerotinum ralstoni [63]. There was also an accumulation in the roots in the first week after inoculation of salicylic acid, a key phenolic compound playing an important role in signaling during immunity induction, with a complete lack of this acid in the rest of the plant. These authors believed that the salicylic acid accumulated in the roots is of bacterial origin [63]. An increase in PAL activity and phenol content was also observed in pea and chickpea leaves after infection with the pathogen Sclerotina sclerotinum after prior inoculation with a mixture of microorganisms (microbial consortium) consisting of bacteria belonging to the genus Pseudomonas and Bacillus and the fungus Trichoderma harzianum [64,65]. An increase in the activity of the PAL enzyme and the content of phenolic compounds was also observed in rice after inoculation with Pseudomonas fluorescens [66]. A similar relationship, i.e., a four-fold increase in the total content of phenolic compounds, was observed in leaves and roots 24 h after inoculation of M. truncatula seedlings with the Pseudomonas corrugata KK7 strain (Figure 8). Plant growth-promoting rhizobacteria are known to increase resistance to abiotic and biotic stress, including by activating the phenylpropanoid pathway. This can lead to the emergence of plant resistance and the control of plant diseases. However, before rhizobacteria can be used to improve crop yields, it is essential to understand the mechanisms behind plant–microbe interactions. The study shows the potential of rhizobacteria to stimulate the phenylpropanoid pathway. The next step to complete the study would be to see if rhizobacteria also trigger a response in the expression of the MtPAL5 gene, which has not been studied, and other genes and enzymes in this pathway, such as chalcone synthase and chalcone isomerase. It would also be worth analyzing changes in the path under study after contact with the pathogen.

4. Materials and Methods

4.1. Plant Culture and Inoculation

Medicago truncatula Gaertn. ecotype Jemalong 5 was used in the research (French National Institute for Agricultural Research—INRAE, Paris, France). After chemical scarification and stratification at 4 °C, the seeds were transferred to pots containing a mixture of perlite and sand in a 1:1 ratio (v/v). Medicago seedlings were watered with a low-nitrogen medium containing NPK-18:6:26 mineral compounds. The plants were grown at a light intensity of 150 μmoL·m−1·s−1, a photoperiod of 16 h/8 h, and a temperature of 24 °C/20 °C [67].
Pseudomonas rhizobacterial strains (P. brassicacearum KK5 and P. corrugata KK7), Paenibacillus borealis KK4, and the symbiotic strain Sinorhizobium meliloti KK13 were used. Bacterial cultures were grown in a Tryptic Soya Broth medium (Scharlau, Barcelona, Spain) until OD600 was about 0.6. The cultures were then centrifuged (4 °C/5000 rpm/20 min). The supernatant was carefully removed, and the bacterial cell pellet was resuspended in the same volume of 10 mM magnesium sulfate solution. The procedure was repeated twice. The bacterial suspension prepared in this way was diluted with 10 mM magnesium sulfate solution to a density of 108 CFU mL −1 (0.1 optical density) and was used for inoculating 5-week-old seedlings of Medicago truncatula J5. For this purpose, 10 mL of freshly prepared bacterial inoculum was pipetted near the root system on the substrate at a distance of 1 cm from the shoot. Control seedlings were treated with a 10 mM magnesium sulfate solution. Material for analysis was collected just before inoculation (T0), 24 h after inoculation (T24), 72 h after inoculation (T72), and 168 h after inoculation (T168).

4.2. Determination of Total Phenolic Compounds

The content of phenolic compounds was determined by the Folin–Ciocalteau method using a UV-1800 spectrophotometer (Shimadzu, Duisburg, Germany). Briefly, 0.1 g of leaf and root tissue was homogenized in 1 mL of 80% (v/v) ethanol. The reaction mixture was prepared with 0.5 mL of supernatant, 0.08 mL of 20% (w/v) NaCO3 in water, and 0.24 mL of Folin–Ciocalteau reagent. After 60 min, the absorbance was measured at 760 nm. The total phenol content was calculated from the calibration curve prepared for chlorogenic acid, and the content of phenolic compounds was expressed as mmoL of chlorogenic acid/g of fresh weight.

4.3. Analysis of Phenylalanine Ammonia-Lyase (PAL) Activity

PAL activity was determined by a spectrophotometric method [68], based on the transformation of phenylalanine into trans-cinnamic acid at 290 nm. In total, 200 mg of leaf or root tissue was homogenized in liquid nitrogen, then added to 2 mL of extraction buffer containing 50 mM Tris-HCl pH 8.8 and 15 mM β-mercaptoethanol (Scharlau, Spain), and centrifuged for 15 min at 16,000× g at 4 °C. The supernatant was used for enzyme activity assays and protein content determination. The reaction mixture was prepared in a spectrophotometer cuvette with 100 µL of extraction buffer, 50 µL of 10 mM phenylalanine (Scharlau), 30 µL of deionized water, and 20 µL of plant extract, and incubated at 37 °C for 1 h. After that, the reaction was stopped by adding 50 µL of 6 M HCl, and the absorbance was measured at 290 nm. Enzyme activity was calculated from the standard curve in the range of 20–200 nmoL of trans-cinnamic acid and expressed as µmoL of trans-cinnamic acid/mg of protein. Protein content was measured using the Bradford method (1976) [69].

