Next Article in Journal
Hsp70 Peptides Induce TREM-1-Dependent and TREM-1-Independent Activation of Cytotoxic Lymphocytes
Next Article in Special Issue
Metabolic-Associated Steatotic Liver Disease and FGF21 Dysregulation in Seipin-Deficient and BSCL2-Associated Celia’s Encephalopathy Murine Models
Previous Article in Journal
Mechanistic Insights into Cytokinin-Regulated Leaf Senescence in Barley: Genotype-Specific Responses in Physiology and Protein Stability
Previous Article in Special Issue
Lipodystrophy in HIV: Evolving Challenges and Unresolved Questions
 
 
Case Report
Peer-Review Record

Expansion of the Phenotypic Spectrum of MNGIE: Lipodystrophy and Metabolic Alterations Associated with a p.Arg393_Val400dup TYMP Variant

Int. J. Mol. Sci. 2025, 26(19), 9751; https://doi.org/10.3390/ijms26199751
by Donatella Gilio 1, Caterina Pelosini 2, Silvia Magno 1, Jacopo Maria Venanzi 3, Marta Daniotti 3, Melania Paoli 2, Lavinia Palladino 1, Maria Rita Sessa 2, Franco Ricci 4, Elena Procopio 3, Giovanni Ceccarini 1 and Ferruccio Santini 1,*
Reviewer 1: Anonymous
Reviewer 2: Anonymous
Int. J. Mol. Sci. 2025, 26(19), 9751; https://doi.org/10.3390/ijms26199751
Submission received: 12 August 2025 / Revised: 30 September 2025 / Accepted: 2 October 2025 / Published: 7 October 2025
(This article belongs to the Special Issue Molecular Insights into Lipodystrophy)

Round 1

Reviewer 1 Report

Comments and Suggestions for Authors

In the case report by Donatella Gilio et al., the authors highlight a rare TYMP variant (p.Arg398_Val405dup) presenting with lipodystrophy and metabolic abnormalities rather than the classical gastrointestinal and neurological features, thereby expanding the known phenotypic spectrum of MNGIE. The authors make a clear description of clinical, biochemical, and subclinical neurological findings which adds immense value to the literature. The report underscores the need to include TYMP mutations in the differential diagnosis of atypical lipodystrophy, especially in adolescents with metabolic derangements and suggestive mitochondrial features. The manuscript is well-prepared and could be accepted in its current form. However, it would be further strengthened if the authors could:

  1. Measure thymidine phosphorylase (TP) activity in patient-derived lymphoblastoid cell lines, if feasible.

  2. Assess mitochondrial function using a Seahorse assay and correlate the findings with TP activity levels and clinical manifestations.

Author Response

Comment: In the case report by Donatella Gilio et al., the authors highlight a rare TYMP variant (p.Arg398_Val405dup) presenting with lipodystrophy and metabolic abnormalities rather than the classical gastrointestinal and neurological features, thereby expanding the known phenotypic spectrum of MNGIE. The authors make a clear description of clinical, biochemical, and subclinical neurological findings which adds immense value to the literature. The report underscores the need to include TYMP mutations in the differential diagnosis of atypical lipodystrophy, especially in adolescents with metabolic derangements and suggestive mitochondrial features. The manuscript is well-prepared and could be accepted in its current form. However, it would be further strengthened if the authors could:

  1. Measure thymidine phosphorylase (TP) activity in patient-derived lymphoblastoid cell lines, if feasible.

     2. Assess mitochondrial function using a Seahorse assay and correlate the findings with TP activity levels and clinical  manifestations

Response: We thank the reviewer for the very positive overall evaluation of our work and for recognizing the relevance of our case in expanding the phenotypic spectrum of TYMP-related disease. We also appreciate the thoughtful suggestions aimed at further strengthening the mechanistic insights. We fully agree that assessing thymidine phosphorylase (TP) activity in patient-derived lymphoblastoid cells, as well as evaluating mitochondrial function using Seahorse technology, would provide valuable additional data. However, due to current time constraints and limited availability of patient-derived material, we are unfortunately unable to conduct these experiments within the scope of this revision. Nonetheless, we consider these approaches highly valuable and plan to include them in future functional studies focused on the pathophysiological consequences of TYMP variants.

Reviewer 2 Report

Comments and Suggestions for Authors

 

This manuscript reports the case of a 16-year-old female carrying a previously described homozygous TYMP variant (c.1193_1216dup; p.Arg398_Val405dup), who presented during adolescence with generalized lipodystrophy, insulin resistance, hypertriglyceridemia, hepatic steatosis, and other metabolic complications. These findings are significant for understanding the role of thymidine phosphorylase in rare cases of lipodystrophy. However, several points should be addressed to improve the quality of the manuscript.

 

 

Major comments:

  1. In lines 88-90=, an oral glucose tolerance test 88 (OGTT) demonstrated 120-minute glucose levels consistent with impaired glucose tolerance (7.94 mmol/L), and insulin levels indicative of insulin resistance. However, you also affirm that insulin levels were normal (line 112 and Table 2). Patients 2, 3, and 4 from the literature presented high levels of insulin and IR. How do you explain IR without high levels of insulin in your patient? I believe you need to correct the information on line 112.
  2. Sanger sequencing showed a homozygous c.1193_1216dup variant in the patient. As the authors informed, the duplicated segment is (GGGCGCTGCCGCTGGCGCTGGTGC), which results in an in-frame 141 protein duplication p.Arg398_Val405dup. However, since the authors said that this is a previously described variant, the authors should correctly inform the nomenclature for this variant. You need to specify the position at the DNA and protein levels according to HGVS and ACMG guidelines (indicating which transcript was used). Does this variant have a “rs” number? Which transcript did you use to give the nomenclature of this variant? The longest? I checked in the region 1192 to 1216 of ENST00000252029.8 (NM_001953.5; NP_001944.1), and it does not correspond to the informed region (the duplication segment corresponds to the nucleotides 1178_1201, using the longest transcript NM_001953). You must check this information.
  3. About the pathogenicity of this variant and the structural changes in thymidine phosphorylase due to this variant, did the authors check them using bioinformatics tools? Since genotype-phenotype studies are relevant for understanding MNGIE disease, I encourage the authors to further investigate the impact of this pathogenic variant on protein function and inform the criteria for pathogenicity according to the College of Medical Genetics and Genomics (ACMG).

Author Response

This manuscript reports the case of a 16-year-old female carrying a previously described homozygous TYMP variant (c.1193_1216dup; p.Arg398_Val405dup), who presented during adolescence with generalized lipodystrophy, insulin resistance, hypertriglyceridemia, hepatic steatosis, and other metabolic complications. These findings are significant for understanding the role of thymidine phosphorylase in rare cases of lipodystrophy. However, several points should be addressed to improve the quality of the manuscript

Comment 1. In lines 88-90=, an oral glucose tolerance test 88 (OGTT) demonstrated 120-minute glucose levels consistent with impaired glucose tolerance (7.94 mmol/L), and insulin levels indicative of insulin resistance. However, you also affirm that insulin levels were normal (line 112 and Table 2). Patients 2, 3, and 4 from the literature presented high levels of insulin and IR. How do you explain IR without high levels of insulin in your patient? I believe you need to correct the information on line 112.

Response 1. We thank the reviewer for this important observation. We acknowledge the inconsistency between the interpretation of insulin resistance and the statement that insulin levels were “normal”. We have revised the manuscript. Specifically, we clarified that although fasting insulin levels remained within the reference range, the insulin response relative to glucose concentrations during the previously performed OGTT appeared disproportionate, suggesting impaired insulin sensitivity. To support this interpretation, we calculated a HOMA-IR value of 1.97, which lies at the upper limit of the normal range and is consistent with borderline insulin resistance. This finding aligns with the abnormal insulin-glucose dynamics observed during the OGTT and reinforces the clinical suspicion of early metabolic dysfunction. We have removed the statement indicating that insulin levels were 'normal' and revised lines 111–117of the manuscript to more accurately reflect this interpretation.

Comment 2. Sanger sequencing showed a homozygous c.1193_1216dup variant in the patient. As the authors informed, the duplicated segment is (GGGCGCTGCCGCTGGCGCTGGTGC), which results in an in-frame 141 protein duplication p.Arg398_Val405dup. However, since the authors said that this is a previously described variant, the authors should correctly inform the nomenclature for this variant. You need to specify the position at the DNA and protein levels according to HGVS and ACMG guidelines (indicating which transcript was used). Does this variant have a “rs” number? Which transcript did you use to give the nomenclature of this variant? The longest? I checked in the region 1192 to 1216 of ENST00000252029.8 (NM_001953.5; NP_001944.1), and it does not correspond to the informed region (the duplication segment corresponds to the nucleotides 1178_1201, using the longest transcript NM_001953). You must check this information.

Response 2. We thank the reviewer for this valuable observation. In our original submission, we reported the variant as c.1193_1216dup; p.Arg398_Val405dup, consistent with the nomenclature used in the previously published article describing the same duplication. That report referred to transcript ENST00000395681.6. However, we agree with the reviewer that, according to HGVS and ACMG recommendations, the variant should be described with reference to the canonical transcript ENST00000252029.8 (NM_001953.5; NP_001944.1). In line with this, we have revised the manuscript to use the corrected nomenclature: c.1178_1201dup; p.Arg393_Val400dup. based on the canonical transcript NM_001953.5). This correction has been applied both in the title and throughout the text. We also clarified in the text that the variant was originally reported in the literature under the alternative transcript to ensure consistency for readers (lines 164–170).

Comment 3. About the pathogenicity of this variant and the structural changes in thymidine phosphorylase due to this variant, did the authors check them using bioinformatics tools? Since genotype-phenotype studies are relevant for understanding MNGIE disease, I encourage the authors to further investigate the impact of this pathogenic variant on protein function and inform the criteria for pathogenicity according to the College of Medical Genetics and Genomics (ACMG).

Response 3. We thank the reviewer for this insightful comment. The variant was initially analyzed using the JuliaOmix platform, which classified it as a Variant of Uncertain Significance (VUS) according to ACMG guidelines, based on the criteria BP4, PM1, and PM2. However, integrating JuliaOmix’s output with additional evidence allows for a more accurate interpretation. Specifically, the variant is absent from population databases (PM2), is an in-frame duplication affecting a critical functional domain (PM4), segregates with disease in the family (PP1), and the patient’s clinical and biochemical phenotype is highly specific for TYMP-related disease (PP4). In addition, in the previous publication describing this mutation, in silico predictions with PredictProtein (PP) indicated significant structural alterations affecting secondary structure elements, transmembrane regions, and protein–protein interaction domains, thus supporting a deleterious effect (PP3). Based on the combination of these criteria, we reclassified the variant as “likely pathogenic,” consistent with ACMG guidelines. We have revised the manuscript to clarify this point, to specify both the JuliaOmix output and our integrated interpretation (Results sectionlines 174–196) and to include a table (Table 3) summarizing the ACMG criteria applied to this variant

In response to the general recommendation to improve the quality of figures and tables, as suggested by Reviewer 2, we have made the following revisions: Figure 1 was updated to include additional clinical photographs, including a posterior view of the patient, to better illustrate the pseudo-muscular hypertrophy and the characteristic fat redistribution associated with the lipodystrophic phenotype. Figures 1 and 2 were re-submitted in high-resolution format (600 dpi) to ensure optimal image quality. Tables were reformatted to enhance readability: we increased their size relative to the page layout and improved alignment, spacing, and font consistency. In addition, we added Table 3, which summarizes the ACMG criteria applied to the identified TYMP variant.

 

Round 2

Reviewer 2 Report

Comments and Suggestions for Authors

The authors improved the quality of the manuscript. They agreed with all the suggestions this reviewer has made. The paper is now suitable for publication.

 

Back to TopTop