Next Article in Journal
Genome-Wide Identification and Expression Analysis of FD Gene Family in Bamboos
Next Article in Special Issue
Hepatic Deletion of Carbohydrate Response Element Binding Protein Impairs Hepatocarcinogenesis in a High-Fat Diet-Induced Mouse Model
Previous Article in Journal
Glycosylation Pattern of Serum Clusterin in Psoriatic Arthritis and Rheumatoid Arthritis—The Search for New Diagnostic Glycomarkers
Previous Article in Special Issue
Knockout of the Carbohydrate Responsive Element Binding Protein Enhances Proliferation and Tumorigenesis in Renal Tubules of Mice
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Chemogenetic Modulation of Preoptic Gabre Neurons Decreases Body Temperature and Heart Rate

1
The Institute of Biomedical and Health Engineering, Shenzhen Institute of Advanced Technology, Chinese Academy of Sciences, Shenzhen-Hong Kong Institute of Brain Science-Shenzhen Fundamental Research Institutions, Shenzhen 518055, China
2
Department of Anatomy and Histoembryology, School of Basic Medical Sciences, Peking University Health Science Center, Beijing 100191, China
3
University of Chinese Academy of Sciences, Beijing 100049, China
4
Department of Pathology and Pathophysiology, Faculty of Basic Medical Sciences, Kunming Medical University, Kunming 650500, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2024, 25(23), 13061; https://doi.org/10.3390/ijms252313061
Submission received: 30 September 2024 / Revised: 7 November 2024 / Accepted: 8 November 2024 / Published: 5 December 2024

Abstract

:
The preoptic area of the hypothalamus is critical for regulation of brain–body interaction, including circuits that control vital signs such as body temperature and heart rate. The preoptic area contains approximately 70 molecularly distinct cell types. The Gabre gene is expressed in a subset of preoptic area cell types. It encodes the GABA receptor ε-subunit, which is thought to confer resistance to anesthetics at the molecular level, but the function of Gabre cells in the brain remains largely unknown. We generated and have extensively characterized a Gabre-cre knock-in mouse line and used chemogenetic tools to interrogate the function of Gabre cells in the preoptic area. Comparison with macaque GABRE expression revealed the conserved character of Gabre cells in the preoptic area. In awake mice, we found that chemogenetic activation of Gabre neurons in the preoptic area reduced body temperature, whereas chemogenetic inhibition had no effect. Furthermore, chemogenetic inhibition of Gabre neurons in the preoptic area decreased the heart rate, whereas chemogenetic activation had no effect under isoflurane anesthesia. These findings suggest an important role of preoptic Gabre neurons in maintaining vital signs such as body temperature and heart rate during wakefulness and under anesthesia.

1. Introduction

The preoptic area, the hypothalamus and selected nuclei of the midbrain and hindbrain harbor neural circuits and cell types that are essential for survival. They regulate the homeostatic interaction of the brain with the internal organs of the body such as the heart, the vascular system, and the reproductive organs [1,2,3,4]. In particular, the preoptic region of the hypothalamus contains a wide range of cell types that control key survival functions such as thermoregulation, thirst, and sleep, as well as social behaviors such as mating, parental behavior, and aggression [5,6,7,8,9]. Indeed, a key goal of neuroscience is to link individual cell types to specific behaviors, with cell types now most commonly defined by comprehensive screens of mRNA expression patterns [10]. Defined in this way, the mouse preoptic region contains 43 types of inhibitory (GABAergic) neurons and 23 types of excitatory (glutamatergic) neurons [11]. However, the function of most of these cell types remains unknown.
The most common way to gain access to specific cell types is to design transgenic mouse lines by introducing stable modifications at a single gene locus. However, many currently used transgenic lines target genes that are broadly expressed in multiple cell types in the preoptic area. Thus, further refinement and design of mouse lines with highly selective expression is critical to examine the role of specific cell types in the preoptic region. By screening gene expression databases for markers expressed in specific nuclei of the preoptic region [12,13], we observed that the Gabre gene shows a distinct expression pattern in the preoptic region. Gabre is one of the 19 genes encoding GABAA receptor subunits. While the α, β, and γ subunits have been extensively studied, relatively little is known about the ε-subunit encoded by the Gabre gene [14]. Interestingly, while most GABAA receptor subunits are widely expressed in multiple brain regions [15,16], Gabre expression appears to be more dynamic and restricted to a limited number of brain nuclei, which may provide clues to understanding the function of Gabre-expressing neurons.
Gabre was originally cloned from human tissues and its presence in the brain and peripheral organs was validated using Northern blots [17,18,19,20]. In addition, Whiting et al. [18] demonstrated strong Gabre expression in the arcuate nucleus of the hypothalamus (Arc) in squirrel monkeys. Subsequent studies in rodents delineated expression in several brain regions including the preoptic area, amygdala, and locus coeruleus [21,22], frequently showing co-expression of the ε-subunit with widely projecting neurotransmitter systems, including histamine, orexin, and noradrenaline [22,23,24], which are intricately involved in the regulation of sleep.
Experiments using heterologous expression systems suggest that the ε-subunit confers a higher rate of desensitization and resistance to anesthetic action, or leads to a higher than typical level of constitutive activity [18,25,26,27,28,29], although not all studies have consistently observed the same effects, possibly due to differences in expression levels and experimental approaches.
Using post hoc identification by RT-PCR, Sergeeva et al. [30] found that spontaneous inhibitory postsynaptic potentials in Gabre-positive hypothalamic cells are resistant to propofol, while Kasparov et al., [31] showed that benzodiazepine insensitivity correlates with Gabre expression in the solitary tract nucleus. In pregnant rats, Gabre mRNA levels are upregulated in brain nuclei critical for respiratory function, suggesting dynamic expression of GABAA receptor ε-subunits upon changes in neurosteroid levels [32]. Finally, recent work with patients has shown that decreased GABRE expression correlates with cognitive impairment in schizophrenia [33], while variants of the GABRE gene are associated with epilepsy [34,35]. In summary, the ε-subunit may confer anesthesia resistance at the molecular level and may play a role in several disease phenotypes, but little is known about the cellular or circuit function of neurons expressing Gabre.
The aim of this study is to contribute to understanding the function of neurons expressing the Gabre gene in the medial preoptic area of the hypothalamus (mPOAGABRE neurons). We generated and validated a Gabre-cre knock-in mouse line and used chemogenetic tools to interrogate the function of mPOAGABRE neurons. We conclude that mPOAGABRE neurons are involved in maintaining the vital signs and provide a novel target for selective manipulation of vital functions in awake animals and during anesthesia.

2. Results

2.1. Targeting Construct and Strategy to Generate Gabre-cre Mice

The genes encoding the ε, α3, and θ subunits of the GABAA receptor are located in tandem on the X chromosome (Figure 1A; [36]). To gain genetic access to cells expressing GABAA receptors containing the ε-subunit, we designed a knock-in strategy targeting the Gabre gene. To identify splice variants, we extracted RNA from tissue of the preoptic area of postnatal day 14 mice. Following RNA isolation, cDNA synthesis, and sequencing, we found six splice variants of the Gabre gene, all located in exon 2 (Figure 1A). Exon 2 encodes repetitive sequences rich in proline and glutamic acid, which are absent in the human Gabre ortholog. To label cells expressing all variants, the ires-cre cassette was inserted 3′ of the stop codon using CRISPR/Cas9 technology. We designed specific genotyping primers to identify the Cre allele (Figure 1B). The mutant and wildtype PCR products were 739 bp and 472 bp long, respectively (Figure 1B).

