Role of the Fungus Pneumocystis in IL1β Pathway Activation and Airways Collagen Deposition in Elastase-Induced COPD Animals
Abstract
:1. Introduction
2. Results
2.1. Pneumocystis Status in an Elastase-Induced COPD Rat Model
2.2. The Increment of Inflammatory Cuffs in the Presence of Pneumocystis Is Not Potentiated in the Elastase-Induced COPD Rat Model
2.3. Pneumocystis Increases Inflammatory Markers Associated with the IL1β Pathway in an Elastase-Induced COPD Rat Model
2.4. Pneumocystis Increases Mucus Secretion in the Airway Epithelium of Elastase-Induced COPD Rats by Induction of the IL1β Pathway
2.5. Pneumocystis Increases Collagen Deposition around the Airways in an Elastase-Induced COPD Rat Model
3. Discussion
4. Materials and Methods
4.1. Ethics
4.2. Elastase-Induced COPD Animal Model and Pneumocystis Infection
4.3. Pneumocystis Rapid Purification and Cysts Quantification
4.4. Detection of Pneumocystis Burden
4.5. Histology
4.6. Gene Expression Determinations
4.7. Protein Extractions
4.8. Western Blotting Determinations
4.9. Chromatin Immunoprecipitation (ChIP)
4.10. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kim, V.; Criner, G.J. Chronic Bronchitis and Chronic Obstructive Pulmonary Disease. Am. J. Respir. Crit. Care Med. 2013, 187, 228–237. [Google Scholar] [CrossRef]
- Christenson, S.A.; Smith, B.M.; Bafadhel, M.; Putcha, N. Chronic Obstructive Pulmonary Disease. Lancet 2022, 399, 2227–2242. [Google Scholar] [CrossRef]
- Mio, T.; Romberger, D.J.; Thompson, A.B.; Robbins, R.A.; Heires, A.; Rennard, S.I. Cigarette Smoke Induces Interleukin-8 Release from Human Bronchial Epithelial Cells. Am. J. Respir. Crit. Care Med. 1997, 155, 1770–1776. [Google Scholar] [CrossRef] [PubMed]
- Retamales, I.; Elliott, W.M.; Meshi, B.; Coxson, H.O.; Pare, P.D.; Sciurba, F.C.; Rogers, R.M.; Hayashi, S.; Hogg, J.C. Amplification of Inflammation in Emphysema and Its Association with Latent Adenoviral Infection. Am. J. Respir. Crit. Care Med. 2001, 164, 469–473. [Google Scholar] [CrossRef]
- Hellermann, G.R.; Nagy, S.B.; Kong, X.; Lockey, R.F.; Mohapatra, S.S. Mechanism of Cigarette Smoke Condensate-Induced Acute Inflammatory Response in Human Bronchial Epithelial Cells. Respir. Res. 2002, 3, 15. [Google Scholar] [CrossRef]
- Barnes, P.J. The Cytokine Network in Asthma and Chronic Obstructive Pulmonary Disease. J. Clin. Investig. 2008, 118, 3546–3556. [Google Scholar] [CrossRef]
- Kuschner, W.; D’Alessandro, A.; Wong, H.; Blanc, P. Dose-Dependent Cigarette Smoking-Related Inflammatory Responses in Healthy Adults. Eur. Respir. J. 1996, 9, 1989–1994. [Google Scholar] [CrossRef]
- Keatings, V.M.; Collins, P.D.; Scott, D.M.; Barnes, P.J. Differences in Interleukin-8 and Tumor Necrosis Factor-Alpha in Induced Sputum from Patients with Chronic Obstructive Pulmonary Disease or Asthma. Am. J. Respir. Crit. Care Med. 1996, 153, 530–534. [Google Scholar] [CrossRef] [PubMed]
- Pauwels, N.S.; Bracke, K.R.; Dupont, L.L.; Van Pottelberge, G.R.; Provoost, S.; Vanden Berghe, T.; Vandenabeele, P.; Lambrecht, B.N.; Joos, G.F.; Brusselle, G.G. Role of IL-1 and the Nlrp3/Caspase-1/IL-1 Axis in Cigarette Smoke-Induced Pulmonary Inflammation and COPD. Eur. Respir. J. 2011, 38, 1019–1028. [Google Scholar] [CrossRef]
- Damera, G.; Pham, T.-H.; Zhang, J.; Ward, C.K.; Newbold, P.; Ranade, K.; Sethi, S. A Sputum Proteomic Signature That Associates with Increased IL-1β Levels and Bacterial Exacerbations of COPD. Lung 2016, 194, 363–369. [Google Scholar] [CrossRef] [PubMed]
- Botelho, F.M.; Bauer, C.M.T.; Finch, D.; Nikota, J.K.; Zavitz, C.C.J.; Kelly, A.; Lambert, K.N.; Piper, S.; Foster, M.L.; Goldring, J.J.P.; et al. IL-1α/IL-1R1 Expression in Chronic Obstructive Pulmonary Disease and Mechanistic Relevance to Smoke-Induced Neutrophilia in Mice. PLoS ONE 2011, 6, e28457. [Google Scholar] [CrossRef]
- Carnevali, S.; Petruzzelli, S.; Longoni, B.; Vanacore, R.; Barale, R.; Cipollini, M.; Scatena, F.; Paggiaro, P.; Celi, A.; Giuntini, C. Cigarette Smoke Extract Induces Oxidative Stress and Apoptosis in Human Lung Fibroblasts. Am. J. Physiol. Lung Cell. Mol. Physiol. 2003, 284, L955–L963. [Google Scholar] [CrossRef]
- Barnes, P.J. Oxidative Stress in Chronic Obstructive Pulmonary Disease. Antioxidants 2022, 11, 965. [Google Scholar] [CrossRef]
- Barnes, P.J. Small Airway Fibrosis in COPD. Int. J. Biochem. Cell Biol. 2019, 116, 105598. [Google Scholar] [CrossRef]
- Milara, J.; Peiró, T.; Serrano, A.; Cortijo, J. Epithelial to Mesenchymal Transition Is Increased in Patients with COPD and Induced by Cigarette Smoke. Thorax 2013, 68, 410–420. [Google Scholar] [CrossRef]
- Christopoulou, M.-E.; Papakonstantinou, E.; Stolz, D. Matrix Metalloproteinases in Chronic Obstructive Pulmonary Disease. Int. J. Mol. Sci. 2023, 24, 3786. [Google Scholar] [CrossRef]
- Takizawa, H.; Tanaka, M.; Takami, K.; Ohtoshi, T.; Ito, K.; Satoh, M.; Okada, Y.; Yamasawa, F.; Nakahara, K.; Umeda, A. Increased Expression of Transforming Growth Factor- β 1 in Small Airway Epithelium from Tobacco Smokers and Patients with Chronic Obstructive Pulmonary Disease (COPD). Am. J. Respir. Crit. Care Med. 2001, 163, 1476–1483. [Google Scholar] [CrossRef] [PubMed]
- Gohy, S.T.; Hupin, C.; Fregimilicka, C.; Detry, B.R.; Bouzin, C.; Gaide Chevronay, H.; Lecocq, M.; Weynand, B.; Ladjemi, M.Z.; Pierreux, C.E.; et al. Imprinting of the COPD Airway Epithelium for Dedifferentiation and Mesenchymal Transition. Eur. Respir. J. 2015, 45, 1258–1272. [Google Scholar] [CrossRef] [PubMed]
- Chalmers, G.; Macleod, K.; Sriram, S.; Thomson, L.; McSharry, C.; Stack, B.; Thomson, N. Sputum Endothelin-1 Is Increased in Cystic Fibrosis and Chronic Obstructive Pulmonary Disease. Eur. Respir. J. 1999, 13, 1288–1292. [Google Scholar] [CrossRef] [PubMed]
- Tschumperlin, D.J.; Shively, J.D.; Kikuchi, T.; Drazen, J.M. Mechanical Stress Triggers Selective Release of Fibrotic Mediators from Bronchial Epithelium. Am. J. Respir. Cell Mol. Biol. 2003, 28, 142–149. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.; Cissé, O.H.; Kovacs, J.A. A Molecular Window into the Biology and Epidemiology of Pneumocystis spp. Clin. Microbiol. Rev. 2018, 31, e00009-18. [Google Scholar] [CrossRef]
- Fleischman, J.K.; Greenberg, H.; Web, A. Small Airways Dysfunction in Patients with AIDS and Pneumocystis Carinii Pneumonia. AIDS Patient Care STDs 1996, 10, 16–20. [Google Scholar] [CrossRef]
- Vargas, S.L.; Ponce, C.A.; Gallo, M.; Pérez, F.; Astorga, J.-F.; Bustamante, R.; Chabé, M.; Durand-Joly, I.; Iturra, P.; Miller, R.F.; et al. Near-Universal Prevalence of Pneumocystis and Associated Increase in Mucus in the Lungs of Infants with Sudden Unexpected Death. Clin. Infect. Dis. 2013, 56, 171–179. [Google Scholar] [CrossRef]
- Ibrahim, A.; Chattaraj, A.; Iqbal, Q.; Anjum, A.; Rehman, M.E.U.; Aijaz, Z.; Nasir, F.; Ansar, S.; Zangeneh, T.T.; Iftikhar, A. Pneumocystis Jiroveci Pneumonia: A Review of Management in Human Immunodeficiency Virus (HIV) and Non-HIV Immunocompromised Patients. Avicenna J. Med. 2023, 13, 023–034. [Google Scholar] [CrossRef]
- Eddens, T.; Campfield, B.T.; Serody, K.; Manni, M.L.; Horne, W.; Elsegeiny, W.; McHugh, K.J.; Pociask, D.; Chen, K.; Zheng, M.; et al. A Novel CD4 + T Cell–Dependent Murine Model of Pneumocystis -Driven Asthma-like Pathology. Am. J. Respir. Crit. Care Med. 2016, 194, 807–820. [Google Scholar] [CrossRef]
- Iturra, P.A.; Rojas, D.A.; Pérez, F.J.; Méndez, A.; Ponce, C.A.; Bonilla, P.; Bustamante, R.; Rodríguez, H.; Beltrán, C.J.; Vargas, S.L. Progression of Type 2 Helper T Cell–Type Inflammation and Airway Remodeling in a Rodent Model of Naturally Acquired Subclinical Primary Pneumocystis Infection. Am. J. Pathol. 2018, 188, 417–431. [Google Scholar] [CrossRef]
- Méndez, A.; Rojas, D.A.; Ponce, C.A.; Bustamante, R.; Beltrán, C.J.; Toledo, J.; García-Angulo, V.A.; Henriquez, M.; Vargas, S.L. Primary Infection by Pneumocystis Induces Notch-Independent Clara Cell Mucin Production in Rat Distal Airways. PLoS ONE 2019, 14, e0217684. [Google Scholar] [CrossRef]
- Rojas, D.A.; Iturra, P.A.; Méndez, A.; Ponce, C.A.; Bustamante, R.; Gallo, M.; Bórquez, P.; Vargas, S.L. Increase in Secreted Airway Mucins and Partial Muc5b STAT6/FoxA2 Regulation during Pneumocystis Primary Infection. Sci. Rep. 2019, 9, 2078. [Google Scholar] [CrossRef]
- Perez-Nazario, N.; Rangel-Moreno, J.; O’Reilly, M.A.; Pasparakis, M.; Gigliotti, F.; Wright, T.W. Selective Ablation of Lung Epithelial IKK2 Impairs Pulmonary Th17 Responses and Delays the Clearance of Pneumocystis. J. Immunol. 2013, 191, 4720–4730. [Google Scholar] [CrossRef]
- Morris, A.; Sciurba, F.C.; Lebedeva, I.P.; Githaiga, A.; Elliott, W.M.; Hogg, J.C.; Huang, L.; Norris, K.A. Association of Chronic Obstructive Pulmonary Disease Severity and Pneumocystis Colonization. Am. J. Respir. Crit. Care Med. 2004, 170, 408–413. [Google Scholar] [CrossRef]
- Sivam, S.; Sciurba, F.C.; Lucht, L.A.; Zhang, Y.; Duncan, S.R.; Norris, K.A.; Morris, A. Distribution of Pneumocystis Jirovecii in Lungs from Colonized COPD Patients. Diagn. Microbiol. Infect. Dis. 2011, 71, 24–28. [Google Scholar] [CrossRef]
- Khodavaisy, S.; Mortaz, E.; Mohammadi, F.; Aliyali, M.; Fakhim, H.; Badali, H. Pneumocystis Jirovecii Colonization in Chronic Obstructive Pulmonary Disease (COPD). Curr. Med. Mycol. 2015, 1, 42–48. [Google Scholar] [CrossRef]
- Shipley, T.W.; Kling, H.M.; Morris, A.; Patil, S.; Kristoff, J.; Guyach, S.E.; Murphy, J.E.; Shao, X.; Sciurba, F.C.; Rogers, R.M.; et al. Persistent Pneumocystis Colonization Leads to the Development of Chronic Obstructive Pulmonary Disease in a Nonhuman Primate Model of AIDS. J. Infect. Dis. 2010, 202, 302–312. [Google Scholar] [CrossRef]
- Calderon, E.J.; Rivero, L.; Respaldiza, N.; Morilla, R.; Montes-Cano, M.A.; Friaza, V.; Munoz-Lobato, F.; Varela, J.M.; Medrano, F.J.; de la Horra, C. Systemic Inflammation in Patients with Chronic Obstructive Pulmonary Disease Who Are Colonized with Pneumocystis jiroveci. Clin. Infect. Dis. 2007, 45, e17–e19. [Google Scholar] [CrossRef]
- Rojas, D.A.; Ponce, C.A.; Bustos, A.; Cortés, V.; Olivares, D.; Vargas, S.L. Pneumocystis Exacerbates Inflammation and Mucus Hypersecretion in a Murine, Elastase-Induced-COPD Model. JoF 2023, 9, 452. [Google Scholar] [CrossRef]
- Rabacal, W.; Rayens, E. Pneumocystis as a Co-Factor in Pulmonary Diseases. OBM Genet. 2018, 2, 1–18. [Google Scholar] [CrossRef]
- Kolb, M.; Margetts, P.J.; Anthony, D.C.; Pitossi, F.; Gauldie, J. Transient Expression of IL-1β Induces Acute Lung Injury and Chronic Repair Leading to Pulmonary Fibrosis. J. Clin. Investig. 2001, 107, 1529–1536. [Google Scholar] [CrossRef]
- Gasse, P.; Mary, C.; Guenon, I.; Noulin, N.; Charron, S.; Schnyder-Candrian, S.; Schnyder, B.; Akira, S.; Quesniaux, V.F.J.; Lagente, V.; et al. IL-1R1/MyD88 Signaling and the Inflammasome Are Essential in Pulmonary Inflammation and Fibrosis in Mice. J. Clin. Investig. 2007, 117, 3786–3799. [Google Scholar] [CrossRef]
- Wilson, M.S.; Madala, S.K.; Ramalingam, T.R.; Gochuico, B.R.; Rosas, I.O.; Cheever, A.W.; Wynn, T.A. Bleomycin and IL-1β–Mediated Pulmonary Fibrosis Is IL-17A Dependent. J. Exp. Med. 2010, 207, 535–552. [Google Scholar] [CrossRef]
- Ghorani, V.; Boskabady, M.H.; Khazdair, M.R.; Kianmeher, M. Experimental Animal Models for COPD: A Methodological Review. Tob. Induc. Dis. 2017, 15, 25. [Google Scholar] [CrossRef]
- Xue, T.; An, C. Role of Pneumocystis Jirovecii Infection in Chronic Obstructive Pulmonary Disease Progression in an Immunosuppressed Rat Pneumocystis Pneumonia Model. Exp. Ther. Med. 2020, 19, 3133–3142. [Google Scholar] [CrossRef]
- Gantois, N.; Lesaffre, A.; Durand-Joly, I.; Bautin, N.; Le Rouzic, O.; Nseir, S.; Reboux, G.; Scherer, E.; Aliouat, E.M.; Fry, S.; et al. Factors Associated with Pneumocystis Colonization and Circulating Genotypes in Chronic Obstructive Pulmonary Disease Patients with Acute Exacerbation or at Stable State and Their Homes. Med. Mycol. 2021, 60, myab070. [Google Scholar] [CrossRef]
- Fitzpatrick, M.E.; Tedrow, J.R.; Hillenbrand, M.E.; Lucht, L.; Richards, T.; Norris, K.A.; Zhang, Y.; Sciurba, F.C.; Kaminski, N.; Morris, A. Pneumocystis Jirovecii Colonization Is Associated with Enhanced Th1 Inflammatory Gene Expression in Lungs of Humans with Chronic Obstructive Pulmonary Disease: Pneumocystis Colonization and Human COPD. Microbiol. Immunol. 2014, 58, 202–211. [Google Scholar] [CrossRef]
- Swain, S.D.; Meissner, N.N.; Siemsen, D.W.; McInnerney, K.; Harmsen, A.G. Pneumocystis Elicits a STAT6-Dependent, Strain-Specific Innate Immune Response and Airway Hyperresponsiveness. Am. J. Respir. Cell Mol. Biol. 2012, 46, 290–298. [Google Scholar] [CrossRef]
- Yi, G.; Liang, M.; Li, M.; Fang, X.; Liu, J.; Lai, Y.; Chen, J.; Yao, W.; Feng, X.; Hu, L.; et al. A Large Lung Gene Expression Study Identifying IL1B as a Novel Player in Airway Inflammation in COPD Airway Epithelial Cells. Inflamm. Res. 2018, 67, 539–551. [Google Scholar] [CrossRef]
- Zou, Y.; Chen, X.; Liu, J.; Zhou, D.B.; Kuang, X.; Xiao, J.; Yu, Q.; Lu, X.; Li, W.; Xie, B.; et al. Serum IL-1β and IL-17 Levels in Patients with COPD: Associations with Clinical Parameters. COPD 2017, 12, 1247–1254. [Google Scholar] [CrossRef]
- Bafadhel, M.; McKenna, S.; Terry, S.; Mistry, V.; Reid, C.; Haldar, P.; McCormick, M.; Haldar, K.; Kebadze, T.; Duvoix, A.; et al. Acute Exacerbations of Chronic Obstructive Pulmonary Disease: Identification of Biologic Clusters and Their Biomarkers. Am. J. Respir. Crit. Care Med. 2011, 184, 662–671. [Google Scholar] [CrossRef]
- Churg, A.; Zhou, S.; Wang, X.; Wang, R.; Wright, J.L. The Role of Interleukin-1β in Murine Cigarette Smoke–Induced Emphysema and Small Airway Remodeling. Am. J. Respir. Cell Mol. Biol. 2009, 40, 482–490. [Google Scholar] [CrossRef]
- Couillin, I.; Vasseur, V.; Charron, S.; Gasse, P.; Tavernier, M.; Guillet, J.; Lagente, V.; Fick, L.; Jacobs, M.; Coelho, F.R.; et al. IL-1R1/MyD88 Signaling Is Critical for Elastase-Induced Lung Inflammation and Emphysema. J. Immunol. 2009, 183, 8195–8202. [Google Scholar] [CrossRef]
- Lappalainen, U.; Whitsett, J.A.; Wert, S.E.; Tichelaar, J.W.; Bry, K. Interleukin-1β Causes Pulmonary Inflammation, Emphysema, and Airway Remodeling in the Adult Murine Lung. Am. J. Respir. Cell Mol. Biol. 2005, 32, 311–318. [Google Scholar] [CrossRef]
- Zago, M.; Sheridan, J.A.; Traboulsi, H.; Hecht, E.; Zhang, Y.; Guerrina, N.; Matthews, J.; Nair, P.; Eidelman, D.H.; Hamid, Q.; et al. Low Levels of the AhR in Chronic Obstructive Pulmonary Disease (COPD)-Derived Lung Cells Increases COX-2 Protein by Altering mRNA Stability. PLoS ONE 2017, 12, e0180881. [Google Scholar] [CrossRef] [PubMed]
- Roh, G.S.; Yi, C.; Cho, Y.J.; Jeon, B.T.; Nizamudtinova, I.T.; Kim, H.J.; Kim, J.H.; Oh, Y.-M.; Huh, J.W.; Lee, J.-H.; et al. Anti-Inflammatory Effects of Celecoxib in Rat Lungs with Smoke-Induced Emphysema. Am. J. Physiol. Lung Cell. Mol. Physiol. 2010, 299, L184–L191. [Google Scholar] [CrossRef] [PubMed]
- Pérez, F.J.; Iturra, P.A.; Ponce, C.A.; Magne, F.; Garcia-Angulo, V.; Vargas, S.L. Niflumic Acid Reverses Airway Mucus Excess and Improves Survival in the Rat Model of Steroid-Induced Pneumocystis Pneumonia. Front. Microbiol. 2019, 10, 1522. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Sun, L.; Kato, T.; Okuda, K.; Martino, M.B.; Abzhanova, A.; Lin, J.M.; Gilmore, R.C.; Batson, B.D.; O’Neal, Y.K.; et al. IL-1β Dominates the Promucin Secretory Cytokine Profile in Cystic Fibrosis. J. Clin. Investig. 2019, 129, 4433–4450. [Google Scholar] [CrossRef] [PubMed]
- Gray, T.; Coakley, R.; Hirsh, A.; Thornton, D.; Kirkham, S.; Koo, J.-S.; Burch, L.; Boucher, R.; Nettesheim, P. Regulation of MUC5AC Mucin Secretion and Airway Surface Liquid Metabolism by IL-1β in Human Bronchial Epithelia. Am. J. Physiol. Lung Cell. Mol. Physiol. 2004, 286, L320–L330. [Google Scholar] [CrossRef]
- Fujisawa, T.; Velichko, S.; Thai, P.; Hung, L.-Y.; Huang, F.; Wu, R. Regulation of Airway MUC5AC Expression by IL-1β and IL-17A; the NF-κB Paradigm. J. Immunol. 2009, 183, 6236–6243. [Google Scholar] [CrossRef] [PubMed]
- Fujisawa, T.; Chang, M.M.-J.; Velichko, S.; Thai, P.; Hung, L.-Y.; Huang, F.; Phuong, N.; Chen, Y.; Wu, R. NF-κB Mediates IL-1β– and IL-17A–Induced MUC5B Expression in Airway Epithelial Cells. Am. J. Respir. Cell Mol. Biol. 2011, 45, 246–252. [Google Scholar] [CrossRef] [PubMed]
- Sponchiado, M.; Bonilla, A.L.; Mata, L.; Jasso-Johnson, K.; Liao, Y.-S.J.; Fagan, A.; Moncada, V.; Reznikov, L.R. Club Cell CREB Regulates the Goblet Cell Transcriptional Network and Pro-Mucin Effects of IL-1B. Front. Physiol. 2023, 14, 1323865. [Google Scholar] [CrossRef]
- Rajavelu, P.; Chen, G.; Xu, Y.; Kitzmiller, J.A.; Korfhagen, T.R.; Whitsett, J.A. Airway Epithelial SPDEF Integrates Goblet Cell Differentiation and Pulmonary Th2 Inflammation. J. Clin. Investig. 2015, 125, 2021–2031. [Google Scholar] [CrossRef]
- Wu, S.; Li, H.; Yu, L.; Wang, N.; Li, X.; Chen, W. IL-1β Upregulates Muc5ac Expression via NF-κB-Induced HIF-1α in Asthma. Immunol. Lett. 2017, 192, 20–26. [Google Scholar] [CrossRef]
- Trachalaki, A.; Tsitoura, E.; Mastrodimou, S.; Invernizzi, R.; Vasarmidi, E.; Bibaki, E.; Tzanakis, N.; Molyneaux, P.L.; Maher, T.M.; Antoniou, K. Enhanced IL-1β Release Following NLRP3 and AIM2 Inflammasome Stimulation Is Linked to mtROS in Airway Macrophages in Pulmonary Fibrosis. Front. Immunol. 2021, 12, 661811. [Google Scholar] [CrossRef]
- Zhang, W.-J.; Chen, S.-J.; Zhou, S.-C.; Wu, S.-Z.; Wang, H. Inflammasomes and Fibrosis. Front. Immunol. 2021, 12, 643149. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.-Y.; Ito, K.; Hayashi, R.; Jazrawi, E.P.I.; Barnes, P.J.; Adcock, I.M. NF-κB and Activator Protein 1 Response Elements and the Role of Histone Modifications in IL-1β-Induced TGF-Β1 Gene Transcription. J. Immunol. 2006, 176, 603–615. [Google Scholar] [CrossRef] [PubMed]
- Doerner, A.M.; Zuraw, B.L. TGF-Β1 Induced Epithelial to Mesenchymal Transition (EMT) in Human Bronchial Epithelial Cells Is Enhanced by IL-1β but Not Abrogated by Corticosteroids. Respir. Res. 2009, 10, 100. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Gu, N.; Chen, J.; Shi, T.; Zhou, Y.; Rong, Y.; Zhou, T.; Yang, W.; Cui, X.; Chen, W. Neutralization of Interleukin-1 Beta Attenuates Silica-Induced Lung Inflammation and Fibrosis in C57BL/6 Mice. Arch. Toxicol. 2013, 87, 1963–1973. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Stephens, B.; Bergman, M.; May, A.; Chiang, T. Role of Collagen in Airway Mechanics. Bioengineering 2021, 8, 13. [Google Scholar] [CrossRef] [PubMed]
- Miller, R.F.; Daly, K.R.; Walzer, P.D.; Ulloa, A.V.; Ponce, C.A.; Vargas, S.L. Sero-Epidemiology of Pneumocystis Infection among Infants, Children, and Adults in Chile. JoF 2022, 8, 136. [Google Scholar] [CrossRef] [PubMed]
- Goldman, D.L.; Chen, Z.; Shankar, V.; Tyberg, M.; Vicencio, A.; Burk, R. Lower Airway Microbiota and Mycobiota in Children with Severe Asthma. J. Allergy Clin. Immunol. 2018, 141, 808–811.e7. [Google Scholar] [CrossRef]
- Baybutt, R.C.; Molteni, A. Vitamin A and Emphysema. In Vitamins & Hormones; Elsevier: Amsterdam, The Netherlands, 2007; Volume 75, pp. 385–401. ISBN 978-0-12-709875-3. [Google Scholar]
- Cosio, T.; Gaziano, R.; Zuccari, G.; Costanza, G.; Grelli, S.; Di Francesco, P.; Bianchi, L.; Campione, E. Retinoids in Fungal Infections: From Bench to Bedside. Pharmaceuticals 2021, 14, 962. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing Real-Time PCR Data by the Comparative CT Method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
Gene | Sequence (5′—3′) | Size (bp) | |
---|---|---|---|
Dhfr | Forward | GTTGCACTTACAACTTCTTATGG | 223 |
Reverse | TAGATCCAGAGATTCATTTCGAG | ||
Actin | Forward | CTTGCAGCTCCTCCGTCGCC | 228 |
Reverse | CTTGCTCTGGGCCTCGTCGC | ||
Il1b | Forward | AGGCTTCCTTGTGCAAGTGT | 71 |
Reverse | TGTCGAGATGCTGCTGTGAG | ||
Cox-2 | Forward | GATTGACAGCCCACCAACTT | 187 |
Reverse | CGGGATGAACTCTCTCCTCA | ||
Tgfβ1 | Forward | AGGGCTACCATGCCAACTTC | 111 |
Reverse | CCACGTAGTAGACGATGGGC | ||
PMuc5b (CRE) | Forward | GGTGCCGGTATTTGTCTTTG | 325 |
Reverse | TGGGTGACTTCAGTATCATGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Coronado, K.; Herrada, C.; Rojas, D.A. Role of the Fungus Pneumocystis in IL1β Pathway Activation and Airways Collagen Deposition in Elastase-Induced COPD Animals. Int. J. Mol. Sci. 2024, 25, 3150. https://doi.org/10.3390/ijms25063150
Coronado K, Herrada C, Rojas DA. Role of the Fungus Pneumocystis in IL1β Pathway Activation and Airways Collagen Deposition in Elastase-Induced COPD Animals. International Journal of Molecular Sciences. 2024; 25(6):3150. https://doi.org/10.3390/ijms25063150
Chicago/Turabian StyleCoronado, Krishna, Carla Herrada, and Diego A. Rojas. 2024. "Role of the Fungus Pneumocystis in IL1β Pathway Activation and Airways Collagen Deposition in Elastase-Induced COPD Animals" International Journal of Molecular Sciences 25, no. 6: 3150. https://doi.org/10.3390/ijms25063150