Investigating the Role of 17-Beta Estradiol in the Regulation of the Unfolded Protein Response (UPR) in Pancreatic Beta Cells
Abstract
:1. Introduction
2. Results
2.1. UPR Activation in Isolated Pancreatic Islets from ApoE−/− and ApoE−/−:Ins2+/Akita Mice
2.2. UPR Activation in Pancreatic Islets from ApoE−/− and ApoE−/−:Ins2+/Akita Mice
2.3. Effects of 17-Beta Estradiol in the Modulation of the Adaptive UPR in a Pancreatic Beta Cell Line
2.4. Effects of 17-Beta Estradiol in the Modulation of the Apoptotic UPR in a Pancreatic Beta Cell Line
3. Discussion
4. Materials and Methods
- Animal models
- Ovariectomy
- Tissue harvesting
- Analysis of the pancreas
- Islet isolation
- Cell line and cell experiments
- Gene expression analysis by qRT-PCR
- Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sun, H.; Saeedi, P.; Karuranga, S.; Pinkepank, M.; Ogurtsova, K.; Duncan, B.B.; Stein, C.; Basit, A.; Chan, J.C.; Mbanya, J.C.; et al. IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045. Diabetes Res. Clin. Pract. 2022, 183, 109119. [Google Scholar] [CrossRef]
- D’Souza, A.; Hussain, M.; Howarth, F.C.; Woods, N.M.; Bidasee, K.; Singh, J. Pathogenesis and pathophysiology of accelerated atherosclerosis in the diabetic heart. Mol. Cell Biochem. 2009, 331, 89–116. [Google Scholar] [CrossRef]
- Raparelli, V.; Morano, S.; Franconi, F.; Lenzi, A.; Basili, S. Sex Differences in Type-2 Diabetes: Implications for Cardiovascular Risk Management. Curr. Pharm. Des. 2017, 23, 1471–1476. [Google Scholar] [CrossRef]
- Appelman, Y.; van Rijn, B.B.; Ten Haaf, M.E.; Boersma, E.; Peters, S.A.E. Sex differences in cardiovascular risk factors and disease prevention. Atherosclerosis 2015, 241, 211–218. [Google Scholar] [CrossRef]
- Nilsson, S.; Mäkelä, S.; Treuter, E.; Tujague, M.; Thomsen, J.; Andersson, G.; Enmark, E.; Pettersson, K.; Warner, M.; Gustafsson, J.A. Mechanisms of estrogen action. Physiol. Rev. 2001, 81, 1535–1565. [Google Scholar] [CrossRef]
- Gupte, A.A.; Pownall, H.J.; Hamilton, D.J. Estrogen: An emerging regulator of insulin action and mitochondrial function. J. Diabetes Res. 2015, 2015, 916585. [Google Scholar] [CrossRef] [PubMed]
- Yamabe, N.; Kang, K.S.; Zhu, B.T. Beneficial effect of 17β-estradiol on hyperglycemia and islet β-cell functions in a streptozotocin-induced diabetic rat model. Toxicol. Appl. Pharmacol. 2010, 249, 76–85. [Google Scholar] [CrossRef] [PubMed]
- de Ritter, R.; de Jong, M.; Vos, R.C.; van der Kallen, C.J.H.; Sep, S.J.S.; Woodward, M.; Stehouwer, C.D.A.; Bots, M.L.; Peters, S.A.E. Sex differences in the risk of vascular disease associated with diabetes. Biol. Sex. Differ. 2020, 11, 1. [Google Scholar] [CrossRef]
- Kautzky-Willer, A.; Leutner, M.; Harreiter, J. Sex differences in type 2 diabetes. Diabetologia 2023, 66, 986–1002. [Google Scholar] [CrossRef]
- Tramunt, B.; Smati, S.; Grandgeorge, N.; Lenfant, F.; Arnal, J.-F.; Montagner, A.; Gourdy, P. Sex differences in metabolic regulation and diabetes susceptibility. Diabetologia 2020, 63, 453–461. [Google Scholar] [CrossRef] [PubMed]