2.2. Expression Analysis of Gabre-cre Mediated Recombination

To identify the Gabre-cre mediated recombination, we crossed Gabre-cre mice with the Ai14 reporter line to induce tdTomato (tdT) fluorescence in Gabre-cre positive cells. We observed robust expression in subcortical areas (Figure 2). Overall, only very few neurons in the cerebral cortex expressed tdT (Figure 2A–I). In the anterior part of the brain, we detected strong fluorescent signals in the lateral septum (LS) and bed nucleus of the stria terminalis (BST) (Figure 2B,C). At the level of the anterior commissure, we observed recombination in the POA (Figure 2D) and more posteriorly in the subfornical organ (SFO) (Figure 2E). At the level of the tuberal hypothalamus, we detected tdT signals in the paraventricular thalamic nucleus (PV), the periventricular hypothalamic nucleus (PVH), the suprachiasmatic nucleus (SCh) (Figure 2F), the arcuate nucleus (Arc), the dorsomedial hypothalamic nucleus (DMH), and the medial mammillary nucleus (MM) (Figure 2G,H). The pre-Edinger–Wesphal nucleus expressed tdT (Figure 2I) and more posteriorly, the PAG had significant tdT signals ventral to the aqueduct (Figure 2J). We did not observe fluorescence in the cerebellum, but there were strong tdT signals in the locus coeruleus (LC) and Barrington’s nucleus (Bar) (Figure 2K). In the brainstem, the nucleus of the solitary tract (NTS) and the nucleus ambiguus (Amb) also showed strong tdT signals (Figure 2L).
Figure 2. Cre-mediated tdT expression (red) in adult brains of Gabre-cre::Ai14 mice. DAPI (blue) stained 50 μm coronal sections, shown from anterior (A) to posterior (L). Sections were selected to highlight regions with dense tdT expression in specific nuclei. The numbers represent anterior-posterior coordinates relative to bregma. (AL) The most significant tdT signals in anterior sections are in the LS and BST whereas only few cells are found in the cortex. The POA and several hypothalamic nuclei such as the PVH, SCh, Arc, DMH, and MM densely express tdT. In addition, tdT is expressed in the SFO, PV, and PrEW regions. In posterior parts of the brain, we find tdT expression in the PAG, LC, NTS, and Amb. For abbreviations, see Table 1. Dashed boxes indicate regions with magnified images in Figure 3.
Figure 2. Cre-mediated tdT expression (red) in adult brains of Gabre-cre::Ai14 mice. DAPI (blue) stained 50 μm coronal sections, shown from anterior (A) to posterior (L). Sections were selected to highlight regions with dense tdT expression in specific nuclei. The numbers represent anterior-posterior coordinates relative to bregma. (AL) The most significant tdT signals in anterior sections are in the LS and BST whereas only few cells are found in the cortex. The POA and several hypothalamic nuclei such as the PVH, SCh, Arc, DMH, and MM densely express tdT. In addition, tdT is expressed in the SFO, PV, and PrEW regions. In posterior parts of the brain, we find tdT expression in the PAG, LC, NTS, and Amb. For abbreviations, see Table 1. Dashed boxes indicate regions with magnified images in Figure 3.
Ijms 25 13061 g002
To further characterize Gabre-cre mediated recombination, we present several brain areas at higher resolution (Figure 3). We find labeled cells in the ventral part of the lateral septum (LS) and parts of the nucleus accumbens (Figure 3A). We observe tdT-expressing cells in several nuclei of the preoptic area (Figure 3B), including the median preoptic nucleus (MnPO), the periventricular hypothalamic nucleus (Pe) and the medial part of medial preoptic nucleus (MPOM). In addition, there are tdT-labeled fibers in the septohypothalamic nucleus (SHy), the lateral part of the medial preoptic nucleus (MPOL), the medial preoptic area (MPA), the parastrial nucleus (PS), the bed nucleus of the stria terminalis, as well as the ventromedial preoptic nucleus (VMPO). In contrast, the lateral preoptic area (LPO) shows little tdT expression. In the anterior part of the hypothalamus, we find densely labeled cells in the paraventricular hypothalamic nucleus (PVH) and the suprachiasmatic nucleus (SCh), the latter having labeled cells mainly in the shell of the SCh, with the core region devoid of tdT-positive cells (Figure 3C). The central anterior hypothalamic nucleus (AHC) shows only diffuse tdT labeling. We find intense labeling in two small central nuclei, the subfornical organ (SFO) and the pre-Edinger–Westphal nucleus (PrEW) (Figure 3D,E). In more posterior parts of the hypothalamus, the arcuate nucleus (Arc) is rich in tdT-expressing cells, whereas the dorsomedial hypothalamic nucleus (DMH), the medial tuberal nucleus (MTu), and the ventromedial hypothalamic nucleus (VMH) contain fewer tdT-positive neurons (Figure 3F). The periaqueductal gray (PAG) also exhibits tdT expression, mostly within the lateral and ventrolateral parts (Figure 3G). In contrast, the dorsolateral and dorsomedial parts of the PAG have few labeled neurons. The dorsal raphe nucleus (DR) also shows a moderate density of labeled cells. Ventral to the cerebellum, tdT signals are prominent in the locus coeruleus (LC) and Barrington’s nucleus (Bar) (Figure 3H). We visualized LC neurons using tyrosine hydroxylase (TH) antibody staining. Interestingly, we found little overlap between TH (green) and tdT expression in the LC, indicating that Gabre may present a marker of a distinct cell type in the LC.

2.3. Colocalization of Cre with Gabre in Different Brain Regions

To test whether Gabre-cre mediated recombination faithfully mirrored Gabre expression, we compared in situ hybridization (ISH) signals for Gabre and tdT, using the Ai14 reporter line crossed with Gabre-cre mice. We found that Gabre expression and Gabre-cre mediated recombination showed qualitatively similar expression patterns (Figure 4). Comparing the results, tdT signals generally covered the same brain regions as Gabre ISH signals but showed a higher signal-to-noise ratio. The LS displayed strong tdT signals and moderate expression of Gabre (Figure 4A). At the level of the anterior commissure, a large number of neurons showed tdT signals in the SHy, MnPO, medial preoptic nucleus (MPO), and Pe, whereas Gabre signals were weaker but present in these areas (Figure 4B). The PVH and SCh showed intense tdT expression but less Gabre expression (Figure 4C). Both tdT and Gabre were strongly stained in the ME, DMH, and Arc (Figure 4D). More posteriorly, we detected a moderate number of tdT-labeled cells in the PAG, while Gabre showed no expression, indicating transient expression during development (Figure 4E). The LC showed dense tdT signal and weaker staining in the Bar (Figure 4F). Similarly, Gabre showed significant signal in the LC, but almost none in the Bar (Figure 4F). Overall, the expression of Gabre and tdT was broadly comparable, although tdT signals typically showed a more uniform and somewhat broader expression level.
Figure 4. Comparison of Gabre (left) and tdT (right) ISH in Gabre-cre::Ai14 mice. Sections are ordered from anterior (A) to posterior (F) with numbers indicating bregma coordinates. (A) The LS shows strong tdT signals and moderately strong Gabre expression. (B) The POA shows a high density of tdT signals; Gabre signals are moderate in the POA nuclei. (C) We detect strong tdT signals and few Gabre signals in the PV and with more Gabre in the PVH and SCh. (D) Large amounts of tdT labeled cells are detected in the CeA, DM, and Arc; however, Gabre expression is comparatively weaker. (E) We find moderately strong tdT signals in the PAG; however, Gabre shows little expression. (F) The LC shows dense tdT and Gabre expression. For abbreviations, see Table 1. See Table 2 for a semi-quantitative listing of expression levels in different brain regions.
Figure 4. Comparison of Gabre (left) and tdT (right) ISH in Gabre-cre::Ai14 mice. Sections are ordered from anterior (A) to posterior (F) with numbers indicating bregma coordinates. (A) The LS shows strong tdT signals and moderately strong Gabre expression. (B) The POA shows a high density of tdT signals; Gabre signals are moderate in the POA nuclei. (C) We detect strong tdT signals and few Gabre signals in the PV and with more Gabre in the PVH and SCh. (D) Large amounts of tdT labeled cells are detected in the CeA, DM, and Arc; however, Gabre expression is comparatively weaker. (E) We find moderately strong tdT signals in the PAG; however, Gabre shows little expression. (F) The LC shows dense tdT and Gabre expression. For abbreviations, see Table 1. See Table 2 for a semi-quantitative listing of expression levels in different brain regions.
Ijms 25 13061 g004

2.4. GABRE Expression in the Primate Brain

Relatively little is known about GABRE expression in the non-human primate brain [18]. Therefore, we examined GABRE expression in macaque monkey brain sections. We found that GABRE had significant expression in the lateral septum (Figure 5A) and POA (Figure 5B). Interestingly, the SHy and MPOM subregions of the POA showed stronger expression than other nuclei in the POA, similar to the mouse Gabre expression, indicating evolutionary conserved expression patterns.

2.5. Chemogenetic Activation of mPOAGABRE Neurons Decreases Body Temperature

Since the preoptic area is a key regulatory center for the control of temperature homeostasis [37], we wondered whether manipulating the activity of Gabre-positive neurons in the preoptic area (mPOAGABRE neurons) would affect body temperature. To investigate the function of mPOAGABRE neurons, we used bilateral delivery of AAVs encoding cre-dependent designer receptors exclusively activated by designer drugs (DREADD, [38]). We used AAVs encoding hM3D(Gq)-mCherry to activate and hM4D(Gi)-mCherry to inhibit mPOAGABRE activity, and AAVs encoding mCherry as controls (Figure 6A). Clozapine-N-oxide (CNO), the cognate ligand of DREADD, was administered intraperitoneally (i.p.) at a dose of 3 mg/kg. Chemogenetic activation of mPOAGABRE neurons significantly decreased rectal temperature (Figure 6B, Gq group, n = 7, control group, n = 7, 2-way ANOVA, p < 0.0001), while chemogenetic inhibition of mPOAGABRE neurons had no effect on rectal temperature (Figure 6B, Gi group, n = 6, control group, n = 7, 2-way ANOVA, p = 0.717). CNO did not alter the rectal temperature of control animals. Using an infrared camera, we measured body surface temperatures in all groups. Images shown represent 0 and 2 h after injection of saline or CNO. Saline injection had no effect on surface temperature of Gq, Gi, or control group mice (Figure 6C). Two hours after CNO injection, only mice in the Gq group displayed a decrease in body surface temperature, while Gi and control group mice showed no change (Figure 6D). We analyzed the surface temperature of the back, head, and tail regions of the mice and detected a significant decrease of back and head surface temperature in Gq group compared with the control (Figure 6E, back temperature, Gq group, n = 6, control group n = 10, two-way ANOVA, p = 0.0046; head temperature, Gq group, n = 6, control group n = 10, two-way ANOVA, p = 0.0024). In the Gi group, the surface temperatures of both the back and head regions were comparable with the control group (Figure 6E, back temp, Gi group, n = 6, control group n = 10, two-way ANOVA, p = 0.784; head temp, Gi group, n = 6, control group n = 10, two-way ANOVA, p = 0.0513). In contrast to the drop of surface temperatures of the back and head regions, the tail temperatures were significantly higher in the Gq group compared with the control (Figure 6E, Gq group, n = 6, control group n = 10, 2-way ANOVA, p = 0.00357). Consistent with the unaltered core body temperature and surface temperatures of the back and head, the tail temperatures of the Gi group were similar to the control (Gi group, n = 6, control group n = 10, two-way ANOVA, p = 0.3780).
In summary, chemogenetic activation of mPOAGABRE neurons robustly decreased core body temperature, while chemogenetic inhibition of mPOAGABRE neurons did not affect body temperature (Figure 6B). The vasodilation of the tail presumably contributed to the heat loss after chemogenetic activation of mPOAGABRE neurons (Figure 6E).

2.6. Chemogenetic Inhibition of mPOAGABRE Neurons Decreases Heart Rate Under Isoflurane Anesthesia

To reversibly manipulate activity of mPOAGABRE neurons under anesthesia, we bilaterally injected Cre-dependent hM3D (Gq)-mCherry adeno-associated virus or hM4D (Gi)-mCherry adeno-associated virus into the mPOA of Gabre-cre mice. Mice were injected with CNO then anesthetized using an isoflurane gas mask with an oxygen flow at a rate of 200 ml/min under infrared light heating (Figure 7A). ECG was recorded with limb leads (Figure 7A,B). Anesthesia has a wide range of effects on the cardiovascular system but generally depresses cardiovascular function. However, isoflurane anesthesia preserves cardiac function better than other anesthetics [39]. Saline injections did not cause any significant change of heart rate in any experimental group. CNO injection in the hM4D (Gi) group induced a decrease in heart rate (p = 0.0030, 2-way ANOVA) compared with the control group (Figure 7C). However, CNO injection resulted in no significant alterations of heart rate in the hM3D (Gq) group compared with the control group (Figure 7D). In summary, inhibition of mPOAGABRE neurons decreased the heart rate during anesthesia. Thus, our results suggest that manipulation of mPOAGABRE neuron activity influences vital signs under anesthesia.

3. Discussion

We generated a novel mouse line, Gabre-cre, to study the expression and function of Gabre-expressing cells. Using Gabre-cre::Ai14 mice, we characterized the detailed expression pattern of the Gabre gene in the entire mouse brain. Moreover, we report a conserved expression pattern of Gabre mRNA in the preoptic area of both macaque and mouse brains. Chemogenetic activation of mPOAGABRE neurons decreased the body temperature in awake behaving mice. During general anesthesia, chemogenetic inhibition of mPOAGABRE neurons reduced heart rate.
The expression of Gabre has been reported previously based on in situ hybridization and antibody staining [21,22,24]. Because the expression level of Gabre appears to be relatively low, only a few regions in the brain show consistent expression, namely the hypothalamus, locus coeruleus, and VTA [22,23,40,41]. In this study, we resolved the expression pattern of Gabre in the brain using genetic tools. We confirm the expression of Gabre in various hypothalamic nuclei, including the POA. In contrast to previous reports [17,20,42,43], we did not detect significant Gabre expression in the cerebellum, subthalamic nucleus, and cerebral cortex. However, we did not evaluate Gabre expression after repeated anesthesia, as was carried out in some of those studies. Sequeira and colleagues [44] reported GABRE expression in the human hypothalamus, although the exact subregion remains unknown. By studying brain sections of non-human primates, we determined the expression of GABRE in the medial preoptic area. The striking similarity of Gabre expression in mouse and macaque POA indicates a highly conserved regional expression pattern of Gabre and potential conserved function in controlling vital signs.
In mammals, body temperature is normally maintained around 37 °C and serves as an important vital sign, while deviations may indicate pathological conditions. The preoptic area receives and integrates information about body temperature, and manipulation of POA activity can reset body temperature to a different level [37,45]. This mechanism involves direct sensing of temperature in the POA by warm-sensitive neurons, which increase their firing rate upon warming and initiate heat loss mechanisms [46,47]. We found that chemogenetic activation of mPOAGABRE neurons reduced both rectal and surface temperature. Thus, it is plausible that Gabre is expressed by warm-sensitive neurons. However, we previously showed that chemogenetic inhibition of POATRPM2 neurons caused hyperthermia [5], while here, we found that inhibition of mPOAGABRE neurons had no effect. Therefore, we speculate that Gabre may label a subset of Trpm2-expressing neurons and that increases and decreases in body temperature are regulated by different sets of POA neurons.
Although the brain under anesthesia is in general in a hypoactive state, some cells remain active to regulate the vital signs, such as respiration, cardiac activity, and temperature homeostasis [48,49]. Should these cells fail to function properly, complications such as hypothermia, cardiac arrhythmias, and hypoventilation may occur during general anesthesia. General anesthetics primarily target GABAA receptors by binding to specific domains of the receptors [50]. Since GABAA channels containing the ε-subunit cannot be potentiated by anesthetics in vitro, it is tempting to speculate that neurons expressing Gabre are part of a core network for maintaining vital functions during general anesthesia in vivo. The Gabre-containing neurons in the ventral respiratory column (VRC) constitute one example. Repeated exposure to general anesthetics increases Gabre expression in the VRC and renders phrenic nerve activity resistant to anesthesia [43]. During pregnancy, VRC neurons show resistance to general anesthetics compared with virgin and postpartum controls. This phenomenon coincides with the upregulation of Gabre in the VRC in pregnant rats [32]. Collectively, the expression of Gabre is necessary to confer resistance to general anesthetics. Over-expression of Gabre renders neurons insensitive to anesthetics both in vitro and in vivo [27,30,51]. Therefore, the presence of Gabre is also sufficient to confer resistance to general anesthesia.
A recent study [52] has shown that a subset of brainstem nucleus ambiguus neurons express Gabre and that activating these neurons can decrease the heart rate by 50% under isoflurane anesthesia. In addition, accumulating evidence indicates that unconsciousness induced by general anesthetics and sleep share common circuit elements in the preoptic area of the hypothalamus [53,54,55,56]. Activation of a specific group of POA neurons expressing bombesin-like receptor 3 raises both body temperature and heart rate [57], while chemogenetic stimulation of Gabre-expressing neurons in the POA reduces body temperature. This suggests that Brs3 and Gabre potentially label non-overlapping types of neurons. Interestingly, when mPOAGABRE neurons are chemogenetically inhibited during anesthesia, the heart rate of the mice slows down by about 20%. This suggests that baseline activity of the mPOAGABRE neurons is necessary to maintain the heart rate under anesthesia. Inhibition of mPOAGABRE neurons may reduce baseline activity and further decrease the heart rate. Further studies are required to test whether Gabre-expressing neurons in the preoptic area represent a homeostatic control mechanism that maintains the vital signs under anesthesia.
Due to the unavailability of specific antibodies against Gabre, we could not quantify the expression of Gabre at the protein level and correlate it with the abundance of mRNA. Comparing the mammalian orthologs of Gabre, we noticed that an insertion of repetitive sequences encoded by exon 2 is only present in mice and rats. Although we identified alternative transcripts of exon 2, whether this proline-rich sequence is indeed translated remains unknown. A specific antibody would be crucial to verify the protein expression.
It is worth noting that the preoptic area is not a uniform structure. Based on single-cell transcriptomic sequencing, about 70 different cell types can be identified [11]. Whether Gabre-positive cells represent a single or multiple cell types warrants further studies. Possibly due to its low expression level, the Gabre gene was not captured in this dataset [11]. Future single-cell trasncriptomic profiling of Gabre-cre::Ai14 mice may answer this question.
We used both male and female mice in this study but did not monitor the estrous cycle stages of the female mice. Gabre expression changes with the estrous cycle in female mice and is reduced in testicular feminization in male mice [58]. In addition, estrogen receptors, which are dynamically expressed in the preoptic area during the estrous cycle, may contribute to sex differences in response to anesthesia [59]. Whether our current findings can be generalized to female mice of all estrous cycle stages remains to be studied.
In this study, we have focused on the function of Gabre-positive neurons in the POA; however, without direct measurement of mPOAGABRE neuronal activity, the functional interpretation of the results remains preliminary and hypothesis-generating for future studies.
Our data indicate that the Gabre-cre mouse line faithfully recapitulates the expression of the Gabre gene in the brain. Chemogenetic activation of Gabre-positive neurons in the POA reduces body temperature in awake mice, whereas chemogenetic inhibition reduces the heart rate during anesthesia. Hence, we hypothesize that POA Gabre neurons play a key role in maintaining vital signs in awake and anesthetized animals. Further studies are needed to clarify the neural circuit mechanisms for maintaining body temperature and heart rate in awake animals and under general anesthesia.

4. Materials and Methods

4.1. Animals

All experimental procedures were performed according to the institutional guidelines on animal welfare and approved by the local institution in charge of experiments using animals (Animal Care and Use Committee at the Shenzhen Institute of Advanced Technology (SIAT), Chinese Academy of Sciences (CAS), China; permit number SIAT-IRB-171016-NS-WH-A0384). In total, 49 female and male mice were used in this study. C57BL/6J mice were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd (Beijing, China). The Ai14 reporter line was imported from the Jackson Laboratory (Bar Harbor, ME, USA).
Macaque monkey brain sections were collected from a 10-month-old male crab-eating macaque (n = 1, body weight 1 kg; obtained from Guangdong Landau Biotechnology Co., Ltd. (Guangzhou, China), that was sacrificed for an unrelated experiment (Animal Care and Use Committee at the Shenzhen Institute of Advanced Technology (SIAT), Chinese Academy of Sciences (CAS), China; permit number SIAT-IACUC-210326-NS-WH-A1881).

4.2. Generation of Gabre-cre Mice

The Gabre-ires-cre (Gabre-cre) knock-in mouse line was generated by Shanghai Model Organisms Center, Inc. by inserting an ires-cre cassette in the 3′UTR of the Gabre gene locus in order to mimic the endogenous expression of Gabre. The Cas9 mRNA, gRNAs, and donor vectors were microinjected into zygotes of C57BL/6J mice. The sequences of the insertion site, crRNAs, and the complete sequence of the ires-cre cassette are shown in the Supporting Information Tables S1–S3. The founder was confirmed with long-range PCRs. It was backcrossed for more than three generations with wild-type C57BL/6J mice before use in the experiments. All Gabre-cre mice were kept on a C57BL/6J background and heterozygous animals were used for experiments. The genotype of Gabre-cre animals was verified by PCR with the primers shown in Table 3.

4.3. Tissue Preparation

Reagents were bought from Sigma-Aldrich (St. Louis, MO, USA), unless otherwise noted. Brain tissue was prepared as follows. Using pentobarbital, mice were deeply anesthetized. We perfused animals with 1× phosphate buffered saline solution (PBS) and 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB). Subsequently, brains were dissected out and fixed again in PFA overnight. Before sectioning, mouse brains were cryoprotected using an ascending series of 10% and 30% sucrose solution in PB, each step lasting at least 24 h. We used O.C.T. Compound (Tissue-Tek® Sakura Finetechnical Co., Ltd., Tokyo, Japan) for embedding brains and prepared 50 µm-thick floating sections on a freezing microtome.

4.4. In Situ Hybridization

In situ hybridization was performed as described previously [5,60]. The primers used for generating in situ probes are shown in Table 4. DIG-labeled riboprobes were used for hybridization on 50 µm free floating cryosections. Hybridization was performed overnight at 65 °C. Sections were washed at 65 °C twice in 2xSSC/50% formamide/0.1% N-lauroylsarcosine and twice in 2xSSC/0.1% N-lauroylsarcosine at 37 °C for 20 min and twice in 0.2xSSC/0.1% N-lauroylsarcosine at 37 °C for 20 min. Sections were blocked in MABT/10% goat serum/1% blocking reagent (cat# 11096176001, Roche, Basel, Switzerland), incubated overnight with sheep anti-DIG-AP (1:1000, cat# 11093274910, Roche, Basel, Switzerland). After washing, staining was performed using NBT/BCIP in NTMT until satisfactory intensity was reached. The staining reaction was stopped with 10 mM EDTA. Sections were washed, dehydrated, and mounted with Eukitt® quick-hardening mounting medium (Sigma-Aldrich, St. Louis, MO, USA).
Mouse cDNA was synthetized from total brain RNA using EasyScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). Desired DNA fragments were amplified by PCR (Phusion, NEB, Beverly, MA, USA). PCR fragments were individually cloned in pEASY-Blunt Zero backbone (TransGen Biotech, Beijing, China) and verified by sequencing. Antisense digoxigenin-labeled riboprobes were synthesized according to the protocol recommended by the manufacturer (cat# 11277073910, Roche, Basel, Switzerland).

4.5. Image Acquisition

Chromogenic stainings were imaged at a 10× or 20× magnification using a slide scanner BX61VS (Olympus, Tokyo, Japan), an inverted confocal microscope LSM 880 (Carl Zeiss GmbH, Jena, Germany), or an ApoTome microscope (Axio Imager 2, Carl Zeiss GmbH, Jena, Germany). The fluorescent images were acquired in monochrome and color maps were applied to the images post-acquisition. Post hoc linear brightness and contrast adjustment were applied uniformly to the images under analysis.

4.6. Immunohistochemistry

For combining Gabre expression and antibody staining, we performed immunohistochemistry on sections from Gabre-cre::Ai14 reporter mice. Sections containing the locus coeruleus were stained with antibody against tyrosine hydroxylase (1:500, MB318, Sigma-Aldrich, St. Louis, MO, USA). Sections were blocked in 5% bovine serum albumin (BSA) in PBS 1 h at room temperature, and then transferred to the primary antibody in PBS with 1% BSA and 0.5% Triton X-100 (X100, Sigma-Aldrich, St. Louis, MO, USA) for incubation at 4 °C overnight. Sections were washed in PBS, followed by 2 h room-temperature incubation with Alexa Fluor 488 goat anti-rabbit secondary antibody (1:2000, Jackson ImmunoResearch, West Grove, PA, USA) and DAPI (1:2500, Solarbio, Beijing, China). After washing in PBS, sections were mounted and coverslipped with Fluoromount Aqueous Mounting Medium (F4680, Sigma-Aldrich, St. Louis, MO, USA).

4.7. Virus Injection and Chemogenetic Activation

We used Cre-dependent adeno-associated viral vectors (AAV9-hSyn-DIO-hM3D(Gq)-mCherry, Taitool, S0425-9, or AAV9-hSyn-DIO-hM4D(Gi)-mCherry, Taitool, S0193-9) to specifically express excitatory hM3D receptors or inhibitory hM4D receptors in mPOAGABRE neurons and AAV9-hSyn-mCherry (S0240-9, Taitool Bioscience, Shanghai, China) to express mCherry in control mice. Clozapine-N-oxide (CNO, APExBIO, Shanghai, China) was freshly dissolved to 0.3 mg/ml in sterile saline. We used a dose of 3 mg/kg CNO for all experiments.
In this study, 3% isoflurane was used to induce anesthesia, and 1–1.5% isoflurane to maintain anesthesia. After checking the lack of response to a toe pinch, mice were put onto a stereotaxic frame (RWD), with eye ointment to protect the eyes. Each mouse received 100 nl virus injection per side, targeting mPOA, using a syringe (10 μL, 7635-01, Hamilton Company, Reno, NV, USA) and a microinjection syringe pump (Micro4, WPI, Sarasota, FL, USA). The injection coordinates relative to bregma were AP +0.50 mm; ML ±0.5 mm; DV −5.0 mm. After microinjection, the syringe was held in position for 10 min to avoid virus reflux. The wound was sutured and covered with lincomycin hydrochloride and lidocaine hydrochloride gel to prevent inflammation. Subsequent to reducing the isoflurane concentration to 0, mice were monitored until recovery from anesthesia.

4.8. Detection of Splice Variants

High-quality total RNA was isolated from wild-type P14 mouse POA tissue using a RNeasy Lipid Tissue Mini Kit (Cat# 74804, Qiagen, Valencia, CA, USA). Mouse cDNA was synthetized from total RNA using EasyScript First-Strand cDNA Synthesis SuperMix (cat# AE301-02, TransGen Biotech, Beijing, China). Subsequently, two DNA bands from cDNA PCR products were observed and extracted using a Zymoclean Gel DNA Recovery Kit (cat# D4001, Zymo Research, Irvine, CA, USA). DNA fragments were cloned using the pEASY-Blunt3 vector (cat# CB301-01, TransGen Biotech, Beijing, China) and confirmed by sequencing.

4.9. Thermal Image Acquisition and Rectal Temperature Measurement

We used an infrared camera (TiX580, FLUKE, Everett, WA, USA) to acquire images every 20 min after intraperitoneal administration of freshly prepared CNO or saline for 2 h. Data were analyzed using SmartView 4.1 software (FLUKE, Everett, WA, USA). Rectal temperatures were measured together with the thermographs at the same time intervals (RET-3, TH-5, Physitemp, Clifton, NJ, USA).

4.10. Heart Rate Measurement

Mice were anesthetized with 3% isoflurane (RWD Life Science, Shenzhen, China) in an induction chamber, followed by 1.5% isoflurane to maintain anesthesia, using a mask with 100% oxygen flowing at 200 ml/min. Under infrared light heating, the rectal temperatures of the animals were kept at 36 °C during the experiment. We used an analog–digital converter (BL-420N, TECHMAN, Chengdu, China) equipped with recording software (BL-420N, TECHMAN, Chengdu, China) to continuously record ECG for 2 h after injection of CNO or saline. The R-R intervals were analyzed with software (BL-420N, TECHMAN, Chengdu, China). The heart rate data were analyzed using Prism8 (GraphPad Software Inc., San Diego, CA, USA).

4.11. Statistical Analysis

All data were tested for normality and are shown as mean ± standard error of the mean. A p-value <0.05 was considered statistically significant for all experiments. A two-way ANOVA was performed to analyze the effect of the time after i.p. injection and virus type (hM3D-mCherry, hM4D-mCherry, or mCherry) on body temperature. We report the effect of virus type on body temperature after simple main effects analysis. A two-way ANOVA was performed to analyze the effect of the time after i.p. injection and virus type (hM3D-mCherry, hM4D-mCherry, or mCherry) on heart rate. We report the effect of virus type on heart rate after the simple main effects analysis. We report the significance as follows: ns = not significant; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ijms252313061/s1.

Author Contributions

All authors had full access to all the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Study concept and design: R.K.N. and H.W. Acquisition of data: Z.W., L.L. and M.L. Analysis and interpretation of data: Z.W., R.K.N. and H.W. Drafting of the manuscript: Z.W., R.K.N. and H.W. Critical revision of the manuscript for important intellectual content: Z.L., L.Q., Z.W., R.K.N. and H.W. Statistical analysis: Z.W. and H.W. Obtained funding: R.K.N. and H.W. Administrative, technical, and material support: Z.L., L.Q., R.K.N. and H.W. Study supervision: L.Q., R.K.N. and H.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Science and Technology, STI2030 Major Projects 2022ZD0211700 and the National Natural Science Foundation of China, 32070978.

Institutional Review Board Statement

All experimental procedures were performed according to the institutional guidelines on animal welfare and approved by the local institution in charge of experiments using animals (Animal Care and Use Committee at the Shenzhen Institute of Advanced Technology (SIAT), Chinese Academy of Sciences (CAS), China; permit number SIAT-IRB-171016-NS-WH-A0384). Macaque monkey brain sections were collected from a 10-month-old male crab-eating macaque (N = 1, body weight 1 kg; obtained from Guangdong Landau Biotechnology Co., Ltd.), that was sacrificed for an unrelated experiment (Animal Care and Use Committee at the Shenzhen Institute of Advanced Technology (SIAT), Chinese Academy of Sciences (CAS), China; permit number SIAT-IACUC-210326-NS-WH-A1881).

Informed Consent Statement

Not applicable.

Data Availability Statement

All data necessary to support the paper’s conclusions are presented in the main text.

Acknowledgments

We thank Feng Liang and Jinfeng Huang for outstanding technical assistance.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Sternson, S.M. Hypothalamic Survival Circuits: Blueprints for Purposive Behaviors. Neuron 2013, 77, 810–824. [Google Scholar] [CrossRef] [PubMed]
  2. McKinley, M.J.; Pennington, G.L.; Ryan, P.J. The Median Preoptic Nucleus: A Major Regulator of Fluid, Temperature, Sleep, and Cardiovascular Homeostasis. In Handbook of Clinical Neurology; Elsevier: Amsterdam, The Netherlands, 2021; Volume 179, pp. 435–454. ISBN 9780128199756. [Google Scholar]
  3. Nakamura, K.; Nakamura, Y.; Kataoka, N. A Hypothalamomedullary Network for Physiological Responses to Environmental Stresses. Nat. Rev. Neurosci. 2022, 23, 35–52. [Google Scholar] [CrossRef] [PubMed]
  4. Mei, L.; Osakada, T.; Lin, D. Hypothalamic Control of Innate Social Behaviors. Science 2023, 382, 399–404. [Google Scholar] [CrossRef] [PubMed]
  5. Song, K.; Wang, H.; Kamm, G.B.; Pohle, J.; Reis, F.D.C.; Heppenstall, P.; Wende, H.; Siemens, J. The TRPM2 Channel Is a Hypothalamic Heat Sensor That Limits Fever and Can Drive Hypothermia. Science 2016, 353, 1393–1398. [Google Scholar] [CrossRef] [PubMed]
  6. Tan, C.L.; Cooke, E.K.; Leib, D.E.; Lin, Y.-C.; Daly, G.E.; Zimmerman, C.A.; Knight, Z.A. Warm-Sensitive Neurons That Control Body Temperature. Cell 2016, 167, 47–59.e15. [Google Scholar] [CrossRef]
  7. Allen, W.E.; DeNardo, L.A.; Chen, M.Z.; Liu, C.D.; Loh, K.M.; Fenno, L.E.; Ramakrishnan, C.; Deisseroth, K.; Luo, L. Thirst-Associated Preoptic Neurons Encode an Aversive Motivational Drive. Science 2017, 357, 1149–1155. [Google Scholar] [CrossRef]
  8. Chung, S.; Weber, F.; Zhong, P.; Tan, C.L.; Nguyen, T.N.; Beier, K.T.; Hörmann, N.; Chang, W.-C.; Zhang, Z.; Do, J.P.; et al. Identification of Preoptic Sleep Neurons Using Retrograde Labelling and Gene Profiling. Nature 2017, 545, 477–481. [Google Scholar] [CrossRef]
  9. Takahashi, T.M.; Sunagawa, G.A.; Soya, S.; Abe, M.; Sakurai, K.; Ishikawa, K.; Yanagisawa, M.; Hama, H.; Hasegawa, E.; Miyawaki, A.; et al. A Discrete Neuronal Circuit Induces a Hibernation-like State in Rodents. Nature 2020, 583, 109–114. [Google Scholar] [CrossRef]
  10. Zeng, H. What Is a Cell Type and How to Define It? Cell 2022, 185, 2739–2755. [Google Scholar] [CrossRef]
  11. Moffitt, J.R.; Bambah-Mukku, D.; Eichhorn, S.W.; Vaughn, E.; Shekhar, K.; Perez, J.D.; Rubinstein, N.D.; Hao, J.; Regev, A.; Dulac, C.; et al. Molecular, Spatial, and Functional Single-Cell Profiling of the Hypothalamic Preoptic Region. Science 2018, 362, eaau5324. [Google Scholar] [CrossRef]
  12. Lein, E.S.; Hawrylycz, M.J.; Ao, N.; Ayres, M.; Bensinger, A.; Bernard, A.; Boe, A.F.; Boguski, M.S.; Brockway, K.S.; Byrnes, E.J.; et al. Genome-Wide Atlas of Gene Expression in the Adult Mouse Brain. Nature 2007, 445, 168–176. [Google Scholar] [CrossRef] [PubMed]
  13. Yao, Z.; van Velthoven, C.T.J.; Kunst, M.; Zhang, M.; McMillen, D.; Lee, C.; Jung, W.; Goldy, J.; Abdelhak, A.; Aitken, M.; et al. A High-Resolution Transcriptomic and Spatial Atlas of Cell Types in the Whole Mouse Brain. Nature 2023, 624, 317–332. [Google Scholar] [CrossRef] [PubMed]
  14. Olsen, R.W.; Sieghart, W. GABAA Receptors: Subtypes Provide Diversity of Function and Pharmacology. Neuropharmacology 2009, 56, 141–148. [Google Scholar] [CrossRef] [PubMed]
  15. Wisden, W.; Laurie, D.; Monyer, H.; Seeburg, P. The Distribution of 13 GABAA Receptor Subunit mRNAs in the Rat Brain. I. Telencephalon, Diencephalon, Mesencephalon. J. Neurosci. 1992, 12, 1040–1062. [Google Scholar] [CrossRef] [PubMed]
  16. Sieghart, W.; Sperk, G. Subunit composition, distribution and function of GABA-A receptor subtypes. Curr. Top. Med. Chem. 2002, 2, 795–816. [Google Scholar] [CrossRef]
  17. Davies, P.A.; Hanna, M.C.; Hales, T.G.; Kirkness, E.F. Insensitivity to anaesthetic agents conferred by a class of GABAA receptor subunit. Nature 1997, 385, 820–823. [Google Scholar] [CrossRef]
  18. Whiting, P.J.; McAllister, G.; Vassilatis, D.; Bonnert, T.P.; Heavens, R.P.; Smith, D.W.; Hewson, L.; O’Donnell, R.; Rigby, M.R.; Sirinathsinghji, D.J.; et al. Neuronally restricted RNA splicing regulates the expression of a novel GABAA receptor subunit conferring atypical functional properties. J. Neurosci. 1997, 17, 5027–5037. [Google Scholar] [CrossRef]
  19. Garret, M.; Bascles, L.; Boue-Grabot, E.; Sartor, P.; Charron, G.; Bloch, B.; Margolskee, R.F. An mRNA Encoding a Putative GABA-Gated Chloride Channel Is Expressed in the Human Cardiac Conduction System. J. Neurochem. 1997, 68, 1382–1389. [Google Scholar] [CrossRef]
  20. Wilke, K.; Gaul, R.; Klauck, S.M.; Poustka, A. A Gene in Human Chromosome Band Xq28 (GABRE) Defines a Putative New Subunit Class of the GABAANeurotransmitter Receptor. Genomics 1997, 45, 1–10. [Google Scholar] [CrossRef]
  21. Moragues, N.; Ciofi, P.; Lafon, P.; Odessa, M.F.; Tramu, G.; Garret, M. cDNA cloning and expression of a γ-aminobutyric acid A receptor ε-subunit in rat brain. Eur. J. Neurosci. 2000, 12, 4318–4330. [Google Scholar]
  22. Moragues, N.; Ciofi, P.; Tramu, G.; Garret, M. Localisation of GABAA Receptor ϵ-Subunit in Cholinergic and Aminergic Neurones and Evidence for Co-Distribution with the θ-Subunit in Rat Brain. Neuroscience 2002, 111, 657–669. [Google Scholar] [CrossRef] [PubMed]
  23. Sergeeva, O.A.; Eriksson, K.S.; Sharonova, I.N.; Vorobjev, V.S.; Haas, H.L. GABAA Receptor Heterogeneity in Histaminergic Neurons. Eur. J. Neurosci. 2002, 16, 1472–1482. [Google Scholar] [CrossRef] [PubMed]
  24. Moragues, N.; Ciofi, P.; Lafon, P.; Tramu, G.; Garret, M. GABAA Receptor ε Subunit Expression in Identified Peptidergic Neurons of the Rat Hypothalamus. Brain Res. 2003, 967, 285–289. [Google Scholar] [CrossRef] [PubMed]
  25. Neelands, T.R.; Fisher, J.L.; Bianchi, M.; Macdonald, R.L. Spontaneous and γ-Aminobutyric Acid (GABA)-Activated GABA A Receptor Channels Formed by ε Subunit-Containing Isoforms. Mol. Pharmacol. 1999, 55, 168–178. [Google Scholar] [CrossRef] [PubMed]
  26. Davies, P.A.; McCartney, M.R.; Wang, W.; Hales, T.G.; Kirkness, E.F. Alternative Transcripts of the GABAA Receptor ε Subunit in Human and Rat. Neuropharmacology 2002, 43, 467–475. [Google Scholar] [CrossRef]
  27. Thompson, S.A.; Bonnert, T.P.; Cagetti, E.; Whiting, P.J.; Wafford, K.A. Overexpression of the GABAA Receptor ε Subunit Results in Insensitivity to Anaesthetics. Neuropharmacology 2002, 43, 662–668. [Google Scholar] [CrossRef]
  28. Wagner, D.A.; Goldschen-Ohm, M.P.; Hales, T.G.; Jones, M.V. Kinetics and Spontaneous Open Probability Conferred by the ϵ Subunit of the GABA A Receptor. J. Neurosci. 2005, 25, 10462–10468. [Google Scholar] [CrossRef]
  29. Germann, A.L.; Burbridge, A.B.; Pierce, S.R.; Akk, G. Activation of the Rat A1β2ε GABAA Receptor by Orthosteric and Allosteric Agonists. Biomolecules 2022, 12, 868. [Google Scholar] [CrossRef]
  30. Sergeeva, O.A.; Andreeva, N.; Garret, M.; Scherer, A.; Haas, H.L. Pharmacological Properties of GABA A Receptors in Rat Hypothalamic Neurons Expressing the ϵ-Subunit. J. Neurosci. 2005, 25, 88–95. [Google Scholar] [CrossRef]
  31. Kasparov, S.; Davies, K.A.; Patel, U.A.; Boscan, P.; Garret, M.; Paton, J.F.R. GABAA Receptor ε-subunit May Confer Benzodiazepine Insensitivity to the Caudal Aspect of the Nucleus Tractus Solitarii of the Rat. J. Physiol. 2001, 536, 785–796. [Google Scholar] [CrossRef]
  32. Hengen, K.B.; Nelson, N.R.; Stang, K.M.; Johnson, S.M.; Crader, S.M.; Watters, J.J.; Mitchell, G.S.; Behan, M. Increased GABAA Receptor ε-Subunit Expression on Ventral Respiratory Column Neurons Protects Breathing During Pregnancy. PLoS ONE 2012, 7, e30608. [Google Scholar] [CrossRef] [PubMed]
  33. Chen, X.; Zhou, Y.-N.; Lu, X.-Z.; Li, R.-J.; Xiong, Y.-F.; Sheng, X.; Zhu, W.-W. Cognitive Dysfunction in Schizophrenia Patients Caused by Down-Regulation of γ-Aminobutyric Acid Receptor Subunits. World J. Psychiatry 2024, 14, 784–793. [Google Scholar] [CrossRef] [PubMed]
  34. Markus, F.; Angelini, C.; Trimouille, A.; Rudolf, G.; Lesca, G.; Goizet, C.; Lasseaux, E.; Arveiler, B.; van Slegtenhorst, M.; Brooks, A.S.; et al. Rare variants in the GABAA receptor subunit ε identified in patients with a wide spectrum of epileptic phenotypes. Mol. Genet. Genom. Med. 2020, 8, e1388. [Google Scholar] [CrossRef] [PubMed]
  35. Wang, Y.; Du, X.; Bin, R.; Yu, S.; Xia, Z.; Zheng, G.; Zhong, J.; Zhang, Y.; Jiang, Y.; Wang, Y. Genetic Variants Identified from Epilepsy of Unknown Etiology in Chinese Children by Targeted Exome Sequencing. Sci. Rep. 2017, 7, 40319. [Google Scholar] [CrossRef]
  36. Ghit, A.; Assal, D.; Al-Shami, A.S.; Hussein, D.E.E. GABAA Receptors: Structure, Function, Pharmacology, and Related Disorders. J. Genet. Eng. Biotechnol. 2021, 19, 123. [Google Scholar] [CrossRef]
  37. Morrison, S.F. Central Neural Control of Thermoregulation and Brown Adipose Tissue. Auton. Neurosci. 2016, 196, 14–24. [Google Scholar] [CrossRef]