4.4. Effect of Bacteria on PAL Gene Expression in M. truncatula

4.4.1. RNA Isolation from Roots/Seedlings and Reverse Transcription

Approximately 200 mg of plant tissue from leaves or roots of M. truncatula seedlings grown in pots or roots of seedlings grown in plates was ground in liquid nitrogen using a mortar and pestle. RNA isolation was carried out using a Direct-zol RNA isolation kit (Zymo Research, Irvine, CA, USA). The isolated RNA was used for further procedures or stored at −80 °C. RNA concentration and purity were assessed by spectrophotometric measurement (BioSpec Nano, Schimadzu, Kyoto, Japan). cDNA synthesis was performed using 500 ng of isolated mRNA and the GoScript Reverse Transcription System (Promega, Madison, WI, USA). The resulting cDNA was stored at −20 °C and used for analysis after 5-fold dilution.

4.4.2. Sequence Alignment and Primer Design for Gene Expression Analysis

The gene sequences available in the J. Craig Venter database (http://www.jcvi.org/medicago, accessed on 20 February 2021) were used for designing primers for the target genes and reference genes. Sequence alignments of PAL proteins from M. truncatula, Arabidopsis thaliana from Tair (The Arabidopsis Information Resource) Database [36], and other Fabaceae species (NCBI Database) were performed using ClustalX2 conducted on MEGA software (Molecular Ewolutionary Genetics Analysis, X version, Masatoshi Nei, Richlandtown, PA, USA). The sequence alignment was used to construct a phylogenetic tree using the Neighbor-Joining method, and bootstrap analysis of 1000 replicates was used to assess the confidence level of monophyletic groups. All sequences used are listed in Table 1. The reference gene was selected based on previous reports of gene expression studies in similar systems of Medicago truncatula. Jasiński et al. (2009) [67] also used actin 2 as a reference gene and examined the effects of microorganisms, symbiotic bacterium Sinorhizobium meliloti, and fungal pathogens, F. culmorum and P. medicaginis on M. truncatula J5 seedlings.
PCR primers for both semi-quantitative and quantitative methods were designed using Primer Express 3.0 software (Applied Biosystems, Carlsbad, CA, USA)—Table 1. Strict primer design conditions were applied. The qPCR primers amplified a fragment of approximately 90 bp within the 400 bp fragment amplified in the semi-quantitative PCR reaction. Additionally, all designed primers had a melting temperature of 58–60 °C.

4.4.3. Semi-Quantitative PCR Analysis of Gene Expression

PCR amplification of fragments of the analyzed genes was performed using the Biometra T Gradient thermocycler. For this purpose, a reaction mixture was prepared containing cDNA and Promega’s GoTaq G2 Hot Start Master Mix. The reaction mixture of 25 µL consisted of 12.5 µL Master Mix (which included 1 U of G2 Hot Start polymerase, 2× reaction buffer pH 8.5, 400 µL of each dNTP, and 4 mM MgCl2), 1 µM of each primer, 1 µL cDNA, and nuclease-free water. The polymerase chain reaction was carried out using a three-step protocol. The initial denaturation was 96 °C/2 min; denaturation 96 °C/15 s, primer annealing 60 °C/15 s, and extension 72 °C/45 s repeated for 30 cycles; and final extension 72 °C/5 min. The obtained PCR products of approximately 400 bp were subjected to electrophoresis on a 1.5% agarose gel with ethidium bromide at 70 V for about 40 min using the Bio-Rad electrophoresis apparatus. Each well was loaded with 12 µL of a mixture consisting of 2 µL of PCR product, 2 µL of 6× concentrated loading buffer, and 8 µL of water. A DNA ladder marker (Mass Ruler DNA Ladders 100 bp, Fermentas, Burlington, ON, Canada) was loaded into one of the wells. For the qPCR analysis, genes were selected that were shown to visibly respond to treatment with rhizobacteria in the PCR reaction. Real-time PCR was performed using a two-step protocol with SYBR GREEN dye. cDNA served as a template for amplification in a StepOnePlus™ Real-Time PCR System (Life Technologies, Carlsbad, CA, USA). The reaction mixture included 1 µ of diluted cDNA, 200 nM of each primer, and 2× Master Mix SYBR, in a final volume of 10 µL. The reaction was carried out according to a standard protocol with initial denaturation at 95 °C for 2 min, followed by cycling at 95 °C for 15 s and 60 °C for 60 s, repeated for 40 cycles. Melting curve analysis was then conducted at 95 °C for 15 s, 60 °C for 60 s, and 60–95 °C with an increase of 0.3 °C per cycle. No nonspecific products were detected, and the efficiency of all reactions was 90–95%. The relative expression for each gene was calculated using the 2−ΔΔCt method [70] and normalized to ACT2. Computer analysis was performed using the GenEX 7.0 Std. software (MultiD Analyses AB, Västra Frölunda, Sweden).

4.5. Statistical Analyses

To investigate the effects of various factors on the response variable, we employed a comprehensive set of analyses, including (1) a one-way analysis of variance (ANOVA) with interaction terms, followed by the post hoc Tukey Honestly Significant Difference test (HSD), and (2) hierarchical clustering analysis (HCA) using Ward’s linkage method and Euclidean distance metric. Additionally, scatterplots were utilized to provide a visual representation of the relationships within our standardized dataset. All statistical analyses were executed using Python version 3.9.7 in PyCharm Professional 2023 (jetbrains.com). The specific libraries used were pandas, seaborn, statsmodels.api, bioinfokit, scikit-learn, scipy.stats, NumPy, and scipy.cluster.hierarchy. The source code and required materials can be found in a publicly accessible repository on GitHub (https://github.com/PTBDBIODATA, accessed on 10 October 2024).