- Cnop, M.; Toivonen, S.; Igoillo-Esteve, M.; Salpea, P. Endoplasmic reticulum stress and eIF2α phosphorylation: The Achilles heel of pancreatic β cells. Mol. Metab. 2017, 6, 1024–1039. [Google Scholar] [CrossRef] [PubMed]
- Rutkowski, D.T.; Kaufman, R.J. That which does not kill me makes me stronger: Adapting to chronic ER stress. Trends Biochem. Sci. 2007, 32, 469–476. [Google Scholar] [CrossRef] [PubMed]
- Iurlaro, R.; Muñoz-Pinedo, C. Cell death induced by endoplasmic reticulum stress. FEBS J. 2016, 283, 2640–2652. [Google Scholar] [CrossRef] [PubMed]
- Pandey, V.K.; Mathur, A.; Kakkar, P. Emerging role of Unfolded Protein Response (UPR) mediated proteotoxic apoptosis in diabetes. Life Sci. 2019, 216, 246–258. [Google Scholar] [CrossRef]
- Maamoun, H.; Abdelsalam, S.S.; Zeidan, A.; Korashy, H.M.; Agouni, A. Endoplasmic Reticulum Stress: A Critical Molecular Driver of Endothelial Dysfunction and Cardiovascular Disturbances Associated with Diabetes. Int. J. Mol. Sci. 2019, 20, 1658. [Google Scholar] [CrossRef]
- Ghosh, R.; Colon-Negron, K.; Papa, F.R. Endoplasmic reticulum stress, degeneration of pancreatic islet β-cells, and therapeutic modulation of the unfolded protein response in diabetes. Mol. Metab. 2019, 27, S60–S68. [Google Scholar] [CrossRef]
- Venegas-Pino, D.E.; Wang, P.-W.; Stoute, H.K.; Singh-Pickersgill, N.A.; Hong, B.Y.; Khan, M.I.; Shi, Y.; Werstuck, G.H. Sex-Specific Differences in an ApoE(−/−):Ins2(+/Akita) Mouse Model of Accelerated Atherosclerosis. Am. J. Pathol. 2016, 186, 67–77. [Google Scholar] [CrossRef]
- De Paoli, M.; Wood, D.W.; Bohn, M.K.; Pandey, A.K.; Borowitz, D.K.; Fang, S.; Patel, Z.; Venegas-Pino, D.E.; Shi, Y.; Werstuck, G.H. Investigating the protective effects of estrogen on β-cell health and the progression of hyperglycemia-induced atherosclerosis. Am. J. Physiol. Endocrinol. Metab. 2022, 323, E254–E266. [Google Scholar] [CrossRef]
- Skelin, M.; Rupnik, M.; Cencic, A. Pancreatic beta cell lines and their applications in diabetes mellitus research. ALTEX-Altern. Anim. Exp. 2010, 27, 105–113. [Google Scholar] [CrossRef]
- Ibrahim, I.M.; Abdelmalek, D.H.; Elfiky, A.A. GRP78: A cell’s response to stress. Life Sci. 2019, 226, 156–163. [Google Scholar] [CrossRef]
- Hosokawa, N.; Wada, I.; Natsuka, Y.; Nagata, K. EDEM accelerates ERAD by preventing aberrant dimer formation of misfolded alpha1-antitrypsin. Genes Cells 2006, 11, 465–476. [Google Scholar] [CrossRef]
- Tufo, G.; E Jones, A.W.; Wang, Z.; Hamelin, J.; Tajeddine, N.; Esposti, D.D.; Martel, C.; Boursier, C.; Gallerne, C.; Migdal, C.; et al. The protein disulfide isomerases PDIA4 and PDIA6 mediate resistance to cisplatin-induced cell death in lung adenocarcinoma. Cell Death Differ. 2014, 21, 685–695. [Google Scholar] [CrossRef] [PubMed]
- Kautzky-Willer, A.; Harreiter, J.; Pacini, G. Sex and Gender Differences in Risk, Pathophysiology and Complications of Type 2 Diabetes Mellitus. Endocr. Rev. 2016, 37, 278–316. [Google Scholar] [CrossRef] [PubMed]
- Kooptiwut, S.; Mahawong, P.; Hanchang, W.; Semprasert, N.; Kaewin, S.; Limjindaporn, T.; Yenchitsomanus, P.-T. Estrogen reduces endoplasmic reticulum stress to protect against glucotoxicity induced-pancreatic β-cell death. J. Steroid Biochem. Mol. Biol. 2014, 139, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Wang, Q.; Chai, W.; Chen, M.-H.; Liu, Z.; Shi, W. Hyperglycemia in apolipoprotein E-deficient mouse strains with different atherosclerosis susceptibility. Cardiovasc. Diabetol. 2011, 10, 117. [Google Scholar] [CrossRef] [PubMed]
- Jang, I.; Pottekat, A.; Poothong, J.; Yong, J.; Lagunas-Acosta, J.; Charbono, A.; Chen, Z.; Scheuner, D.L.; Liu, M.; Itkin-Ansari, P.; et al. PDIA1/P4HB is required for efficient proinsulin maturation and ß cell health in response to diet induced obesity. eLife 2019, 8, e44528. [Google Scholar] [CrossRef] [PubMed]
- Poitout, V.; Stout, L.E.; Armstrong, M.B.; Walseth, T.F.; Sorenson, R.L.; Robertson, R.P. Morphological and functional characterization of beta TC-6 cells--an insulin-secreting cell line derived from transgenic mice. Diabetes 1995, 44, 306–313. [Google Scholar] [CrossRef] [PubMed]
- Lovat, P.E.; Corazzari, M.; Armstrong, J.L.; Martin, S.; Pagliarini, V.; Hill, D.; Brown, A.M.; Piacentini, M.; Birch-Machin, M.A.; Redfern, C.P. Increasing melanoma cell death using inhibitors of protein disulfide isomerases to abrogate survival responses to endoplasmic reticulum stress. Cancer Res. 2008, 68, 5363–5369. [Google Scholar] [CrossRef] [PubMed]
- Borrello, M.T.; Martin, M.B.; Pin, C.L. The unfolded protein response: An emerging therapeutic target for pancreatitis and pancreatic ductal adenocarcinoma. Pancreatology 2022, 22, 148–159. [Google Scholar] [CrossRef]
- Beriault, D.R.; Werstuck, G.H. Detection and quantification of endoplasmic reticulum stress in living cells using the fluorescent compound, Thioflavin, T. Biochim. Biophys. Acta 2013, 1833, 2293–2301. [Google Scholar] [CrossRef]
- Jin, L.; Liu, C.; Zhang, N.; Zhang, R.; Yan, M.; Bhunia, A.; Zhang, Q.; Liu, M.; Han, J.; Siebert, H.-C. Attenuation of Human Lysozyme Amyloid Fibrillation by ACE Inhibitor Captopril: A Combined Spectroscopy, Microscopy, Cytotoxicity, and Docking Study. Biomacromolecules 2021, 22, 1910–1920. [Google Scholar] [CrossRef]
- Kar, R.K.; Gazova, Z.; Bednarikova, Z.; Mroue, K.H.; Ghosh, A.; Zhang, R.; Ulicna, K.; Siebert, H.-C.; Nifantiev, N.E.; Bhunia, A. Evidence for Inhibition of Lysozyme Amyloid Fibrillization by Peptide Fragments from Human Lysozyme: A Combined Spectroscopy, Microscopy, and Docking Study. Biomacromolecules 2016, 17, 1998–2009. [Google Scholar] [CrossRef]
- Sharma, N.K.; Das, S.K.; Mondal, A.K.; Hackney, O.G.; Chu, W.S.; Kern, P.A.; Rasouli, N.; Spencer, H.J.; Yao-Borengasser, A.; Elbein, S.C. Endoplasmic reticulum stress markers are associated with obesity in nondiabetic subjects. J. Clin. Endocrinol. Metab. 2008, 93, 4532–4541. [Google Scholar] [CrossRef]
- Cnop, M.; Foufelle, F.; Velloso, L.A. Endoplasmic reticulum stress, obesity and diabetes. Trends Mol. Med. 2012, 18, 59–68. [Google Scholar] [CrossRef]
- Kawasaki, N.; Asada, R.; Saito, A.; Kanemoto, S.; Imaizumi, K. Obesity-induced endoplasmic reticulum stress causes chronic inflammation in adipose tissue. Sci. Rep. 2012, 2, 799. [Google Scholar] [CrossRef]
- Ferraz-Bannitz, R.; Welendorf, C.R.; Coelho, P.O.; Salgado, W.; Nonino, C.B.; Beraldo, R.A.; Foss-Freitas, M.C. Bariatric surgery can acutely modulate ER-stress and inflammation on subcutaneous adipose tissue in non-diabetic patients with obesity. Diabetol. Metab. Syndr. 2021, 13, 19. [Google Scholar] [CrossRef]
- Auffret, J.; Freemark, M.; Carré, N.; Mathieu, Y.; Tourrel-Cuzin, C.; Lombès, M.; Movassat, J.; Binart, N. Defective prolactin signaling impairs pancreatic β-cell development during the perinatal period. Am. J. Physiol. Endocrinol. Metab. 2013, 305, E1309–E1318. [Google Scholar] [CrossRef] [PubMed]
- Shrivastava, V.; Lee, M.; Lee, D.; Pretorius, M.; Radford, B.; Makkar, G.; Huang, C. Beta cell adaptation to pregnancy requires prolactin action on both beta and non-beta cells. Sci. Rep. 2021, 11, 10372. [Google Scholar] [CrossRef] [PubMed]
- Brelje, T.C.; Bhagroo, N.V.; Stout, L.E.; Sorenson, R.L. Prolactin and oleic acid synergistically stimulate β-cell proliferation and growth in rat islets. Islets 2017, 9, e1330234. [Google Scholar] [CrossRef]
- Grattan, D.R.; Jasoni, C.L.; Liu, X.; Anderson, G.M.; Herbison, A.E. Prolactin regulation of gonadotropin-releasing hormone neurons to suppress luteinizing hormone secretion in mice. Endocrinology 2007, 148, 4344–4351. [Google Scholar] [CrossRef] [PubMed]
- Fu, Z.; Zou, F.; Deng, H.; Zhou, H.; Liu, L. Estrogen protects SGC7901 cells from endoplasmic reticulum stress-induced apoptosis by the Akt pathway. Oncol. Lett. 2014, 7, 560–564. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.S.; Sun, Z.; Ma, J.; Cui, W.; Gao, B.; Zhang, H.Y.; Han, Y.H.; Hu, H.M.; Wang, L.; Fan, J.; et al. 17β-Estradiol inhibits ER stress-induced apoptosis through promotion of TFII-I-dependent Grp78 induction in osteoblasts. Lab. Investig. 2014, 94, 906–916. [Google Scholar] [CrossRef] [PubMed]
- Song, X.; Li, G.; Vaage, J.; Valen, G. Effects of sex, gonadectomy, and oestrogen substitution on ischaemic preconditioning and ischaemia-reperfusion injury in mice. Acta Physiol. Scand. 2003, 177, 459–466. [Google Scholar] [CrossRef] [PubMed]
- Elhage, R.; Arnal, J.F.; Pieraggi, M.T.; Duverger, N.; Fiévet, C.; Faye, J.C.; Bayard, F. 17 beta-estradiol prevents fatty streak formation in apolipoprotein E-deficient mice. Arterioscler. Thromb. Vasc. Biol. 1997, 17, 2679–2684. [Google Scholar] [CrossRef] [PubMed]
- Gérard, C.; Gallez, A.; Dubois, C.; Drion, P.; Delahaut, P.; Quertemont, E.; Noël, A.; Pequeux, C. Accurate Control of 17β-Estradiol Long-Term Release Increases Reliability and Reproducibility of Preclinical Animal Studies. J. Mammary Gland. Biol. Neoplasia 2017, 22, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Ström, J.O.; Theodorsson, A.; Ingberg, E.; Isaksson, I.-M.; Theodorsson, E. Ovariectomy and 17β-estradiol Replacement in Rats and Mice: A Visual Demonstration. J. Vis. Exp. 2012. [Google Scholar] [CrossRef]
- Carter, J.D.; Dula, S.B.; Corbin, K.L.; Wu, R.; Nunemaker, C.S. A Practical Guide to Rodent Islet Isolation and Assessment. Biol. Proced. Online 2009, 11, 3–31. [Google Scholar] [CrossRef]
- Stull, N.D.; Breite, A.; McCarthy, R.; Tersey, S.A.; Mirmira, R.G. Mouse Islet of Langerhans Isolation using a Combination of Purified Collagenase and Neutral Protease. J. Vis. Exp. 2012, 64, e4013. [Google Scholar] [CrossRef]
- Dheda, K.; Huggett, J.F.; Bustin, S.A.; Johnson, M.A.; Rook, G.; Zumla, A. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques 2004, 37, 112–114, 116, 118–119. [Google Scholar] [CrossRef]
- Rossetti, C.L.; de Oliveira Costa, H.M.; Barthem, C.S.; da Silva, M.H.; de Carvalho, D.P.; da-Silva, W.S. Sexual dimorphism of liver endoplasmic reticulum stress susceptibility in prepubertal rats and the effect of sex steroid supplementation. Exp. Physiol. 2019, 104, 677–690. [Google Scholar] [CrossRef]
ApoE−/− | ApoE−/−:Ins2+/Akita | ApoE−/−:Ins2+/Akita + 17-Beta Estradiol |
---|---|---|
28.04 ± 0.63 | 25.70 ± 2.11 | 27.50 ± 1.77 |
ApoE−/− | ApoE−/−:Ins2+/Akita | ApoE−/−:Ins2+/Akita Ovx | ApoE−/−:Ins2+/Akita Ovx + 17-Beta Estradiol |
---|---|---|---|
20.94 ± 0.92 | 23.10 ± 2.38 | 23.18 ± 1.77 | 23.16 ± 2.58 |
Target | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|
Mouse Beta actin | GGCACCACACCTTTACAATG | GGGGTGTTGAAGGTCTCAAAC |
Mouse Cyclophilin A | TGTGCCAGGGTGGTGACTTTAC | TGGGAACCGTTTGTGTTTGG |
Mouse Hprt1 | AGATGTCATGAAGGAGATGG | TACAGTAGCTCTTCAGTCTG |
Mouse Grp78 | CTGGGTACATTTGATCTGACTGG | GCATTCTGGTGGCTTTCCAGCCATTC |
Mouse Edem | CTACCTGCGAAGAGGCCG | GTTCATGAGCTGCCCACTGA |
Mouse Pdia1 | CAAGATCAAGCCCCACCTGAT | AGTTCCCCCCAACCAGTACTT |
Mouse Pdia3 | GATGGAATTGTCAGCCACTTG | GGTGTGTGCAAATCGGTAGTT |
Mouse Pdia4 | AGCTCCTTGGCAGCTTTCTC | TGCAGACATTATTTTGGTGGA |
Mouse Pdia6 | CTAGCAGTCAGCGGTCTGTAT | CACAGGCCGTCACTCTGAAT |
Mouse Atf4 | ATGGCCGGCTATGGATGAT | CGAAGTCAAACTCTTTCAGATCCATT |
Mouse Gadd153/Chop | TATCTCATCCCCAGGAAACG | CTGCTCCTTCTCCTTCATGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
De Paoli, M.; Shah, D.; Zakharia, A.; Patel, Z.; Patel, Z.; Pakhi, P.; Werstuck, G.H. Investigating the Role of 17-Beta Estradiol in the Regulation of the Unfolded Protein Response (UPR) in Pancreatic Beta Cells. Int. J. Mol. Sci. 2024, 25, 1816. https://doi.org/10.3390/ijms25031816
De Paoli M, Shah D, Zakharia A, Patel Z, Patel Z, Pakhi P, Werstuck GH. Investigating the Role of 17-Beta Estradiol in the Regulation of the Unfolded Protein Response (UPR) in Pancreatic Beta Cells. International Journal of Molecular Sciences. 2024; 25(3):1816. https://doi.org/10.3390/ijms25031816
Chicago/Turabian StyleDe Paoli, Monica, Deep Shah, Alexander Zakharia, Zil Patel, Zinal Patel, Pakhi Pakhi, and Geoff H. Werstuck. 2024. "Investigating the Role of 17-Beta Estradiol in the Regulation of the Unfolded Protein Response (UPR) in Pancreatic Beta Cells" International Journal of Molecular Sciences 25, no. 3: 1816. https://doi.org/10.3390/ijms25031816