  38. Armbruster, B.N.; Li, X.; Pausch, M.H.; Herlitze, S.; Roth, B.L. Evolving the Lock to Fit the Key to Create a Family of G Protein-Coupled Receptors Potently Activated by an Inert Ligand. Proc. Natl. Acad. Sci. USA 2007, 104, 5163–5168. [Google Scholar] [CrossRef]
  39. Janssen, B.J.; De Celle, T.; Debets, J.J.; Brouns, A.E.; Callahan, M.F.; Smith, T.L. Effects of Anesthetics on Systemic Hemodynamics in Mice. Am. J. Physiol. Heart Circ. Physiol. 2004, 287, H1618–H1624. [Google Scholar] [CrossRef]
  40. Tossell, K.; Dodhia, R.A.; Galet, B.; Tkachuk, O.; Ungless, M.A. Tonic GABAergic Inhibition, via GABAA Receptors Containing αβε Subunits, Regulates Excitability of Ventral Tegmental Area Dopamine Neurons. Eur. J. Neurosci. 2021, 53, 1722–1737. [Google Scholar] [CrossRef]
  41. Sinkkonen, S.T.; Hanna, M.C.; Kirkness, E.F.; Korpi, E.R. GABAA receptor ε and θ subunits display unusual structural variation between species and are enriched in the rat locus ceruleus. J. Neurosci. 2000, 20, 3588–3595. [Google Scholar] [CrossRef]
  42. Fang, H.; Wang, Z.; Bu, Y.; Yuan, Z.; Wang, G.; Guo, Y.; Cheng, X.; Qiu, W. Repeated Inhalation of Sevoflurane Inhibits the Information Transmission of Purkinje Cells and Delays Motor Development via the GABAA Receptor ε Subunit in Neonatal Mice. Mol. Med. Rep. 2017, 17, 1083–1092. [Google Scholar] [CrossRef] [PubMed]
  43. Hengen, K.B.; Nelson, N.R.; Stang, K.M.; Johnson, S.M.; Smith, S.M.; Watters, J.J.; Mitchell, G.S.; Behan, M. Daily Isoflurane Exposure Increases Barbiturate Insensitivity in Medullary Respiratory and Cortical Neurons via Expression of ε-Subunit Containing GABA ARs. PLoS ONE 2015, 10, e0119351. [Google Scholar] [CrossRef] [PubMed]
  44. Sequeira, A.; Shen, K.; Gottlieb, A.; Limon, A. Human Brain Transcriptome Analysis Finds Region- and Subject-Specific Expression Signatures of GABAAR Subunits. Commun. Biol. 2019, 2, 153. [Google Scholar] [CrossRef] [PubMed]
  45. Tan, C.L.; Knight, Z.A. Regulation of Body Temperature by the Nervous System. Neuron 2018, 98, 31–48. [Google Scholar] [CrossRef] [PubMed]
  46. Boulant, J.A. Neuronal Basis of Hammel’s Model for Set-Point Thermoregulation. J. Appl. Physiol. 2006, 100, 1347–1354. [Google Scholar] [CrossRef]
  47. Siemens, J.; Kamm, G.B. Cellular Populations and Thermosensing Mechanisms of the Hypothalamic Thermoregulatory Center. Pflügers Arch. Eur. J. Physiol. 2018, 470, 809–822. [Google Scholar] [CrossRef]
  48. Lockwood, C.; Conroy-Hiller, T.; Page, T. Vital Signs. JBI Evid. Synth. 2004, 2, 1–38. [Google Scholar] [CrossRef]
  49. Schulkin, J.; Sterling, P. Allostasis: A Brain-Centered, Predictive Mode of Physiological Regulation. Trends Neurosci. 2019, 42, 740–752. [Google Scholar] [CrossRef]
  50. Kim, J.J.; Gharpure, A.; Teng, J.; Zhuang, Y.; Howard, R.J.; Zhu, S.; Noviello, C.M.; Walsh, R.M.; Lindahl, E.; Hibbs, R.E. Shared Structural Mechanisms of General Anaesthetics and Benzodiazepines. Nature 2020, 585, 303–308. [Google Scholar] [CrossRef]
  51. Irnaten, M.; Walwyn, W.M.; Wang, J.; Venkatesan, P.; Evans, C.; Chang, K.S.K.; Andresen, M.C.; Hales, T.G.; Mendelowitz, D. Pentobarbital Enhances GABAergic Neurotransmission to Cardiac Parasympathetic Neurons, Which Is Prevented by Expression of GABAAε Subunit. Anesthesiology 2002, 97, 717–724. [Google Scholar] [CrossRef]
  52. Veerakumar, A.; Yung, A.R.; Liu, Y.; Krasnow, M.A. Molecularly Defined Circuits for Cardiovascular and Cardiopulmonary Control. Nature 2022, 606, 739–746. [Google Scholar] [CrossRef] [PubMed]
  53. Jiang-Xie, L.-F.; Yin, L.; Zhao, S.; Prevosto, V.; Han, B.-X.; Dzirasa, K.; Wang, F. A Common Neuroendocrine Substrate for Diverse General Anesthetics and Sleep. Neuron 2019, 102, 1053–1065.e4. [Google Scholar] [CrossRef]
  54. Mondino, A.; Hambrecht-Wiedbusch, V.S.; Li, D.; York, A.K.; Pal, D.; González, J.; Torterolo, P.; Mashour, G.A.; Vanini, G. Glutamatergic Neurons in the Preoptic Hypothalamus Promote Wakefulness, Destabilize NREM Sleep, Suppress REM Sleep, and Regulate Cortical Dynamics. J. Neurosci. 2021, 41, 3462–3478. [Google Scholar] [CrossRef] [PubMed]
  55. Reitz, S.L.; Wasilczuk, A.Z.; Beh, G.H.; Proekt, A.; Kelz, M.B. Activation of Preoptic Tachykinin 1 Neurons Promotes Wakefulness over Sleep and Volatile Anesthetic-Induced Unconsciousness. Curr. Biol. 2021, 31, 394–405.e4. [Google Scholar] [CrossRef] [PubMed]
  56. Reitz, S.L.; Kelz, M.B. Preoptic Area Modulation of Arousal in Natural and Drug Induced Unconscious States. Front. Neurosci. 2021, 15, 644330. [Google Scholar] [CrossRef]
  57. Piñol, R.A.; Mogul, A.S.; Hadley, C.K.; Saha, A.; Li, C.; Škop, V.; Province, H.S.; Xiao, C.; Gavrilova, O.; Krashes, M.J.; et al. Preoptic BRS3 Neurons Increase Body Temperature and Heart Rate via Multiple Pathways. Cell Metab. 2021, 33, 1389–1403.e6. [Google Scholar] [CrossRef]
  58. Jorge, J.C.; McIntyre, K.L.; Henderson, L.P. The Function and the Expression of Forebrain GABA A Receptors Change with Hormonal State in the Adult Mouse. J. Neurobiol. 2002, 50, 137–149. [Google Scholar] [CrossRef]
  59. Zhang, Y.; Li, H.; Zhang, X.; Wang, S.; Wang, D.; Wang, J.; Tong, T.; Zhang, Z.; Yang, Q.; Dong, H. Estrogen Receptor-A in Medial Preoptic Area Contributes to Sex Difference of Mice in Response to Sevoflurane Anesthesia. Neurosci. Bull. 2022, 38, 703–719. [Google Scholar] [CrossRef]
  60. Li, M.; Yang, L.; Qian, W.; Ray, S.; Lu, Z.; Liu, T.; Zou, Y.-Y.; Naumann, R.K.; Wang, H. A Novel Rat Model of Dravet Syndrome Recapitulates Clinical Hallmarks. Neurobiol. Dis. 2023, 184, 106193. [Google Scholar] [CrossRef]
Figure 1. Generation of a Gabre-cre knock-in mouse line. (A) Targeting strategy. Open reading frames are mapped to chromosome X and illustrated with arrows and rectangles for Gabre (green) and iCre (blue). Six different splice variants were detected, mainly in exon 2. With CRISPR/Cas9 technology, the ires-iCre sequence was inserted 3′ to the Gabre stop codon. (B) PCR Screening. Genotyping primers used are described in the methods section. P1 + P3 detect the wild-type allele (739 bp), while P2 + P3 detect the Gabre-cre knock-in allele (472 bp).
Figure 1. Generation of a Gabre-cre knock-in mouse line. (A) Targeting strategy. Open reading frames are mapped to chromosome X and illustrated with arrows and rectangles for Gabre (green) and iCre (blue). Six different splice variants were detected, mainly in exon 2. With CRISPR/Cas9 technology, the ires-iCre sequence was inserted 3′ to the Gabre stop codon. (B) PCR Screening. Genotyping primers used are described in the methods section. P1 + P3 detect the wild-type allele (739 bp), while P2 + P3 detect the Gabre-cre knock-in allele (472 bp).
Ijms 25 13061 g001
Figure 3. Higher resolution images of selected regions of Gabre-cre::Ai14 mice. The locations are highlighted by a dashed box in schematic black and white images; see also Figure 2. (A) Dense labeled cells are located mainly in the ventral lateral septum. (B) Strong tdT signals detected in several nuclei of the preoptic area with varying intensity, among which the MPOM and MnPO show the highest density. (C) In the anterior hypothalamus, the PVH and the shell region of the SCh show a large number of labeled cells. (D,E) Dense labeling in the SFO and PrEW. (F) Strong tdT labeling is present around the 3 V. The Arc has a large number of labeled neurons, while the DMH and the MTu have a moderate density. (G) The PAG has tdT positive cells, mostly within the lateral and ventrolateral parts. (H) The LC and the Bar both express tdT. The green fluorescent signals represent tyrosine hydroxylase (TH) antibody staining. For abbreviations, see Table 1.
Figure 3. Higher resolution images of selected regions of Gabre-cre::Ai14 mice. The locations are highlighted by a dashed box in schematic black and white images; see also Figure 2. (A) Dense labeled cells are located mainly in the ventral lateral septum. (B) Strong tdT signals detected in several nuclei of the preoptic area with varying intensity, among which the MPOM and MnPO show the highest density. (C) In the anterior hypothalamus, the PVH and the shell region of the SCh show a large number of labeled cells. (D,E) Dense labeling in the SFO and PrEW. (F) Strong tdT labeling is present around the 3 V. The Arc has a large number of labeled neurons, while the DMH and the MTu have a moderate density. (G) The PAG has tdT positive cells, mostly within the lateral and ventrolateral parts. (H) The LC and the Bar both express tdT. The green fluorescent signals represent tyrosine hydroxylase (TH) antibody staining. For abbreviations, see Table 1.
Ijms 25 13061 g003
Figure 5. GABRE expression in macaque monkey LS and POA. (A,B). In situ hybridization for GABRE in the LS and POA regions of the macaque brain. For abbreviations, see Table 1.
Figure 5. GABRE expression in macaque monkey LS and POA. (A,B). In situ hybridization for GABRE in the LS and POA regions of the macaque brain. For abbreviations, see Table 1.
Ijms 25 13061 g005
Figure 6. Chemogenetic activation of mPOAGABRE neurons decreases body temperature. (A) Schematic figure and example of AAV injection targeting mPOA in the Gabre-cre mouse line. (B) Changes of rectal temperature after chemogenetic activation of mPOAGABRE neurons (Gq, n = 7), chemogenetic inhibition (Gi, n = 6), and control group (Ctrl, n = 7). (C) Thermographs of mice injected with saline in Gq, Gi, and control groups. (D) Thermographs of mice injected with CNO in Gq, Gi, and control groups. (E) Quantification of surface temperature of the back, head, and tail regions after CNO injection in Gq (n = 6), Gi (n = 6), and control (n = 10) groups. The gray, red, and blue boxes in (C,D) indicate the Ctrl, Gq, and Gi groups, respectively. Asterisks indicate statistical significance (ns = not significant, * p < 0.05, ** p < 0.01, **** p < 0.0001). Two-way ANOVA was used to compare Gq with control and Gi with control groups, respectively. Data are shown as mean ± SEM.
Figure 6. Chemogenetic activation of mPOAGABRE neurons decreases body temperature. (A) Schematic figure and example of AAV injection targeting mPOA in the Gabre-cre mouse line. (B) Changes of rectal temperature after chemogenetic activation of mPOAGABRE neurons (Gq, n = 7), chemogenetic inhibition (Gi, n = 6), and control group (Ctrl, n = 7). (C) Thermographs of mice injected with saline in Gq, Gi, and control groups. (D) Thermographs of mice injected with CNO in Gq, Gi, and control groups. (E) Quantification of surface temperature of the back, head, and tail regions after CNO injection in Gq (n = 6), Gi (n = 6), and control (n = 10) groups. The gray, red, and blue boxes in (C,D) indicate the Ctrl, Gq, and Gi groups, respectively. Asterisks indicate statistical significance (ns = not significant, * p < 0.05, ** p < 0.01, **** p < 0.0001). Two-way ANOVA was used to compare Gq with control and Gi with control groups, respectively. Data are shown as mean ± SEM.
Ijms 25 13061 g006
Figure 7. Chemogenetic inhibition of mPOAGABRE neurons decreases heart rate under isoflurane anesthesia. (A) Schematic illustration of ECG recording during anesthesia. (B) A sample trace of the ECG recording. (C) CNO but not saline injection in the Gi group decreases heart rate. (Gi group, n =6; control group, n = 5, two-way ANOVA, p = 0.0834 for saline injection, p = 0.0030 for CNO injection). (D) Saline and CNO injections do not affect heart rate in the Gq group (Gq group, n = 5; control group, n = 5, two-way ANOVA, p = 0.2908 for saline injection, p = 0.1667 for CNO injection). Asterisks indicate statistical significance (ns = not significant, ** p < 0.01) using two-way ANOVA for comparison. Data are shown as mean ± SEM.
Figure 7. Chemogenetic inhibition of mPOAGABRE neurons decreases heart rate under isoflurane anesthesia. (A) Schematic illustration of ECG recording during anesthesia. (B) A sample trace of the ECG recording. (C) CNO but not saline injection in the Gi group decreases heart rate. (Gi group, n =6; control group, n = 5, two-way ANOVA, p = 0.0834 for saline injection, p = 0.0030 for CNO injection). (D) Saline and CNO injections do not affect heart rate in the Gq group (Gq group, n = 5; control group, n = 5, two-way ANOVA, p = 0.2908 for saline injection, p = 0.1667 for CNO injection). Asterisks indicate statistical significance (ns = not significant, ** p < 0.01) using two-way ANOVA for comparison. Data are shown as mean ± SEM.
Ijms 25 13061 g007
Table 1. Abbreviations.
Table 1. Abbreviations.
AbbreviationFull Name
acaAnterior commissure, anterior part
AcbCAccumbens nucleus, core region
AcbShAccumbens nucleus, shell region
acpAnterior commissure, posterior limb
AHCAnterior hypothalamic nucleus, central
AmbAmbiguus nucleus
AqAqueduct
ArcArcuate hypothalamic nucleus
BarBarrington’s nucleus
CeACentral amygdalar nucleus
CPuCaudate putamen
DLPAGDorsolateral periaqueductal gray
DMHDorsomedial hypothalamic nucleus
DMPAGDorsomedial periaqueductal gray
DRDDorsal raphe nucleus, ventral part
DRLDorsal raphe nucleus, lateral part
fFornix
FuBed nucleus of the stria terminalis, fusiform part
LCLocus coeruleus
LPAGLateral periaqueductal gray
LPOLateral preoptic area
LSLateral septum
LVLateral ventricle
MMMedial mammillary nucleus
MnPOMedian preoptic nucleus
MPAMedial preoptic area
MPOLMedial preoptic nucleus, lateral part
MPOMMedial preoptic nucleus, medial part
MSMedial septum
MTuMedial tuberal nucleus
NTSSolitary tract nucleus
PAGPeriaqueductal gray
PDTgPosterodosal tegmental nucleus
PePeriventricular hypothalamic nucleus
POAPreoptic area
PrEWPre-Edinger–Westphal nucleus
PSParastrial nucleus
PVParaventricular thalamic nucleus
PVHParaventricular hypothalamic nucleus
SChSuprachiasmatic nucleus
scpSuperior cerebellar peduncle
SFOSubfornical organ
SHySeptohypothalamic nucleus
STBed nucleus of the stria terminalis
STLVBed nucleus of the stria terminalis, lateral division, ventral part
STMVBed nucleus of the stria terminalis, medial division, ventral part
VLPAGVentrolateral periaqueductal gray
VMHCVentromedial hypothalamic nucleus, central part
VMHDMVentromedial hypothalamic nucleus, dorsomedial part
VMHVLVentromedial hypothalamic nucleus, ventrolateral part
VMPOVentromedial preoptic nucleus
3V3rd ventricle
4V4th ventricle
Table 2. Expression patterns across brain regions. Signal strength: − no signal, + weak signal, ++ medium signal, +++ strong signal.
Table 2. Expression patterns across brain regions. Signal strength: − no signal, + weak signal, ++ medium signal, +++ strong signal.
Brain RegionGabre-cre::Ai14 tdT CellsGabre-cre::Ai14 tdT NeuropiltdT ISH CellsGabre ISH Cells
Cerebral Cortex
Motor Cortex++
Somatosensory Cortex++
Intermediate Endopiriform Nucleus+++
Cerebral Nuclei
Lateral Septum++++++++++
Medial Septum++
Medial Amygdalar Nucleus+++++++
Anterior Amygdalar Area++++++
Intercalated Amygdalar Nucleus+++++++
Central Amygdalar Nucleus++++++++++
Nucleus Accumbens+++
Bed Nucleus of the Stria Terminalis+++++++
Thalamus
Intergeniculate Leaflet+++
Lateral Geniculate Complex, Ventral Part++
Medial Geniculate Nucleus, Medial++++
Suprageniculate Thalamic Nucleus+++
Paraventricular Thalamic Nucleus++++++
Intermediodorsal Thalamic Nucleus++
Reuniens Thalamic Nucleus+++
Central Medial Thalamic Nucleus+++
Hypothalamus
Median Eminence++++++++
Arcuate Hypothalamic Nucleus++++++++++++
Medial Tuberal Nucleus+++++++
Dorsomedial Hypothalamic Nucleus++++++++++++
Ventromedial Hypothalamic Nucleus++++++++
Zona Incerta++++++
Lateral Hypothalamic Area+++++++++
Periventricular Hypothalamic Nucleus+++++++++
Parastrial Nucleus+++++
Medial Preoptic Nucleus, Medial Part++++++++++
Medial Preoptic Nucleus, Lateral Part+++++++
Ventromedial Preoptic Nucleus++++++++++
Septohypothalamic Nucleus+++++++
Lateral Preoptic Area++++-
Medial Preoptic Area+++++++
Median Preoptic Nucleus++++++++
Posterior Hypothalamic Nucleus++++++++
Medial Mamillary Nucleus+++++
Paraventricular Hypothalamic Nucleus+++++++
Subfornical Organ++++++++++
Suprachiasmatic Area+++++++
Anterior Hypothalamic Nucleus+++++++
Midbrain
Pariaqueductal Gray+++++++++
Pre-Edinger–Westphal Nucleus++++++
Mesencephalic Reticular Formation+++
Isthmic Reticular Formation+++
Pedunculotegmental Nucleus++
Interpeduncular Nucleus, Rostral Subnucleus+++
Dorsal Raphe Nucleus+++++
Hindbrain
Locus Coeruleus+++++++++++
Solitary Tract Nucleus++++++++
Intermediate Reticular Nucleus++++
Ambiguus Nucleus++++
Botzinger Complex+++
Raphe Pallidus Nucleus+++++
Inferior Olive, Principal Nucleus+++++
Area Postrema+++++
Fiber tracts
Superior Cerebellar Peduncle+
Table 3. Primers for genotyping Gabre-cre mice.
Table 3. Primers for genotyping Gabre-cre mice.
PrimerSequence (5′→3′)
P1TTCCAACCAATAGCCGTGCTAATG
P2TGGACCAATGTGAACATAGTGATGAACTAC
P3CTGCTATACTGTTGCTCTGTGCATTCTG
Table 4. Primers for in situ hybridization.
Table 4. Primers for in situ hybridization.
PrimerSequence (5′→3′)
Gabre mouse forward ATACTCGAGTTGACATCATCTTCCACCAGACCTG
Gabre mouse reverseTGGTTGGAAGTTGGTAGACCTTTAGAGAAGC
tdT forwardATGGTGAGCAAGGGCGAGGA
tdT reverseGGCATGGACGAGCTGTACAAG
GABRE macaque forwardTCTTCAAGGAGCATCCGTGATGC
GABRE macaque reverseGTGACAGTGGGCTCTTGGATAGCTTC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Z.; Li, L.; Li, M.; Lu, Z.; Qin, L.; Naumann, R.K.; Wang, H. Chemogenetic Modulation of Preoptic Gabre Neurons Decreases Body Temperature and Heart Rate. Int. J. Mol. Sci. 2024, 25, 13061. https://doi.org/10.3390/ijms252313061

AMA Style

Wang Z, Li L, Li M, Lu Z, Qin L, Naumann RK, Wang H. Chemogenetic Modulation of Preoptic Gabre Neurons Decreases Body Temperature and Heart Rate. International Journal of Molecular Sciences. 2024; 25(23):13061. https://doi.org/10.3390/ijms252313061

Chicago/Turabian Style

Wang, Ziyue, Lanxiang Li, Miao Li, Zhonghua Lu, Lihua Qin, Robert Konrad Naumann, and Hong Wang. 2024. "Chemogenetic Modulation of Preoptic Gabre Neurons Decreases Body Temperature and Heart Rate" International Journal of Molecular Sciences 25, no. 23: 13061. https://doi.org/10.3390/ijms252313061

APA Style

Wang, Z., Li, L., Li, M., Lu, Z., Qin, L., Naumann, R. K., & Wang, H. (2024). Chemogenetic Modulation of Preoptic Gabre Neurons Decreases Body Temperature and Heart Rate. International Journal of Molecular Sciences, 25(23), 13061. https://doi.org/10.3390/ijms252313061

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop