TGF-β1 Signaling Impairs Metformin Action on Glycemic Control
Abstract
:1. Introduction
2. Results
2.1. TGFβ1 Signaling Promotes AMPK Phosphorylation at Serine 485
2.2. TGFβ1 Signaling Impairs Metformin-Induced AMPK Activation
2.3. TGFβ1 Impairs Metformin Action on Suppressing HGP in Primary Hepatocytes
2.4. TGF-β1 Impairs Metformin Suppression of Gluconeogenic Gene Expression in Primary Hepatocytes
2.5. Hepatic TGF-β1 Deficiency Improves Metformin Sensitivity for Suppressing HGP
2.6. Hepatic TGF-β1 or Foxo1 Deficiency Restored Metformin Sensitivity in Diabetic Mice
2.7. Pharmacological Inhibition of TGF-β1 Signaling Enhances Metformin Suppression of HGP in Primary Hepatocytes
2.8. Pharmacological Inhibition of TGF-β1 Signaling Improves Metformin Sensitivity
3. Discussion
4. Materials and Methods
4.1. Animal Experiments
4.2. Primary Hepatocytes Isolation and Culturing
4.3. HGP Assay
4.4. Western Blotting
4.5. Quantitative Real-Time PCR
4.6. Metformin Tolerance Test (MTT)
4.7. HFD Treatment and LY2157299 Administration
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Khan, M.A.B.; Hashim, M.J.; King, J.K.; Govender, R.D.; Mustafa, H.; Al Kaabi, J. Epidemiology of type 2 diabetes–global burden of disease and forecasted trends. J. Epidemiol. Glob. Health 2020, 10, 107–111. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Ley, S.H.; Hu, F.B. Global aetiology and epidemiology of type 2 diabetes mellitus and its complications. Nat. Rev. Endocrinol. 2018, 14, 88–98. [Google Scholar] [CrossRef]
- Kahn, S.E.; Cooper, M.E.; Del Prato, S. Pathophysiology and treatment of type 2 diabetes: Perspectives on the past, present, and future. Lancet 2014, 383, 1068–1083. [Google Scholar] [CrossRef]
- Ekberg, K.; Landau, B.R.; Wajngot, A.; Chandramouli, V.; Efendic, S.; Brunengraber, H.; Wahren, J. Contributions by kidney and liver to glucose production in the postabsorptive state and after 60 h of fasting. Diabetes 1999, 48, 292–298. [Google Scholar] [CrossRef] [PubMed]
- Petersen, M.C.; Vatner, D.F.; Shulman, G.I. Regulation of hepatic glucose metabolism in health and disease. Nat. Rev. Endocrinol. 2017, 13, 572–587. [Google Scholar] [CrossRef] [PubMed]
- Rena, G.; Hardie, D.G.; Pearson, E.R. The mechanisms of action of metformin. Diabetologia 2017, 60, 1577–1585. [Google Scholar] [CrossRef]
- Guo, X.; Li, X.; Yang, W.; Liao, W.; Shen, J.Z.; Ai, W.; Pan, Q.; Sun, Y.; Zhang, K.; Zhang, R.; et al. Metformin targets foxo1 to control glucose homeostasis. Biomolecules 2021, 11, 873. [Google Scholar] [CrossRef]
- Habegger, K.M.; Hoffman, N.J.; Ridenour, C.M.; Brozinick, J.T.; Elmendorf, J.S. AMPK enhances insulin-stimulated GLUT4 regulation via lowering membrane cholesterol. Endocrinology 2012, 153, 2130–2141. [Google Scholar] [CrossRef]
- Herman, R.; Kravos, N.A.; Jensterle, M.; Janež, A.; Dolžan, V. Metformin and Insulin Resistance: A Review of the Underlying Mechanisms behind Changes in GLUT4-Mediated Glucose Transport. Int. J. Mol. Sci. 2022, 23, 1264. [Google Scholar] [CrossRef]
- Sharabi, K.; Lin, H.; Tavares, C.D.; Dominy, J.E.; Camporez, J.P.; Perry, R.J.; Schilling, R.; Rines, A.K.; Lee, J.; Hickey, M.; et al. Selective chemical inhibition of pgc-1α gluconeogenic activity ameliorates type 2 diabetes. Cell 2017, 169, 148–160.e15. [Google Scholar] [CrossRef]
- Kim, K.K.; Sheppard, D.; Chapman, H.A. TGF-β1 Signaling and Tissue Fibrosis. Cold Spring Harb. Perspect. Biol. 2018, 10, a022293. [Google Scholar] [CrossRef] [PubMed]
- Morikawa, M.; Derynck, R.; Miyazono, K. TGF-β and the TGF-β Family: Context-Dependent Roles in Cell and Tissue Physiology. Cold Spring Harb. Perspect. Biol. 2016, 8, a021873. [Google Scholar] [CrossRef] [PubMed]
- Pan, Q.; Gao, M.; Kim, D.; Ai, W.; Yang, W.; Jiang, W.; Brashear, W.; Dai, Y.; Li, S.; Sun, Y.; et al. Hepatocyte FoxO1 Deficiency Protects From Liver Fibrosis via Reducing Inflammation and TGF-β1-mediated HSC Activation. Cell. Mol. Gastroenterol. Hepatol. 2024, 17, 41–58. [Google Scholar] [CrossRef]
- Yadav, H.; Quijano, C.; Kamaraju, A.K.; Gavrilova, O.; Malek, R.; Chen, W.; Zerfas, P.; Zhigang, D.; Wright, E.C.; Stuelten, C.; et al. Protection from obesity and diabetes by blockade of TGF-beta/Smad3 signaling. Cell Metab. 2011, 14, 67–79. [Google Scholar] [CrossRef] [PubMed]
- Tan, C.K.; Leuenberger, N.; Tan, M.J.; Yan, Y.W.; Chen, Y.; Kambadur, R.; Wahli, W.; Tan, N.S. Smad3 deficiency in mice protects against insulin resistance and obesity induced by a high-fat diet. Diabetes 2011, 60, 464–476. [Google Scholar] [CrossRef]
- Yadav, H.; Devalaraja, S.; Chung, S.T.; Rane, S.G. TGF-beta1/Smad3 Pathway Targets PP2A-AMPK-FoxO1 Signaling to Regulate Hepatic Gluconeogenesis. J. Biol. Chem. 2017, 292, 3420–3432. [Google Scholar] [CrossRef]
- Pan, Q.; Ai, W.; Chen, Y.; Kim, D.M.; Shen, Z.; Yang, W.; Jiang, W.; Sun, Y.; Safe, S.; Guo, S. Reciprocal regulation of hepatic TGF-β1 and Foxo1 controls gluconeogenesis and energy expenditure. Diabetes 2023, 72, 1193–1206. [Google Scholar] [CrossRef]
- Xiao, Y.; Wang, Y.; Ryu, J.; Liu, W.; Zou, H.; Zhang, R.; Yan, Y.; Dai, Z.; Zhang, D.; Sun, L.-Z.; et al. Upregulated TGF-β1 contributes to hyperglycaemia in type 2 diabetes by potentiating glucagon signalling. Diabetologia 2023, 66, 1142–1155. [Google Scholar] [CrossRef]
- He, L.; Chang, E.; Peng, J.; An, H.; McMillin, S.M.; Radovick, S.; Stratakis, C.A.; Wondisford, F.E. Activation of the cAMP-PKA pathway antagonizes metformin suppression of hepatic glucose production. J. Biol. Chem. 2016, 291, 10562–10570. [Google Scholar] [CrossRef]
- Jiang, P.; Ren, L.; Zhi, L.; Yu, Z.; Lv, F.; Xu, F.; Peng, W.; Bai, X.; Cheng, K.; Quan, L.; et al. Negative regulation of AMPK signaling by high glucose via E3 ubiquitin ligase MG53. Mol. Cell 2021, 81, 629–637.e5. [Google Scholar] [CrossRef]
- Giannarelli, R.; Aragona, M.; Coppelli, A.; Del Prato, S. Reducing insulin resistance with metformin: The evidence today. Diabetes Metab. 2003, 29, 6S28–6S35. [Google Scholar] [CrossRef] [PubMed]
- Dong, X.C.; Copps, K.D.; Guo, S.; Li, Y.; Kollipara, R.; DePinho, R.A.; White, M.F. Inactivation of hepatic foxo1 by insulin signaling is required for adaptive nutrient homeostasis and endocrine growth regulation. Cell Metab. 2008, 8, 65–76. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Z.; Guo, S.; Copps, K.; Dong, X.; Kollipara, R.; Rodgers, J.T.; DePinho, R.A.; Puigserver, P.; White, M.F. Foxo1 integrates insulin signaling with mitochondrial function in the liver. Nat. Med. 2009, 15, 1307–1311. [Google Scholar] [CrossRef] [PubMed]
- Tao, R.; Wang, C.; Stöhr, O.; Qiu, W.; Hu, Y.; Miao, J.; Dong, X.C.; Leng, S.; Stefater, M.; Stylopoulos, N.; et al. Inactivating hepatic follistatin alleviates hyperglycemia. Nat. Med. 2018, 24, 1058–1069. [Google Scholar] [CrossRef]
- Chen, Y.; Pan, Q.; Liao, W.; Ai, W.; Yang, S.; Guo, S. Transcription factor Foxo1 mediates TGF-β1-induced apoptosis in hepatocytes. Am. J. Pathol. 2023, 193, 1143–1155. [Google Scholar] [CrossRef]
- Nasri, H.; Rafieian-Kopaei, M. Metformin: Current knowledge. J. Res. Med. Sci. 2014, 19, 658–664. [Google Scholar] [PubMed]
- Salber, G.J.; Wang, Y.-B.; Lynch, J.T.; Pasquale, K.M.; Rajan, T.V.; Stevens, R.G.; Grady, J.J.; Kenny, A.M. Metformin Use in Practice: Compliance With Guidelines for Patients With Diabetes and Preserved Renal Function. Clin. Diabetes 2017, 35, 154–161. [Google Scholar] [CrossRef]
- Kooy, A.; de Jager, J.; Lehert, P.; Bets, D.; Wulffelé, M.G.; Donker, A.J.M.; Stehouwer, C.D.A. Long-term effects of metformin on metabolism and microvascular and macrovascular disease in patients with Type 2 diabetes mellitus. JAMA Intern. Med. 2009, 169, 616–625. [Google Scholar] [CrossRef]
- Foretz, M.; Guigas, B.; Bertrand, L.; Pollak, M.; Viollet, B. Metformin: From mechanisms of action to therapies. Cell Metab. 2014, 20, 953–966. [Google Scholar] [CrossRef]
- Koo, S.-H.; Flechner, L.; Qi, L.; Zhang, X.; Screaton, R.A.; Jeffries, S.; Hedrick, S.; Xu, W.; Boussouar, F.; Brindle, P.; et al. The CREB coactivator TORC2 is a key regulator of fasting glucose metabolism. Nature 2005, 437, 1109–1114. [Google Scholar] [CrossRef]
- Patel, K.; Foretz, M.; Marion, A.; Campbell, D.G.; Gourlay, R.; Boudaba, N.; Tournier, E.; Titchenell, P.; Peggie, M.; Deak, M.; et al. The LKB1-salt-inducible kinase pathway functions as a key gluconeogenic suppressor in the liver. Nat. Commun. 2014, 5, 4535. [Google Scholar] [CrossRef]
- Johanns, M.; Lai, Y.-C.; Hsu, M.-F.; Jacobs, R.; Vertommen, D.; Van Sande, J.; Dumont, J.E.; Woods, A.; Carling, D.; Hue, L.; et al. AMPK antagonizes hepatic glucagon-stimulated cyclic AMP signalling via phosphorylation-induced activation of cyclic nucleotide phosphodiesterase 4B. Nat. Commun. 2016, 7, 10856. [Google Scholar] [CrossRef] [PubMed]
- Foretz, M.; Hébrard, S.; Leclerc, J.; Zarrinpashneh, E.; Soty, M.; Mithieux, G.; Sakamoto, K.; Andreelli, F.; Viollet, B. Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state. J. Clin. Investig. 2010, 120, 2355–2369. [Google Scholar] [CrossRef] [PubMed]
- Miller, R.A.; Chu, Q.; Xie, J.; Foretz, M.; Viollet, B.; Birnbaum, M.J. Biguanides suppress hepatic glucagon signalling by decreasing production of cyclic AMP. Nature 2013, 494, 256–260. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Pan, Q.; Yan, H.; Zhang, K.; Guo, X.; Xu, Z.; Yang, W.; Qi, Y.; Guo, C.A.; Hornsby, C.; et al. Novel Mechanism of Foxo1 Phosphorylation in Glucagon Signaling in Control of Glucose Homeostasis. Diabetes 2018, 67, 2167–2182. [Google Scholar] [CrossRef]
- Kulkarni, J.A.; Witzigmann, D.; Thomson, S.B.; Chen, S.; Leavitt, B.R.; Cullis, P.R.; van der Meel, R. The current landscape of nucleic acid therapeutics. Nat. Nanotechnol. 2021, 16, 630–643. [Google Scholar] [CrossRef] [PubMed]
- Kattenhorn, L.M.; Tipper, C.H.; Stoica, L.; Geraghty, D.S.; Wright, T.L.; Clark, K.R.; Wadsworth, S.C. Adeno-associated virus gene therapy for liver disease. Hum. Gene Ther. 2016, 27, 947–961. [Google Scholar] [CrossRef] [PubMed]
- Naso, M.F.; Tomkowicz, B.; Perry, W.L., 3rd; Strohl, W.R. Adeno-associated virus (AAV) as a vector for gene therapy. BioDrugs 2017, 31, 317–334. [Google Scholar] [CrossRef]
- Böhm, A.; Hoffmann, C.; Irmler, M.; Schneeweiss, P.; Schnauder, G.; Sailer, C.; Schmid, V.; Hudemann, J.; Machann, J.; Schick, F.; et al. TGF-β contributes to impaired exercise response by suppression of mitochondrial key regulators in skeletal muscle. Diabetes 2016, 65, 2849–2861. [Google Scholar] [CrossRef]
- Rosmond, R.; Chagnon, M.; Bouchard, C.; Björntorp, P. Increased abdominal obesity, insulin and glucose levels in nondiabetic subjects with a T29C polymorphism of the transforming growth factor-β1 gene. Horm. Res. Paediatr. 2003, 59, 191–194. [Google Scholar] [CrossRef]
- El-Sherbini, S.M.; Shahen, S.M.; Mosaad, Y.M.; Abdelgawad, M.S.; Talaat, R.M. Gene polymorphism of transforming growth factor-β1 in Egyptian patients with type 2 diabetes and diabetic nephropathy. Acta Biochim. Biophys. Sin. 2013, 45, 330–338. [Google Scholar] [CrossRef]
- Raina, P.; Sikka, R.; Kaur, R.; Sokhi, J.; Matharoo, K.; Singh, V.; Bhanwer, A. Association of transforming growth factor beta-1 (TGF-β1) genetic variation with type 2 diabetes and end stage renal disease in two large population samples from North India. OMICS J. Integr. Biol. 2015, 19, 306–317. [Google Scholar] [CrossRef]
- Grainger, D.J.; Heathcote, K.; Chiano, M.; Snieder, H.; Kemp, P.R.; Metcalfe, J.C.; Carter, N.D.; Specter, T.D. Genetic control of the circulating concentration of transforming growth factor type β1. Hum. Mol. Genet. 1999, 8, 93–97. [Google Scholar] [CrossRef] [PubMed]
- Susianti, H.; Handono, K.; Purnomo, B.B.; Widodo, N.; Gunawan, A.; Kalim, H. Changes to signal peptide and the level of transforming growth factor-β1 due to T869C polymorphism of TGF β1 associated with lupus renal fibrosis. SpringerPlus 2014, 3, 514. [Google Scholar] [CrossRef] [PubMed]
- Xiao, H.; Zhang, J.; Xu, Z.; Feng, Y.; Zhang, M.; Liu, J.; Chen, R.; Shen, J.; Wu, J.; Lu, Z.; et al. Metformin is a novel suppressor for transforming growth factor (TGF)-β1. Sci. Rep. 2016, 6, 28597. [Google Scholar] [CrossRef]
- Liang, D.; Song, Z.; Liang, W.; Li, Y.; Liu, S. Metformin inhibits TGF-beta 1-induced MCP-1 expression through BAMBI-mediated suppression of MEK/ERK1/2 signalling. Nephrology 2019, 24, 481–488. [Google Scholar] [CrossRef] [PubMed]
- Rojas, A.; Padidam, M.; Cress, D.; Grady, W.M. TGF-beta receptor levels regulate the specificity of signaling pathway activation and biological effects of TGF-beta. Biochim. Biophys. Acta Mol. Cell Res. 2009, 1793, 1165–1173. [Google Scholar] [CrossRef] [PubMed]
- Luo, T.; Nocon, A.; Fry, J.; Sherban, A.; Rui, X.; Jiang, B.; Xu, X.J.; Han, J.; Yan, Y.; Yang, Q.; et al. AMPK activation by metformin suppresses abnormal extracellular matrix remodeling in adipose tissue and ameliorates insulin resistance in obesity. Diabetes 2016, 65, 2295–2310. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Li, S.; Liu, S.; Zhang, Y.; Shen, D.; Wang, P.; Dang, X. Metformin ameliorates liver fibrosis induced by congestive hepatopathy via the mTOR/HIF-1α signaling pathway. Ann. Hepatol. 2023, 28, 101135. [Google Scholar] [CrossRef] [PubMed]
- Foretz, M.; Guigas, B.; Viollet, B. Metformin: Update on mechanisms of action and repurposing potential. Nat. Rev. Endocrinol. 2023, 19, 460–476. [Google Scholar] [CrossRef]
- Guo, S.; Dunn, S.L.; White, M.F. The Reciprocal stability of FOXO1 and IRS2 creates a regulatory circuit that controls insulin signaling. Mol. Endocrinol. 2006, 20, 3389–3399. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.; Lorenz, B.R.; Zelmanovitz, P.H.; Chan, C.B. Metformin Preserves β-Cell Compensation in Insulin Secretion and Mass Expansion in Prediabetic Nile Rats. Int. J. Mol. Sci. 2021, 22, 421. [Google Scholar] [CrossRef] [PubMed]
- Amin, S.; Cook, B.; Zhou, T.; Ghazizadeh, Z.; Lis, R.; Zhang, T.; Khalaj, M.; Crespo, M.; Perera, M.; Xiang, J.Z.; et al. Discovery of a drug candidate for GLIS3-associated diabetes. Nat. Commun. 2018, 9, 2681. [Google Scholar] [CrossRef] [PubMed]
Antibodies | Source | Identifier |
---|---|---|
pAMK-T172 | Cell Signaling Technology | Cat# 2531 |
pAMK-S485 | Cell Signaling Technology | Cat# 2537 |
AMPK-alpha | Cell Signaling Technology | Cat# 2532 |
pSmad3-S423/425 | Cell Signaling Technology | Cat# 9520 |
Smad3 | Cell Signaling Technology | Cat# 9523 |
GAPDH | Cell Signaling Technology | Cat# 2118s |
β-actin | Cell Signaling Technology | Cat# 4967 |
Genes | Source | Reverse |
---|---|---|
G6pc forward | Integrated DNA Technologies | CATTGTGGCTTCCTTGGTCC |
G6pc reverse | Integrated DNA Technologies | GGCAGTATGGGATAAGACTG |
Pck1 forward | Integrated DNA Technologies | CCATCGGCTACATCCCTAAG |
Pck1 reverse | Integrated DNA Technologies | GACCTGGTCCTCCAGATA |
Smad7 forward | Integrated DNA Technologies | GGCCGGATCTCAGGCATT |
Smad7 reverse | Integrated DNA Technologies | TTGGGTATCTGGAGTAAGGAGG |
Cyclophilin forward | Integrated DNA Technologies | ACTGAATGGCTGGATGGCAAG |
Cyclophilin reverse | Integrated DNA Technologies | TGCCCGCAAGTCAAAAGAAAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pan, Q.; Ai, W.; Guo, S. TGF-β1 Signaling Impairs Metformin Action on Glycemic Control. Int. J. Mol. Sci. 2024, 25, 2424. https://doi.org/10.3390/ijms25042424
Pan Q, Ai W, Guo S. TGF-β1 Signaling Impairs Metformin Action on Glycemic Control. International Journal of Molecular Sciences. 2024; 25(4):2424. https://doi.org/10.3390/ijms25042424
Chicago/Turabian StylePan, Quan, Weiqi Ai, and Shaodong Guo. 2024. "TGF-β1 Signaling Impairs Metformin Action on Glycemic Control" International Journal of Molecular Sciences 25, no. 4: 2424. https://doi.org/10.3390/ijms25042424