5. Conclusions

The results of these studies provide the first evidence of changes in the biosynthetic pathway of phenolic compounds in model plant Medicago truncatula under the influence of free-living and symbiotic rhizobacteria. Plant growth-promoting rhizobacteria strains Pseudomonas brassicacearum KK5, P. corrugata KK7, and Paenibacillus borealis KK4 and the symbiotic strain Sinorhizobium meliloti KK13 had a stimulating effect on changes in the expression of genes encoding PAL, in particular, MtPAL2, MtPAL3, and MtPAL4, on the activity of phenylalanine ammonia-lyase and on the total content of phenolic compounds. It was also found that the MtPAL3 gene reacted most strongly to inoculation with rhizobacteria; therefore, it can be considered the best gene candidate for assessing interactions between rhizobacteria and M. truncatula. Taking this into account, it seems likely that bacterial strains, in particular, Pseudomonas brassicacearum KK5 and P. corrugata KK7, can be used to induce the biosynthetic pathway of phenolic compounds in the model plant M. truncatula and thus in other legumes. This can result in the induction of resistance in plants and, consequently, improved disease control. The presented results allow us to focus future research on the impact of rhizobacteria on plant resistance by activating the phenylpropanoid biosynthesis pathway, and the role of individual phenolic compounds in disease control.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ijms252312684/s1.

Author Contributions

A.K. conceptualization, methodology, formal analysis, investigation, writing—original draft preparation, supervision; T.M. formal analysis, investigation, writing—original draft preparation, software; A.Ł. writing—review and editing, methodology; K.R. writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was co-financed by the Minister of Science (Poland) under the “Regional Excellence Initiative” Program for 2024-2027 (RID/SP/0045/2024/01).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors have no relevant financial or non-financial interests to disclose.

References

  1. Trivedi, P.; Leach, J.E.; Tringe, S.G.; Sa, T.; Singh, B.K. Plant–Microbiome Interactions: From Community Assembly to Plant Health. Nat. Rev. Microbiol. 2020, 18, 607–621. [Google Scholar] [CrossRef] [PubMed]
  2. Trivedi, P.; Batista, B.D.; Bazany, K.E.; Singh, B.K. Plant–Microbiome Interactions under a Changing World: Responses, Consequences and Perspectives. New Phytol. 2022, 234, 1951–1959. [Google Scholar] [CrossRef] [PubMed]
  3. Agler, M.T.; Ruhe, J.; Kroll, S.; Morhenn, C.; Kim, S.-T.; Weigel, D.; Kemen, E.M. Microbial Hub Taxa Link Host and Abiotic Factors to Plant Microbiome Variation. PLoS Biol. 2016, 14, e1002352. [Google Scholar] [CrossRef]
  4. Trivedi, P.; Mattupalli, C.; Eversole, K.; Leach, J.E. Enabling Sustainable Agriculture through Understanding and Enhancement of Microbiomes. New Phytol. 2021, 230, 2129–2147. [Google Scholar] [CrossRef]
  5. Naylor, D.; Coleman-Derr, D. Drought Stress and Root-Associated Bacterial Communities. Front. Plant Sci. 2018, 8, 2223. [Google Scholar] [CrossRef]
  6. Berendsen, R.L.; Pieterse, C.M.J.; Bakker, P.A.H.M. The Rhizosphere Microbiome and Plant Health. Trends Plant Sci. 2012, 17, 478–486. [Google Scholar] [CrossRef]
  7. Whipps, J.M. Microbial Interactions and Biocontrol in the Rhizosphere. J. Exp. Bot. 2001, 52, 487–511. [Google Scholar] [CrossRef] [PubMed]
  8. Zhang, S.; Li, C.; Si, J.; Han, Z.; Chen, D. Action Mechanisms of Effectors in Plant-Pathogen Interaction. Int. J. Mol. Sci. 2022, 23, 6758. [Google Scholar] [CrossRef]
  9. Kloepper, J.W.; Schroth, M.N. Relationship of in Vitro Antibiosis of Plant Growth-Promoting Rhizobacteria to Plant Growth and the Displacement of Root Microflora. Phytopathology 1981, 71, 1020–1024. [Google Scholar] [CrossRef]
  10. Glick, B.R.; Holguin, G.; Patten, C.L.; Penrose, D.M. Biochemical and Genetic Mechanisms Used by Plant Growth Promoting Bacteria; World Scientific: Singapore, 1999; ISBN 1783262133. [Google Scholar]
  11. Bhattacharyya, P.N.; Jha, D.K. Plant Growth-Promoting Rhizobacteria (PGPR): Emergence in Agriculture. World J. Microbiol. Biotechnol. 2012, 28, 1327–1350. [Google Scholar] [CrossRef]
  12. Mendes, R.; Kruijt, M.; De Bruijn, I.; Dekkers, E.; Van Der Voort, M.; Schneider, J.H.M.; Piceno, Y.M.; DeSantis, T.Z.; Andersen, G.L.; Bakker, P.A.H.M. Deciphering the Rhizosphere Microbiome for Disease-Suppressive Bacteria. Science 2011, 332, 1097–1100. [Google Scholar] [CrossRef]
  13. Martínez-Viveros, O.; Jorquera, M.A.; Crowley, D.E.; Gajardo, G.; Mora, M.L. Mechanisms and Practical Considerations Involved in Plant Growth Promotion by Rhizobacteria. J. Soil Sci. Plant Nutr. 2010, 10, 293–319. [Google Scholar] [CrossRef]
  14. Pieterse, C.M.J.; Zamioudis, C.; Berendsen, R.L.; Weller, D.M.; Van Wees, S.C.M.; Bakker, P.A.H.M. Induced Systemic Resistance by Beneficial Microbes. Annu. Rev. Phytopathol. 2014, 52, 347–375. [Google Scholar] [CrossRef]
  15. Shah, A.; Nazari, M.; Antar, M.; Msimbira, L.A.; Naamala, J.; Lyu, D.; Rabileh, M.; Zajonc, J.; Smith, D.L. PGPR in Agriculture: A Sustainable Approach to Increasing Climate Change Resilience. Front. Sustain. Food Syst. 2021, 5, 667546. [Google Scholar] [CrossRef]
  16. Aroca, R.; Ruiz-Lozano, J.M.; Zamarreño, Á.M.; Paz, J.A.; García-Mina, J.M.; Pozo, M.J.; López-Ráez, J.A. Arbuscular Mycorrhizal Symbiosis Influences Strigolactone Production under Salinity and Alleviates Salt Stress in Lettuce Plants. J. Plant Physiol. 2013, 170, 47–55. [Google Scholar] [CrossRef]
  17. Choudhary, D.K.; Prakash, A.; Johri, B.N. Induced Systemic Resistance (ISR) in Plants: Mechanism of Action. Indian J. Microbiol. 2007, 47, 289–297. [Google Scholar] [CrossRef] [PubMed]
  18. Bakker, P.A.H.M.; Doornbos, R.F.; Zamioudis, C.; Berendsen, R.L.; Pieterse, C.M.J. Induced Systemic Resistance and the Rhizosphere Microbiome. Plant Pathol. J. 2013, 29, 136–143. [Google Scholar] [CrossRef]
  19. Pieterse, C.M.J.; Van der Does, D.; Zamioudis, C.; Leon-Reyes, A.; Van Wees, S.C.M. Hormonal Modulation of Plant Immunity. Annu. Rev. Cell Dev. Biol. 2012, 28, 489–521. [Google Scholar] [CrossRef]
  20. Van Loon, L.C.; Bakker, P.A.H.M.; Pieterse, C.M.J. Systemic resistance induced by rhizosphere bacteria. Annu. Rev. Phytopathol. 1998, 36, 453–483. [Google Scholar] [CrossRef]
  21. Yu, Y.; Gui, Y.; Li, Z.; Jiang, C.; Guo, J.; Niu, D. Induced Systemic Resistance for Improving Plant Immunity by Beneficial Microbes. Plants 2022, 11, 386. [Google Scholar] [CrossRef]
  22. Daroodi, Z.; Taheri, P.; Tarighi, S. Direct Antagonistic Activity and Tomato Resistance Induction of the Endophytic Fungus Acrophialophora Jodhpurensis against Rhizoctonia Solani. Biol. Control 2021, 160, 104696. [Google Scholar] [CrossRef]
  23. Guo, Q.; Li, Y.; Lou, Y.; Shi, M.; Jiang, Y.; Zhou, J.; Sun, Y.; Xue, Q.; Lai, H. Bacillus Amyloliquefaciens Ba13 Induces Plant Systemic Resistance and Improves Rhizosphere Microecology against Tomato Yellow Leaf Curl Virus Disease. Appl. Soil Ecol. 2019, 137, 154–166. [Google Scholar] [CrossRef]
  24. Wang, M.; Xue, J.; Ma, J.; Feng, X.; Ying, H.; Xu, H. Streptomyces Lydicus M01 Regulates Soil Microbial Community and Alleviates Foliar Disease Caused by Alternaria Alternata on Cucumbers. Front. Microbiol. 2020, 11, 942. [Google Scholar] [CrossRef]
  25. Chakraborty, U.; Chakraborty, B.; Basnet, M. Plant Growth Promotion and Induction of Resistance in Camellia Sinensis by Bacillus Megaterium. J. Basic Microbiol. 2006, 46, 186–195. [Google Scholar] [CrossRef]
  26. Dixon, R.A.; Paiva, N.L. Stress-Induced Phenylpropanoid Metabolism. Plant Cell 1995, 7, 1085. [Google Scholar] [CrossRef]
  27. Vogt, T. Phenylpropanoid Biosynthesis. Mol. Plant 2010, 3, 2–20. [Google Scholar] [CrossRef]
  28. Liu, R.; Xu, S.; Li, J.; Hu, Y.; Lin, Z. Expression Profile of a PAL Gene from Astragalus Membranaceus Var. Mongholicus and Its Crucial Role in Flux into Flavonoid Biosynthesis. Plant Cell Rep. 2006, 25, 705–710. [Google Scholar] [CrossRef]
  29. Singh, K.; Kumar, S.; Rani, A.; Gulati, A.; Ahuja, P.S. Phenylalanine Ammonia-Lyase (PAL) and Cinnamate 4-Hydroxylase (C4H) and Catechins (Flavan-3-Ols) Accumulation in Tea. Funct. Integr. Genom. 2009, 9, 125–134. [Google Scholar] [CrossRef]
  30. Hahlbrock, K.; Scheel, D. Physiology and Molecular Biology of Phenylpropanoid Metabolism. Annu. Rev. Plant Biol. 1989, 40, 347–369. [Google Scholar] [CrossRef]
  31. Gholami, A.; De Geyter, N.; Pollier, J.; Goormachtig, S.; Goossens, A. Natural Product Biosynthesis in Medicago Species. Nat. Prod. Rep. 2014, 31, 356–380. [Google Scholar] [CrossRef]
  32. Schwede, T.F.; Rétey, J.; Schulz, G.E. Crystal Structure of Histidine Ammonia-Lyase Revealing a Novel Polypeptide Modification as the Catalytic Electrophile. Biochemistry 1999, 38, 5355–5361. [Google Scholar] [CrossRef] [PubMed]
  33. Purwar, S.; Sundaram, S.; Sinha, S.; Gupta, A.; Dobriyall, N.; Kumar, A. Expression and in Silico Characterization of Phenylalanine Ammonium Lyase against Karnal Bunt (Tilletia indica) in Wheat (Triticum aestivum). Bioinformation 2013, 9, 1013. [Google Scholar] [CrossRef]
  34. Rawal, H.C.; Singh, N.K.; Sharma, T.R. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants. Int. J. Genom. 2013, 2013, 678969. [Google Scholar] [CrossRef]
  35. Wanner, L.A.; Li, G.; Ware, D.; Somssich, I.E.; Davis, K.R. The Phenylalanine Ammonia-Lyase Gene Family in Arabidopsis Thaliana. Plant Mol. Biol. 1995, 27, 327–338. [Google Scholar] [CrossRef]
  36. Raes, J.; Rohde, A.; Christensen, J.H.; Van de Peer, Y.; Boerjan, W. Genome-Wide Characterization of the Lignification Toolbox in Arabidopsis. Plant Physiol. 2003, 133, 1051–1071. [Google Scholar] [CrossRef] [PubMed]
  37. Tuskan, G.A.; Difazio, S.; Jansson, S.; Bohlmann, J.; Grigoriev, I.; Hellsten, U.; Putnam, N.; Ralph, S.; Rombauts, S.; Salamov, A. The Genome of Black Cottonwood, Populus Trichocarpa (Torr. & Gray). Science 2006, 313, 1596–1604. [Google Scholar] [CrossRef]
  38. Bagal, U.R.; Leebens-Mack, J.H.; Lorenz, W.W.; Dean, J.F.D. The Phenylalanine Ammonia Lyase (PAL) Gene Family Shows a Gymnosperm-Specific Lineage. BMC Genom. 2012, 13, S1. [Google Scholar] [CrossRef] [PubMed]
  39. Dong, C.; Ning, C.A.O.; Zhang, Z.; Shang, Q. Phenylalanine Ammonia-Lyase Gene Families in Cucurbit Species: Structure, Evolution, and Expression. J. Integr. Agric. 2016, 15, 1239–1255. [Google Scholar] [CrossRef]
  40. Feng, Y.; Huang, Q.; Zhang, R.; Li, J.; Luo, K.; Chen, Y. Molecular characterisation of PAL gene family reveals their role in abiotic stress response in lucerne (Medicago sativa). Crop Pasture Sci. 2022, 73, 300–311. [Google Scholar] [CrossRef]
  41. Ren, W.; Wang, Y.; Xu, A.; Zhao, Y. Genome-Wide Identification and Characterization of the Phenylalanine Ammonia-Lyase (PAL) Gene Family in Medicago Truncatula. Legume Res. Int. J. 2019, 42, 461–466. [Google Scholar] [CrossRef]
  42. Handberg, K.; Stougaard, J. Lotus Japonicus, an Autogamous, Diploid Legume Species for Classical and Molecular Genetics. Plant J. 1992, 2, 487–496. [Google Scholar] [CrossRef]
  43. Tadege, M.; Wen, J.; He, J.; Tu, H.; Kwak, Y.; Eschstruth, A.; Cayrel, A.; Endre, G.; Zhao, P.X.; Chabaud, M. Large-scale Insertional Mutagenesis Using the Tnt1 Retrotransposon in the Model Legume Medicago Truncatula. Plant J. 2008, 54, 335–347. [Google Scholar] [CrossRef] [PubMed]
  44. Young, N.D.; Debellé, F.; Oldroyd, G.E.D.; Geurts, R.; Cannon, S.B.; Udvardi, M.K.; Benedito, V.A.; Mayer, K.F.X.; Gouzy, J.; Schoof, H. The Medicago Genome Provides Insight into the Evolution of Rhizobial Symbioses. Nature 2011, 480, 520–524. [Google Scholar] [CrossRef] [PubMed]
  45. Roy, B.A.; Kirchner, J.W. Evolutionary Dynamics of Pathogen Resistance and Tolerance. Evolution 2000, 54, 51–63. [Google Scholar] [CrossRef]
  46. Glazebrook, J. Contrasting Mechanisms of Defense against Biotrophic and Necrotrophic Pathogens. Annu. Rev. Phytopathol. 2005, 43, 205–227. [Google Scholar] [CrossRef]
  47. Huang, J.; Gu, M.; Lai, Z.; Fan, B.; Shi, K.; Zhou, Y.-H.; Yu, J.-Q.; Chen, Z. Functional Analysis of the Arabidopsis PAL Gene Family in Plant Growth, Development, and Response to Environmental Stress. Plant Physiol. 2010, 153, 1526–1538. [Google Scholar] [CrossRef]
  48. Kim, D.S.; Hwang, B.K. An Important Role of the Pepper Phenylalanine Ammonia-Lyase Gene (PAL1) in Salicylic Acid-Dependent Signalling of the Defence Response to Microbial Pathogens. J. Exp. Bot. 2014, 65, 2295–2306. [Google Scholar] [CrossRef]
  49. Monteón-Ojeda, A.; Mora-Aguilera, J.A.; Hernández-Castro, E.; Sandoval-Islas, J.S.; Azuara-Domínguez, A.; Damián-Nava, A. Induction of Systemic Acquired Resistance Associated with the Enzyme Activity of Phenylalanine Ammonia-Lyase, Peroxidase, and Polyphenoloxidase and Its Effect on the Severity of Anthracnose on Nursery Mango Plants. Arch. Phytopathol. Plant Prot. 2022, 55, 1250–1264. [Google Scholar] [CrossRef]
  50. Tonnessen, B.W.; Manosalva, P.; Lang, J.M.; Baraoidan, M.; Bordeos, A.; Mauleon, R.; Oard, J.; Hulbert, S.; Leung, H.; Leach, J.E. Rice Phenylalanine Ammonia-Lyase Gene OsPAL4 Is Associated with Broad Spectrum Disease Resistance. Plant Mol. Biol. 2015, 87, 273–286. [Google Scholar] [CrossRef]
  51. Liu, Y.; Liu, L.; Yang, S.; Zeng, Q.; He, Z.; Liu, Y. Cloning, Characterization and Expression of the Phenylalanine Ammonia-Lyase Gene (PaPAL) from Spruce Picea Asperata. Forests 2019, 10, 613. [Google Scholar] [CrossRef]
  52. Wu, Z.; Gui, S.; Wang, S.; Ding, Y. Molecular Evolution and Functional Characterisation of an Ancient Phenylalanine Ammonia-Lyase Gene (NnPAL1) from Nelumbo Nucifera: Novel Insight into the Evolution of the PAL Family in Angiosperms. BMC Evol. Biol. 2014, 14, 1–14. [Google Scholar] [CrossRef] [PubMed]
  53. Shine, M.B.; Yang, J.; El-Habbak, M.; Nagyabhyru, P.; Fu, D.; Navarre, D.; Ghabrial, S.; Kachroo, P.; Kachroo, A. Cooperative Functioning between Phenylalanine Ammonia Lyase and Isochorismate Synthase Activities Contributes to Salicylic Acid Biosynthesis in Soybean. New Phytol. 2016, 212, 627–636. [Google Scholar] [CrossRef] [PubMed]
  54. Thomas, J.; Kim, H.R.; Rahmatallah, Y.; Wiggins, G.; Yang, Q.; Singh, R.; Glazko, G.; Mukherjee, A. RNA-Seq Reveals Differentially Expressed Genes in Rice (Oryza sativa) Roots during Interactions with Plant-Growth Promoting Bacteria, Azospirillum Brasilense. PLoS ONE 2019, 14, e0217309. [Google Scholar] [CrossRef] [PubMed]
  55. Jain, S.; Vaishnav, A.; Varma, A.; Choudhary, D.K. Comparative Expression Analysis of Defence-Related Genes in Bacillus-treated Glycine max upon challenge inoculation with selective fungal phytopathogens. Curr. Sci. 2018, 115, 1950. [Google Scholar] [CrossRef]
  56. Chen, Y.; Li, F.; Tian, L.; Huang, M.; Deng, R.; Li, X.; Chen, W.; Wu, P.; Li, M.; Jiang, H. The Phenylalanine Ammonia Lyase Gene LjPAL1 Is Involved in Plant Defense Responses to Pathogens and Plays Diverse Roles in Lotus Japonicus-Rhizobium Symbioses. Mol. Plant-Microbe Interact. 2017, 30, 739–753. [Google Scholar] [CrossRef]
  57. Chen, T.; Duan, L.; Zhou, B.; Yu, H.; Zhu, H.; Cao, Y.; Zhang, Z. Interplay of Pathogen-Induced Defense Responses and Symbiotic Establishment in Medicago Truncatula. Front. Microbiol. 2017, 8, 973. [Google Scholar] [CrossRef]
  58. Ali, M.B.; McNear, D.H. Induced Transcriptional Profiling of Phenylpropanoid Pathway Genes Increased Flavonoid and Lignin Content in Arabidopsisleaves in Response to Microbial Products. BMC Plant Biol. 2014, 14, 1–14. [Google Scholar] [CrossRef]
  59. Bhattacharyya, C.; Banerjee, S.; Acharya, U.; Mitra, A.; Mallick, I.; Haldar, A.; Haldar, S.; Ghosh, A.; Ghosh, A. Evaluation of Plant Growth Promotion Properties and Induction of Antioxidative Defense Mechanism by Tea Rhizobacteria of Darjeeling, India. Sci. Rep. 2020, 10, 15536. [Google Scholar] [CrossRef]
  60. Singh, R.P.; Jha, P.N. The PGPR Stenotrophomonas Maltophilia SBP-9 Augments Resistance against Biotic and Abiotic Stress in Wheat Plants. Front. Microbiol. 2017, 8. [Google Scholar] [CrossRef]
  61. Basha, S.A.; Sarma, B.K.; Singh, D.P.; Annapurna, K.; Singh, U.P. Differential Methods of Inoculation of Plant Growth-Promoting Rhizobacteria Induce Synthesis of Phenylalanine Ammonia-Lyase and Phenolic Compounds Differentially in Chickpca. Folia Microbiol. 2006, 51, 463–468. [Google Scholar] [CrossRef]
  62. Bahadur, A.; Singh, U.P.; Sarnia, B.K.; Singh, D.P.; Singh, K.P.; Singh, A. Foliar Application of Plant Growth-Promoting Rhizobacteria Increases Antifungal Compounds in Pea (Pisum sativum) against Erysiphe Pisi. Mycobiology 2007, 35, 129–134. [Google Scholar] [CrossRef] [PubMed]
  63. Singh, U.P.; Sarma, B.K.; Singh, D.P. Effect of Plant Growth-Promoting Rhizobacteria and Culture Filtrate of Sclerotium Rolfsii on Phenolic and Salicylic Acid Contents in Chickpea (Cicer arietinum). Curr. Microbiol. 2003, 46, 131–140. [Google Scholar] [CrossRef] [PubMed]
  64. Jain, A.; Singh, S.; Kumar Sarma, B.; Bahadur Singh, H. Microbial Consortium–Mediated Reprogramming of Defence Network in Pea to Enhance Tolerance against Sclerotinia Sclerotiorum. J. Appl. Microbiol. 2012, 112, 537–550. [Google Scholar] [CrossRef] [PubMed]
  65. Singh, A.; Sarma, B.K.; Upadhyay, R.S.; Singh, H.B. Compatible Rhizosphere Microbes Mediated Alleviation of Biotic Stress in Chickpea through Enhanced Antioxidant and Phenylpropanoid Activities. Microbiol. Res. 2013, 168, 33–40. [Google Scholar] [CrossRef]
  66. Meena, B.; Radhajeyalakshmi, R.; Vidhyasekaran, P.; Velazhahan, R. Effect of Foliar Application of Pseudomonas Fluoresencens on Activities of Phenylalanine Ammonia-Lyase, Chitinase and β-1,3–Glucanase and Accumulation of Phenolics in Rice. Acta Phytopathol. Entomol. Hung. 2000, 34, 307–315. [Google Scholar] [CrossRef]
  67. Jasinski, M.; Banasiak, J.; Radom, M.; Kalitkiewicz, A.; Figlerowicz, M. Full-Size ABC Transporters from the ABCG Subfamily in Medicago Truncatula. Mol. Plant-Microbe Interact. 2009, 22, 921–931. [Google Scholar] [CrossRef]
  68. Edwards, R.; Kessmann, H. Isoflavonoid Phytoalexins and Their Biosynthetic Enzymes. Mol. Plant Pathol. 1992, 2, 45–62. [Google Scholar] [CrossRef]
  69. Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  70. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Figure 1. Phylogenetic analysis annotated PALs in Medicago truncatula, Arabidopsis thaliana, and other species of plants belonging to the Fabaceae family, created on the basis of amino acid sequences using the Neighbor-Joining method.
Figure 1. Phylogenetic analysis annotated PALs in Medicago truncatula, Arabidopsis thaliana, and other species of plants belonging to the Fabaceae family, created on the basis of amino acid sequences using the Neighbor-Joining method.
Ijms 25 12684 g001
Figure 2. MtPAL2 gene expression profile in leaves and roots of non-inoculated M. truncatula seedlings (at time points: T0—seedlings aged 35 days; T24—36 days; T72—38 days; T168—42 days) (A) and the effect of rhizobacteria on the expression of this gene in leaves (B) and roots (C) 24 and 72 h after inoculation of 35-day-old seedlings.
Figure 2. MtPAL2 gene expression profile in leaves and roots of non-inoculated M. truncatula seedlings (at time points: T0—seedlings aged 35 days; T24—36 days; T72—38 days; T168—42 days) (A) and the effect of rhizobacteria on the expression of this gene in leaves (B) and roots (C) 24 and 72 h after inoculation of 35-day-old seedlings.
Ijms 25 12684 g002
Figure 3. MtPAL3 gene expression profile in leaves and roots of non-inoculated M. truncatula seedlings (at time points: T0—seedlings aged 35 days; T24—36 days; T72—38 days; T168—42 days) (A) and the effect of rhizobacteria on the expression of this gene in leaves (B) and roots (C) 24 and 72 h after inoculation of 35-day-old seedlings.
Figure 3. MtPAL3 gene expression profile in leaves and roots of non-inoculated M. truncatula seedlings (at time points: T0—seedlings aged 35 days; T24—36 days; T72—38 days; T168—42 days) (A) and the effect of rhizobacteria on the expression of this gene in leaves (B) and roots (C) 24 and 72 h after inoculation of 35-day-old seedlings.
Ijms 25 12684 g003
Figure 4. MtPAL4 gene expression profile in leaves and roots of non-inoculated M. truncatula seedlings (at time points: T0—seedlings aged 35 days; T24—36 days; T72—38 days; T168—42 days) (A) and the effect of rhizobacteria on the expression of this gene in leaves (B) and roots (C) 24 and 72 h after inoculation of 35-day-old seedlings.
Figure 4. MtPAL4 gene expression profile in leaves and roots of non-inoculated M. truncatula seedlings (at time points: T0—seedlings aged 35 days; T24—36 days; T72—38 days; T168—42 days) (A) and the effect of rhizobacteria on the expression of this gene in leaves (B) and roots (C) 24 and 72 h after inoculation of 35-day-old seedlings.
Ijms 25 12684 g004
Figure 5. Hierarchical cluster analysis showing the effect of rhizobacteria on MtPAL gene expression after M. truncatula inoculation.
Figure 5. Hierarchical cluster analysis showing the effect of rhizobacteria on MtPAL gene expression after M. truncatula inoculation.
Ijms 25 12684 g005
Figure 6. Effect of rhizobacteria on phenylalanine ammonia-lyase (PAL) activity in leaves (A) and roots (B) of 5-week-old seedlings of M. truncatula at 24, 72, and 168 h after inoculation.
Figure 6. Effect of rhizobacteria on phenylalanine ammonia-lyase (PAL) activity in leaves (A) and roots (B) of 5-week-old seedlings of M. truncatula at 24, 72, and 168 h after inoculation.
Ijms 25 12684 g006
Figure 7. Hierarchical cluster analysis showing the effect of rhizobacteria on PAL enzyme activity after M. truncatula inoculation.
Figure 7. Hierarchical cluster analysis showing the effect of rhizobacteria on PAL enzyme activity after M. truncatula inoculation.
Ijms 25 12684 g007
Figure 8. Effect of rhizobacteria on the content of phenolic compounds in leaves (A) and roots (B) in 5-week-old M. truncatula seedlings at 24, 72, and 168 h after inoculation.
Figure 8. Effect of rhizobacteria on the content of phenolic compounds in leaves (A) and roots (B) in 5-week-old M. truncatula seedlings at 24, 72, and 168 h after inoculation.
Ijms 25 12684 g008
Figure 9. Hierarchical cluster analysis showing the effect of rhizobacteria on total phenolic content after M. truncatula inoculation.
Figure 9. Hierarchical cluster analysis showing the effect of rhizobacteria on total phenolic content after M. truncatula inoculation.
Ijms 25 12684 g009
Table 1. List of tested (white fields) and reference genes.
Table 1. List of tested (white fields) and reference genes.
Gene NameGene Product NameLocus NumberSequence for PCR Primers (5′ → 3′)Sequence for qPCR Primers (5′ → 3′)
MtPAL 1phenylalanine ammonia-lyase 1Medtr1g064090TACCACTTCGCGGTACAATCAC
TATGCTCCATAATAGCAGCAGCTT
not tested
MtPAL 2phenylalanine ammonia-lyase 2Medtr1g094780GCTTCATTGGTTCTTTTTGATACAA
TTCCTCCATGAAGTGCCTTATCC
CACTTCAGAAGCCCAAACAAGATAG
TGTTGCGTATCGAATCACTTCAA
MtPAL 3phenylalanine ammonia-lyase 3Medtr2g094960ACAAGATTAGCTTTGGCTGCT
GCCACTTGACTCAGTCTTTTCT
GCGATGGCTGCATATTGTTCT
TTATGCTGTTCAGCGCTTTGG
MtPAL 4phenylalanine ammonia-lyase 4Medtr5g098720ACACCAATCTTGCCATTGCG
TCCATAATAGCAGCTGCCTCG
AGCAGGTCTGAGTTCTGGGTTCT
GAAGCCACACCAGATCCAACA
MtPAL 6phenylalanine ammonia-lyase 6Medtr7g101425TACACGTTTGGCTCTCGCAT
TGGCTACTTGACTTACGGTGT
not tested
ACTactin 2Medtr7g026230TATCATAGATGGTTGGAACAGGACC
GGAGACAGCCAGGACCAGC
TCAATGTGCCTGCCATGTATGT
CTCACACCGTCACCAGAATCC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kisiel, A.; Miller, T.; Łobodzińska, A.; Rybak, K. Biosynthesis of Phenolic Compounds of Medicago truncatula After Inoculation with Selected PGPR Strains. Int. J. Mol. Sci. 2024, 25, 12684. https://doi.org/10.3390/ijms252312684

AMA Style

Kisiel A, Miller T, Łobodzińska A, Rybak K. Biosynthesis of Phenolic Compounds of Medicago truncatula After Inoculation with Selected PGPR Strains. International Journal of Molecular Sciences. 2024; 25(23):12684. https://doi.org/10.3390/ijms252312684

Chicago/Turabian Style

Kisiel, Anna, Tymoteusz Miller, Adrianna Łobodzińska, and Kinga Rybak. 2024. "Biosynthesis of Phenolic Compounds of Medicago truncatula After Inoculation with Selected PGPR Strains" International Journal of Molecular Sciences 25, no. 23: 12684. https://doi.org/10.3390/ijms252312684

APA Style

Kisiel, A., Miller, T., Łobodzińska, A., & Rybak, K. (2024). Biosynthesis of Phenolic Compounds of Medicago truncatula After Inoculation with Selected PGPR Strains. International Journal of Molecular Sciences, 25(23), 12684. https://doi.org/10.3390/ijms252312684

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop