The Effect of Adipose-Derived Stem Cell (ADSC)-Exos on the Healing of Autologous Skin Grafts in Miniature Pigs
Abstract
:1. Introduction
2. Results
2.1. ADSC-Exos Promote Skin Wound Healing
2.2. ADSC-Exos Improve Histopathological Changes After Skin Grafting
2.3. ADSC-Exos Inhibit Oxidative Stress After Skin Grafting
2.4. ADSC-Exos Regulate Inflammatory Balance After Skin Grafting
2.5. ADSC-Exos Promote Regeneration After Skin Grafting
2.6. ADSC-Exos Activate the PI3K/AKT/mTOR Signaling Pathway
2.7. ADSC-Exos Have a Similar Regenerative Ability to ADSCs After Skin Transplantation
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Acquisition of ADSC and ADSC-Exos
4.3. Surgical Procedure and Treatment Protocol
4.4. Enzyme-Linked Immunosorbent Assay (Elisa)
4.5. Analysis of Enzyme Activity Related to Oxidative Stress
4.6. Histopathological Assessment
4.7. Real-Time Quantitative PCRwomen
4.8. Western Blotting
4.9. Immunohistochemistry
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wang, J.; Kaplan, M.H.; Yang, K. ResTORing barrier function in the skin. J. Allergy Clin. Immunol. 2020, 145, 111–113. [Google Scholar] [CrossRef]
- Balsini, P.; Buchberger, M.; Symmank, D.; Weninger, W.; Pfisterer, K. Extracellular matrix modification in skin inflammation. Eur. J. Immunol. 2021, 51, 380. [Google Scholar]
- Ding, J.Y.; Chen, M.J.; Wu, L.F.; Shu, G.F.; Fang, S.J.; Li, Z.Y.; Chu, X.R.; Li, X.K.; Wang, Z.G.; Ji, J.S. Mesenchymal stem cell-derived extracellular vesicles in skin wound healing: Roles, opportunities and challenges. Mil. Med. Res. 2023, 10, 36. [Google Scholar] [CrossRef]
- Peña, O.A.; Martin, P. Cellular and molecular mechanisms of skin wound healing. Nat. Rev. Mol. Cell Biol. 2024, 25, 599–616. [Google Scholar] [CrossRef] [PubMed]
- Wilkinson, H.N.; Hardman, M.J. Wound healing: Cellular mechanisms and pathological outcomes. Open Biol. 2020, 10, 200223. [Google Scholar] [CrossRef] [PubMed]
- Gupta, S.; Jain, R.K. Application of autologous platelet-rich plasma to graft donor sites to reduce pain and promote healing. J. Wound Care 2022, 31, 86–90. [Google Scholar] [CrossRef]
- Calonge, M. Mesenchimal stem cells for ocular surface disease. Acta Ophthalmol. 2022, 100. [Google Scholar] [CrossRef]
- Sherman, L.S.; Romagano, M.P.; Williams, S.F.; Rameshwar, P. Mesenchymal stem cell therapies in brain disease. Semin. Cell Dev. Biol. 2019, 95, 111–119. [Google Scholar] [CrossRef]
- Bochon, B.; Kozubska, M.; Surygała, G.; Witkowska, A.; Kuźniewicz, R.; Grzeszczak, W.; Wystrychowski, G. Mesenchymal Stem Cells—Potential Applications in Kidney Diseases. Int. J. Mol. Sci. 2019, 20, 2462. [Google Scholar] [CrossRef]
- Li, Y.Y.; Ye, Z.Y.; Yang, W.Q.; Zhang, Q.Z.; Zeng, J.C. An Update on the Potential of Mesenchymal Stem Cell Therapy for Cutaneous Diseases. Stem Cells Int. 2021, 2021, 8834590. [Google Scholar] [CrossRef]
- Keshtkar, S.; Azarpira, N.; Ghahremani, M.H. Mesenchymal stem cell-derived extracellular vesicles: Novel frontiers in regenerative medicine. Stem Cell Res. Ther. 2018, 9, 63. [Google Scholar] [CrossRef]
- Tang, Y.Y.; Zhou, Y.; Li, H.J. Advances in mesenchymal stem cell exosomes: A review. Stem Cell Res. Ther. 2021, 12, 71. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.; Li, D.; Wang, M.T.; Xu, Z.L.; Chen, X.; Liu, Q.; Sun, W.J.; Li, J.X.; Gong, Y.Q.; Liu, D.; et al. Exposure to blue light stimulates the proangiogenic capability of exosomes derived from human umbilical cord mesenchymal stem cells. Stem Cell Res. Ther. 2019, 10, 358. [Google Scholar] [CrossRef]
- Bahr, M.M.; Amer, M.S.; Sooud, K.A.-E.L.; Abdallah, A.N.; Shehab, G.G.; Tookhy, O.S.E. Proficiency of Carboxymethyl cellulose as a Cryoprotectant. Clinical and Histological Evaluation of Cryopreserved Heterogenous Mesenchymal Stem Cell-Exosomal Hydrogel on Critical Size Skin Wounds in Dogs. Int. J. Hematol. Oncol. Stem Cell Res. 2021, 15, 178–191. [Google Scholar] [CrossRef]
- Eun, K.; Hwang, S.U.; Jeon, H.M.; Hyun, S.H.; Kim, H. Comparative Analysis of Human, Mouse, and Pig Glial Fibrillary Acidic Protein Gene Structures. Anim. Biotechnol. 2016, 27, 126–132. [Google Scholar] [CrossRef]
- Lv, Y.; Sang, J.; Kou, Z.; Wang, H. The Effect of Adipose Mesenchymal Stem Cells on the Healing Process of Autologous Skin Transplantation in Bama Miniature Pigs. J. Vet. Sci. Anim. Ind. 2024, 55, 3193–3204. [Google Scholar]
- Zuk, P.A.; Zhu, M.; Mizuno, H.; Huang, J.; Futrell, J.W.; Katz, A.J.; Benhaim, P.; Lorenz, H.P.; Hedrick, M.H. Multilineage Cells from Human Adipose Tissue: Implications for Cell-Based Therapies. Tissue Eng. 2001, 7, 211–228. [Google Scholar] [CrossRef]
- Moreno-Manzano, V.; Mellado-López, M.; Morera-Esteve, M.J.; Alastrue-Agudo, A.; Bisbal-Velasco, V.; Forteza-Vila, J.; Serrano-Aroca, A.; Vera-Donoso, C.D. Human adipose-derived mesenchymal stem cells accelerate decellularized neobladder regeneration. Regen. Biomater. 2020, 7, 161–169. [Google Scholar] [CrossRef]
- Wan, Z.; Wang, X.; Fu, Z.L.; Ma, Y.M.; Dai, G.; Gong, X.Y.; Chen, G.X.; Yang, L. Toll-like receptor activation regulates the paracrine effect of adipose-derived mesenchymal stem cells on reversing osteoarthritic phenotype of chondrocytes. Mol. Biol. Rep. 2024, 51, 550. [Google Scholar] [CrossRef]
- Zhang, L.; Ye, C.; Li, P.; Li, C.; Shu, W.; Zhao, Y.; Wang, X. ADSCs stimulated by VEGF-C alleviate intestinal inflammation via dual mechanisms of enhancing lymphatic drainage by a VEGF-C/VEGFR-3-dependent mechanism and inhibiting the NF-κB pathway by the secretome. Stem Cell Res. Ther. 2022, 13, 448. [Google Scholar] [CrossRef]
- Meldolesi, J. Exosomes and Ectosomes in Intercellular Communication. Curr. Biol. 2018, 28, R435–R444. [Google Scholar] [CrossRef]
- Tienda-Vázquez, M.A.; Hanel, J.M.; Márquez-Arteaga, E.M.; Salgado-alvarez, A.P.; Scheckhuber, C.Q.; Alanis-Gómez, J.R.; Espinoza-Silva, J.I.; Ramos-Kuri, M.; Hernández-Rosas, F.; Melchor-Martínez, E.M.; et al. Exosomes: A Promising Strategy for Repair, Regeneration and Treatment of Skin Disorders. Cells 2023, 12, 1625. [Google Scholar] [CrossRef]
- Wan, X.F.; Ni, X.J.; Xie, Y.J.; Chen, L.; Cai, B.C.; Lin, Q.; Ke, R.N.; Huang, T.; Shan, X.Y.; Wang, B. Research progress and application prospect of adipose-derived stem cell secretome in diabetes foot ulcers healing. Stem Cell Res. Ther. 2024, 15, 279. [Google Scholar] [CrossRef]
- Jin, C.; Zhao, R.; Hu, W.; Wu, X.; Zhou, L.; Shan, L.; Wu, H. Topical hADSCs-HA Gel Promotes Skin Regeneration and Angiogenesis in Pressure Ulcers by Paracrine Activating PPARβ/δ Pathway. Drug Des. Dev. Ther. 2024, 18, 4799–4824. [Google Scholar] [CrossRef]
- Li, Y.; Li, D.; You, L.; Deng, T.; Pang, Q.; Meng, X.; Zhu, B. dCas9-Based PDGFR–β Activation ADSCs Accelerate Wound Healing in Diabetic Mice through Angiogenesis and ECM Remodeling. Int. J. Mol. Sci. 2023, 24, 5949. [Google Scholar] [CrossRef]
- Mazini, L.; Rochette, L.; Admou, B.; Amal, S.; Malka, G. Hopes and Limits of Adipose-Derived Stem Cells (ADSCs) and Mesenchymal Stem Cells (MSCs) in Wound Healing. Int. J. Mol. Sci. 2020, 21, 1306. [Google Scholar] [CrossRef]
- Qin, Y.; Ge, G.R.; Yang, P.; Wang, L.L.; Qiao, Y.S.; Pan, G.Q.; Yang, H.L.; Bai, J.X.; Cui, W.G.; Geng, D.C. An Update on Adipose-Derived Stem Cells for Regenerative Medicine: Where Challenge Meets Opportunity. Adv. Sci. 2023, 10, 2207334. [Google Scholar] [CrossRef]
- Doyle, L.; Wang, M. Overview of Extracellular Vesicles, Their Origin, Composition, Purpose, and Methods for Exosome Isolation and Analysis. Cells 2019, 8, 727. [Google Scholar] [CrossRef]
- Walsh, S.A.; Hoyt, B.W.; Rowe, C.J.; Dey, D.; Davis, T.A. Alarming Cargo: The Role of Exosomes in Trauma-Induced Inflammation. Biomolecules 2021, 11, 522. [Google Scholar] [CrossRef]
- Juan, T.; Fürthauer, M. Biogenesis and function of ESCRT-dependent extracellular vesicles. Semin. Cell Dev. Biol. 2018, 74, 66–77. [Google Scholar] [CrossRef]
- Wang, Y.; Liu, T.; Jiao, G.M.; Lv, Y.G.; Piao, C.X.; Lu, X.Y.; Ma, H.Y.; Wang, H.B. Exosomes from adipose-derived mesenchymal stem cells can attenuate liver injury caused by minimally invasive hemihepatectomy combined with ischemia-reperfusion in minipigs by modulating the endoplasmic reticulum stress response. Life Sci. 2023, 321, 121618. [Google Scholar] [CrossRef]
- Jia, Q.Y.; Zhao, H.X.; Wang, Y.X.; Cen, Y.; Zhang, Z.Y. Mechanisms and applications of adipose-derived stem cell-extracellular vesicles in the inflammation of wound healing. Front. Immunol. 2023, 14, 1214757. [Google Scholar] [CrossRef] [PubMed]
- Zhou, B.H.; Chen, Q.Y.; Zhang, Q.W.; Tian, W.D.; Chen, T.; Liu, Z. Therapeutic potential of adipose-derived stem cell extracellular vesicles: From inflammation regulation to tissue repair. Stem Cell Res. Ther. 2024, 15, 249. [Google Scholar] [CrossRef]
- Freese, K.E.; Kokai, L.; Edwards, R.P.; Philips, B.J.; Sheikh, M.A.; Kelley, J.; Comerci, J.; Marra, K.G.; Rubin, J.P.; Linkov, F. Adipose-Derived Stems Cells and Their Role in Human Cancer Development, Growth, Progression, and Metastasis: A Systematic Review. Cancer Res. 2015, 75, 1161–1168. [Google Scholar] [CrossRef]
- Liang, X.T.; Ding, Y.; Zhang, Y.L.; Tse, H.F.; Lian, Q.Z. Paracrine Mechanisms of Mesenchymal Stem Cell-Based Therapy: Current Status and Perspectives. Cell Transplant. 2014, 23, 1045–1059. [Google Scholar] [CrossRef]
- Qiu, H.; Liu, S.; Wu, K.L.; Zhao, R.; Cao, L.D.; Wang, H. Prospective application of exosomes derived from adipose-derived stem cells in skin wound healing: A review. J. Cosmet. Dermatol. 2020, 19, 574–581. [Google Scholar] [CrossRef]
- Sun, B.K.; Siprashvili, Z.; Khavari, P.A. Advances in skin grafting and treatment of cutaneous wounds. Science 2014, 346, 941–945. [Google Scholar] [CrossRef] [PubMed]
- Mutsaers, S.E.; Bishop, J.E.; McGrouther, G.; Laurent, G.J. Mechanisms of tissue repair: From wound healing to fibrosis. Int. J. Biochem. Cell Biol. 1997, 29, 5–17. [Google Scholar] [CrossRef]
- Banerjee, P.; Suguna, L.; Shanthi, C. Wound healing activity of a collagen-derived cryptic peptide. Amino Acids 2015, 47, 317–328. [Google Scholar] [CrossRef] [PubMed]
- Martin, P.; Nunan, R. Cellular and molecular mechanisms of repair in acute and chronic wound healing. Br. J. Dermatol. 2015, 173, 370–378. [Google Scholar] [CrossRef]
- Lan, H.Y. Diverse Roles of TGF-β/Smads in Renal Fibrosis and Inflammation. Int. J. Biol. Sci. 2011, 7, 1056–1067. [Google Scholar] [CrossRef]
- De Rivero Vaccari, J.P.; Brand, F.; Adamczak, S.; Lee, S.W.; Perez-Barcena, J.; Wang, M.Y.; Bullock, M.R.; Dietrich, W.D.; Keane, R.W. Exosome-mediated inflammasome signaling after central nervous system injury. J. Neurochem. 2015, 136, 39–48. [Google Scholar] [CrossRef]
- Zhao, G.; Yang, C.; Yang, J.; Liu, P.; Jiang, K.F.; Shaukat, A.; Wu, H.C.; Deng, G.Z. Placental exosome-mediated Bta-miR-499-Lin28B/let-7 axis regulates inflammatory bias during early pregnancy. Cell Death Dis. 2018, 9, 704. [Google Scholar] [CrossRef]
- Singla, D.K.; Johnson, T.A.; Dargani, Z.T. Exosome Treatment Enhances Anti-Inflammatory M2 Macrophages and Reduces Inflammation-Induced Pyroptosis in Doxorubicin-Induced Cardiomyopathy. Cells 2019, 8, 1224. [Google Scholar] [CrossRef]
- Zhao, H.; Shang, Q.W.; Pan, Z.Z.; Bai, Y.; Li, Z.Q.; Zhang, H.Y.; Zhang, Q.; Guo, C.; Zhang, L.N.; Wang, Q. Exosomes from Adipose-Derived Stem Cells Attenuate Adipose Inflammation and Obesity Through Polarizing M2 Macrophages and Beiging in White Adipose Tissue. Diabetes 2018, 67, 235–247. [Google Scholar] [CrossRef]
- Li, X.; Xie, X.Y.; Lian, W.S.; Shi, R.F.; Han, S.L.; Zhang, H.J.; Lu, L.G.; Li, M.Q. Exosomes from adipose-derived stem cells overexpressing Nrf2 accelerate cutaneous wound healing by promoting vascularization in a diabetic foot ulcer rat model. Exp. Mol. Med. 2018, 50, 1–14. [Google Scholar] [CrossRef]
- Iannotta, D.; Kijas, A.W.; Rowan, A.E.; Wolfram, J. Entry and exit of extracellular vesicles to and from the blood circulation. Nat. Nanotechnol. 2023, 19, 13–20. [Google Scholar] [CrossRef] [PubMed]
- Rehman, J.; Traktuev, D.; Li, J.L.; Merfeld-Clauss, S.; Temm-Grove, C.J.; Bovenkerk, J.E.; Pell, C.L.; Johnstone, B.H.; Considine, R.V.; March, K.L. Secretion of angiogenic and antiapoptotic factors by human adipose stromal cells. Circulation 2004, 109, 1292–1298. [Google Scholar] [CrossRef]
- Cabral, J.; Ryan, A.E.; Griffin, M.D.; Ritter, T. Extracellular vesicles as modulators of wound healing. Adv. Drug Deliv. Rev. 2018, 129, 394–406. [Google Scholar] [CrossRef]
- Hade, M.D.; Suire, C.N.; Mossell, J.; Suo, Z.C. Extracellular vesicles: Emerging frontiers in wound healing. Med. Res. Rev. 2022, 42, 2102–2125. [Google Scholar] [CrossRef]
- Yang, W.Z.; Yang, J.; Xue, L.P.; Xiao, L.B.; Li, Y. MiR-126 overexpression inhibits high glucose-induced migration and tube formation of rhesus macaque choroid-retinal endothelial cells by obstructing VEGFA and PIK3R2. J. Diabetes Its Complicat. 2017, 31, 653–663. [Google Scholar] [CrossRef]
- Xu, F.; Xiang, Q.; Long, X.; Zhou, Z. Exosomes miR378a-3p Mediate Pro-angiogenic Activity of Human Adipose-derived Mesenchymal Stem Cells. Circulation 2016, 134, A14211. [Google Scholar]
- Mianehsaz, E.; Mirzaei, H.R.; Mahjoubin-Tehran, M.; Rezaee, A.; Sahebnasagh, R.; Pourhanifeh, M.H.; Mirzaei, H.; Hamblin, M.R. Mesenchymal stem cell-derived exosomes: A new therapeutic approach to osteoarthritis? Stem Cell Res. Ther. 2019, 10, 340. [Google Scholar] [CrossRef]
- Ebrahimian, T.G.; Pouzoulet, F.; Squiban, C.; Buard, V.; André, M.; Cousin, B.; Gourmelon, P.; Benderitter, M.; Casteilla, L.; Tamarat, R. Cell Therapy Based on Adipose Tissue-Derived Stromal Cells Promotes Physiological and Pathological Wound Healing. Arterioscler. Thromb. Vasc. Biol. 2009, 29, 503–510. [Google Scholar] [CrossRef]
- Shen, T.; Zheng, Q.Q.; Shen, J.; Li, Q.S.; Song, X.H.; Luo, H.B.; Hong, C.Y.; Yao, K. Effects of Adipose-derived Mesenchymal Stem Cell Exosomes on Corneal Stromal Fibroblast Viability and Extracellular Matrix Synthesis. Chin. Med. J. 2018, 131, 704–712. [Google Scholar] [CrossRef]
- Zhang, J.Y.; Guan, J.J.; Niu, X.; Hu, G.W.; Guo, S.C.; Li, Q.; Xie, Z.P.; Zhang, C.Q.; Wang, Y. Exosomes released from human induced pluripotent stem cells-derived MSCs facilitate cutaneous wound healing by promoting collagen synthesis and angiogenesis. J. Transl. Med. 2015, 13, 49. [Google Scholar] [CrossRef]
- Liu, Z.; Yang, Y.; Ju, J.H.; Zhang, G.L.; Zhang, P.; Ji, P.X.; Jin, Q.H.; Cao, G.B.; Zuo, R.; Wang, H.Y.; et al. miR-100-5p Promotes Epidermal Stem Cell Proliferation through Targeting MTMR3 to Activate PIP3/AKT and ERK Signaling Pathways. Stem Cells Int. 2022, 2022, 1474273. [Google Scholar] [CrossRef]
- Ren, S.; Chen, J.; Duscher, D.; Liu, Y.T.; Guo, G.J.; Kang, Y.; Xiong, H.W.; Zhan, P.; Wang, C.; Machens, H.-G.; et al. Microvesicles from human adipose stem cells promote wound healing by optimizing cellular functions via AKT and ERK signaling pathways. Stem Cell Res. Ther. 2019, 10, 47. [Google Scholar] [CrossRef]
- Song, J.H.; Zhou, D.; Cui, L.L.; Wu, C.J.; Jia, L.A.; Wang, M.Q.; Li, J.R.; Ya, J.; Ji, X.M.; Meng, R. Advancing stroke therapy: Innovative approaches with stem cell-derived extracellular vesicles. Cell Commun. Signal. 2024, 22, 369. [Google Scholar] [CrossRef]
- Luo, R.H.; Liu, M.M.; Tan, T.T.; Yang, Q.; Wang, Y.; Men, L.H.; Zhao, L.P.; Zhang, H.H.; Wang, S.L.; Xie, T.; et al. Emerging Significance and Therapeutic Potential of Extracellular vesicles. Int. J. Biol. Sci. 2021, 17, 2476–2486. [Google Scholar] [CrossRef]
- Sarate, R.M.; Hochstetter, J.; Valet, M.; Hallou, A.; Song, Y.R.; Bansaccal, N.; Ligare, M.; Aragona, M.; Engelman, D.; Bauduin, A.; et al. Dynamic regulation of tissue fluidity controls skin repair during wound healing. Cell 2024, 187, 5298–5315.e19. [Google Scholar] [CrossRef]
- Cendales, L.C.; Kanitakis, J.; Schneeberger, S.; Burns, C.; Ruiz, P.; Landin, L.; Remmelink, M.; Hewitt, C.W.; Landgren, T.; Lyons, B.; et al. The Banff 2007 working classification of skin-containing composite tissue Allograft Pathology. Am. J. Transplant. 2008, 8, 1396–1400. [Google Scholar] [CrossRef]
Score | Inflammatory Infiltration | Epidermal Abnormalities and Necrosis | Cell Apoptosis and Necrosis |
---|---|---|---|
0 | None or Minimal | None | None |
1 | Minimal | Minimal | None |
2 | Mild | Mild | Minimal |
3 | Moderate | Moderate | Moderate |
4 | Severe | Severe | Severe |
Gene | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
---|---|---|
VEGF | CATGGCAGAAGGAGACCAGAAACC | CACAGGACGGCTTGAAGATGTACTC |
PCNA | GGCTCTATCCTGAAGAAGGTGCTG | GACATGAGACGAGTCCATGCTCTG |
CD31 | GGTGGTCAAGAGAAGCAATGAGGTC | AAATGGGCGAGGTTCCGTTTATGG |
TGF-β | CCATTCGCGGCCAGATT | GCTCCGGTTCGACACTTTC |
ANG-1 | AAATGGAGGGGAAGCACAAGGAAG | ACTGTTATTGGTGGTGGCTCTGTTC |
ANG-2 | CACCTACACGCTGACCTTTCCTAAC | CGCTGAATAACTGTCCATCCACCTC |
SOCS3 | GGTCACCCACAGCAAGTTTCCC | TCCAGTAGAAGCCGCTCTCCTG |
TNF-α | ACCAGCCAGGAGAGAGACAAG | AGCGTGTGAGAGGGAGAGAGT |
IL-6 | AGCAAGGAGGTACTGGCAGA | AAGACCGGTGGTGATTCTCA |
IL-1β | GGGAGGATATCAAGGAGCACG | CTTGGAGCTTGCTAAAGGCAC |
AKT | GACGGCACCTTCATCGGCTAC | CGCCACGGAGAAGTTGTTGAGG |
PI3K | ACGGAGGAGGTGCTCTGGAAC | GGACTCGGGACTGGGCATCTC |
mTOR | GCACGTCAGCACCATCAACCTC | GCCTCAGCCATTCCAACCAGTC |
β-actin | TCTGGCACCACACCTTCT | TGATCTGGGTCATCTTCTCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, P.; Cao, L.; Liu, T.; Lu, X.; Ma, Y.; Wang, H. The Effect of Adipose-Derived Stem Cell (ADSC)-Exos on the Healing of Autologous Skin Grafts in Miniature Pigs. Int. J. Mol. Sci. 2025, 26, 479. https://doi.org/10.3390/ijms26020479
Li P, Cao L, Liu T, Lu X, Ma Y, Wang H. The Effect of Adipose-Derived Stem Cell (ADSC)-Exos on the Healing of Autologous Skin Grafts in Miniature Pigs. International Journal of Molecular Sciences. 2025; 26(2):479. https://doi.org/10.3390/ijms26020479
Chicago/Turabian StyleLi, Pujun, Lei Cao, Tao Liu, Xiangyu Lu, Yajun Ma, and Hongbin Wang. 2025. "The Effect of Adipose-Derived Stem Cell (ADSC)-Exos on the Healing of Autologous Skin Grafts in Miniature Pigs" International Journal of Molecular Sciences 26, no. 2: 479. https://doi.org/10.3390/ijms26020479
APA StyleLi, P., Cao, L., Liu, T., Lu, X., Ma, Y., & Wang, H. (2025). The Effect of Adipose-Derived Stem Cell (ADSC)-Exos on the Healing of Autologous Skin Grafts in Miniature Pigs. International Journal of Molecular Sciences, 26(2), 479. https://doi.org/10.3390/ijms26020479