Next Article in Journal
Identification of Downregulated MECR Gene in Parkinson’s Disease Through Integrated Transcriptomic Analysis and Validation
Next Article in Special Issue
Sterol Regulatory Element-Binding Protein Sre1 Mediates the Development and Pathogenicity of the Grey Mould Fungus Botrytis cinerea
Previous Article in Journal
An Alternative Mode of GPCR Transactivation: Activation of GPCRs by Adhesion GPCRs
Previous Article in Special Issue
Systematic Analysis of Cotton RING E3 Ubiquitin Ligase Genes Reveals Their Potential Involvement in Salt Stress Tolerance
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification of GmPIF Family and Regulatory Pathway Analysis of GmPIF3g in Different Temperature Environments

1
National Key Laboratory of Smart Farm Technologies and Systems, Northeast Agricultural University, Harbin 150030, China
2
College of Resources and Environment, Northeast Agricultural University, Harbin 150030, China
3
Heihe Branch of Heilongjiang Academy of Agricultural Sciences, Heihe 164300, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(2), 551; https://doi.org/10.3390/ijms26020551
Submission received: 7 December 2024 / Revised: 4 January 2025 / Accepted: 6 January 2025 / Published: 10 January 2025
(This article belongs to the Special Issue Plant Responses to Biotic and Abiotic Stresses)

Abstract

:
Phytochrome-interacting factors (PIFs) play a crucial role in regulating plant growth and development. However, studies on soybean PIFs are limited. Here, we identified 22 GmPIF genes from the soybean genome and classified the GmPIF proteins into 13 subfamilies based on amino acid sequence homology, secondary and tertiary structures, protein structure, and conserved motifs. Genome-wide collinearity analysis revealed that fragment duplication events play a dominant role in expanding the GmPIF gene family. Cis-acting element analysis revealed that the GmPIF gene family is involved in light response, hormone response, biotic–abiotic stress response elements, and plant growth and development. Gene expression analysis in different temperature environments showed that the GmPIF family was found to be induced by phytohormone treatments, with a significant increase in the expression level of GmPIF3g. GmPIF3g plays a key role in the regulation of the entire network, and in addition, 30 proteins interacting with the GmPIF3g promoter were identified through the use of a novel biofilm interference technique. This technique showed that the transcription factor Dof (DNA binding with one finger) binds to the GmPIF3g promoter, and Y1H assays indicated that Dof regulates its expression by binding to the PIF promoter. These results provide a theoretical basis for further studies on the regulatory network of GmPIF genes to improve the structure of soybean plants under shade environments, as well as a new method for analyzing regulatory elements that interact with gene promoters.

1. Introduction

Phytochrome-interacting factors (PIFs) are crucial plant photoreceptors that belong to the bHLH (basic-helix-loop-helix) transcription factor family. In Arabidopsis thaliana, eight PIF members have been identified, including PIF1, PIF3, PIF4, PIF5, PIF6, PIF7, and PIF8 [1,2,3,4,5,6]. PIFs have a conserved APB (active phytochrome B-binding motif) or APA (active phytochrome A-binding motif) at the N-terminal end and a conserved bHLH structural domain at the C-terminal end. PIF3 was the first PIF member identified; yeast two-hybrid technology revealed that it interacts with the C-terminal end of PhyB (Phytochrome B) [4]. Pr will change into Pfr (far-red light absorption form) when exposed to red light and move from the cytoplasm to the nucleus. It binds to PIF’s APB or APA domains, causing the PIF to switch from an inhibitory to an active state. Activated PIF may bind to particular DNA sequences, control downstream gene expression, and influence plant growth and development [7]. All PIFs are particularly connected to PhyB via Pfr. Arabidopsis phyB, once activated by light, may engage directly with a kind of phytochrome interaction factor PIF, transferring light signals and influencing downstream gene expression, so boosting photomorphogenesis. As a result, phyB and PIFs are critical signal modules that allow plants to respond to their surroundings in light. Recent research has shown the exact molecular process of light-activated phyB from Pr to Pfr, proposing the “induction-fit” interaction model between phyB and PIF [8]. PIF1 and PIF3 both contain an APA domain, which can interact with PHYA (phytochrome A). However, this interaction is not conserved structurally. According to certain research, PIF1 binds more strongly with PHIA than PIF3. In this technique, the PIF gene is coupled with the photo-responsive gene to control their expression levels in Arabidopsis by increasing PIF phosphorylation [9].
The PIF serves as a central regulator of intracellular signaling, participating in the modulation of numerous biological processes in plants. It not only controls plant growth and development but also plays a crucial role in the plant’s resistance mechanisms by integrating various plant hormone signaling pathways. During the plant’s response to abiotic stresses such as low temperature, high temperature, shading, and drought, PIF exerts a pivotal regulatory function [9,10,11,12,13,14,15]. In the process of plant growth and development, different hormone pathway signals are also related to PIF, especially those involving hormones: GA (gibberellin) [16,17,18], ABA (abscisic acid) [19,20], BR (brassinosteroid) [21], JA (jasmonate) [22], IAA (auxin) [23,24], and ethylene [25]. GA and BR participate in the signal transduction of light and temperature. DELLA (Asp Glu Leu Leu Ala) is a negative regulator of the GA pathway that responds to light and circadian rhythms by regulating PIF activity. At night, GA and GID1 (GA-insensitive dwarf 1) concentrations reach their highest levels, which inhibit the activity of DELLA to negatively regulate PIF. Increased PIF mRNA levels subsequently promote rapid hypocotyl growth before dawn [26]. At dawn, the decrease in GID1 levels leads to the stabilization of DELLA and the suppression of PIF activity, which subsequently results in chlorophyllation and a reduction in plant growth [27]. During the daytime Pfr phosphorylates PIFs, which, in turn, degrades PIFs via the ubiquitin–proteasome pathway. An insufficient amount of PIFs inhibits hypocotyl growth [28,29].
There is extensive overlap between the genes regulated downstream of BZR1 and those related to light signaling [30]. PIF4 and active BZR1 build up and interact with one another under dark conditions to encourage hypocotyl elongation [31]. Conversely, pifq mutants are less sensitive to exogenous oleuropein lactones than the wild type under light conditions; in the bri 1–116 mutant, the overexpression of the non-functional BZR1 results in a dwarfing phenotype due to the upregulation of PIF4 [32]. BIN2, as a negative regulator of the BR signaling pathway, regulates periodic hypocotyl growth by phosphorylating PIF4 [33]. PIF activates BR signaling kinase 5, promoting the interaction between the downstream transcription factor BES1 and the PIF, forming a BES1-PIF complex to enhance downstream gene expression [34]. In addition, PIF4 also functions in controlling hypocotyl elongation in Arabidopsis by regulating the IAA concentration. In warm environments, PIF4 accumulates as it interacts with the transcriptional activator HMR to promote the expression of heat-sensitive growth-related genes–YUC8, IAA19, and IAA29–thereby stimulating plant growth [35]. Moreover, PIF4 interacts with the transcriptional cofactor SEU to form a regulatory complex that regulates the expression of the early hormone response genes IAA6 and IAA19 and affects IAA concentration to promote hypocotyl elongation [36]. Under shade conditions, the enhanced activity of PIF4, PIF5, and PIF7 promotes the expression of YUC8, IAA19, and PRE1 genes, thereby promoting plant elongation [37].
As a fixed plant, soybean must integrate a variety of external and endogenous cues to regulate its height, and the internode length of soybean plants is critical in determining plant height and overall structure. Exogenous and endogenous hormones, as well as light and temperature, stimulate internode elongation. Plant hormones control internode elongation via concentration fluctuations and steady-state changes [38]. Light and temperature control internode elongation by coordinating the light-temperature signal route with the plant hormone system [6]. The mechanism of PIF-mediated light and temperature control, as well as the integration of the hormone signal route, remain unknown.
In this work, we sought to uncover and describe the integrated regulatory mechanism of soybean PIF gene family members in light, temperature, and hormone signaling pathways. In order to do this, we examined their expression patterns in various light, temperature, and hormone settings. We employed a novel method called biofilm interference (BLI) to discover proteins that interact with the critical factor GmPIF3g promoter. Y1H analysis was utilized to confirm the combination of Dof and PIF promoters. These findings lay a good framework for further research into the involvement of the GmPIF gene in the light, temperature, and hormone control network, which may improve the structure of soybean plants grown in shady environments. In addition, in this study, we proposed a new method to fish the binding protein with the gene promoter.

2. Results

2.1. Identification of GmPIF Genes in Soybean

By analyzing soybean transcriptome data, a total of 22 candidate PIF protein sequences were obtained and named GmPIF1a-GPIF1e, GmPIF3a-GmPIF3k, GmPIF4a-GmPIF4d, GmPIF7a, and GmPIF7b. The basic physicochemical properties of GmPIF protein sequences were analyzed using ExPaSy. The molecular weight range of the 22 members of the GmPIF gene family is 18.48–77.25 kD, encoding amino acids ranging from 160 to 633 aa, with a maximum isoelectric point of 9.41 (GmPIF7b) and a minimum of 5.61 (GmPIF3a). Among them, GmPIF1d, GmPIF3b, GmPIF3d, GmPIF3f, GmPIF3h, GmPIF3j, and GmPIF7b have a PI > 7, indicating alkalinity, while others have a PI < 7, indicating acidity. Only two GmPIF proteins are stable (coefficient less than 40), indicating poor stability of the GmPIF transcription factors. In total, 22 GmPIF members are distributed on 13 chromosomes and located in the nucleus (Table 1), where they perform the most important biological functions.

2.2. Phylogenetic Tree Construction, Motif, and Gene Structure Analysis

Based on the phylogenetic tree, which is constructed to analyze the sequence homology and explore the evolutionary affinities of PIFs among different species as well as within the members of the GmPIF family. By comparing the full-length protein sequences of 22 PIFs from soybean, 17 PIFs from maize, 11 PIFs from rice, and 11 PIFs from Arabidopsis, all the proteins were categorized into 13 distinct subfamilies, ranging from class 1 to 13 (Figure 1). There were no homologous genes in classes 1, 3, 6, 8, and 11. The homology of GmPIF family members with Arabidopsis was significantly greater than that of monocotyledonous plants such as rice and maize. The high homology observed between the members of the GmPIF family and the members of the AtPIF family indicates the presence of similar biological functions. GmPIF1d and GmPIF1c were clustered in class 2 and were homologous to AtPIF1c. GmPIF4c was clustered in class 4 and was more distantly related to the other genes. GmPIF7a and GmPIF7b were clustered in class 5 and were homologous to AtPIF7 and AtPIF8. GmPIF3h, GmPIF3b, and GmPIF3j were clustered in class 7. GmPIF4a, GmPIF4b, and GmPIF4d were homologous to AtPIF4 and AtPIF5. GmPIF3k, GmPIF3g, and GmPIF3i were homologous to AtPIF3d. GmPIF3a, GmPIF3c, GmPIF3d, GmPIF3f, and GmPIF3e were clustered in class 12. GmPIF1a, GmPIF1b, and GmPIF1c were homologous to AtPIF1b and were clustered in class 13.
In proteins encoded by genes belonging to the GmPIF family, 10 motifs were found (Figure 2). (Supplemental Table S1), and all GmPIFs contained Motif1 (BHLH motif) except GmPIF1d and GmPIF1e. Except for GmPIF1d, GmPIF1e, GmPIF3a, GmPIF3c, GmPIF3d, GmPIF3f, and GmPIF4c, the other GmPIFs contained Motif2 (APB motif), which is the most important motif; all of them exhibited similar exon–intron distribution patterns. The 22 GmPIF genes included the UTR and CDS. The number of CDS in each gene varied from five (GmPIF3e) to eight (GmPIF1d and GmPIF1e). The quantity of exons and introns is a crucial marker of the gene family’s evolutionary history, and the makeup of these segments greatly influences a gene’s function. The same type of GmPIF genes generally have a similar number of exons but varying numbers of introns, indicating that intron insertion is a key factor in altering gene structure and may become a key factor in regulating its functional differentiation [39].

2.3. Predicting the Protein Secondary and Tertiary Structure of the GmPIF Gene

The secondary structure prediction revealed that the α-helix content in the proteins encoded by the PIF gene exceeds 0.15. This finding suggests that the secondary structural characteristics of the proteins encoded by the PIF gene are characterized by a relatively high proportion of α-helices. The gene with the largest β-sheet was GmPIF1e, and the gene with the smallest β-sheet was GmPIF7a (Table 2). Secondary structure analysis revealed that the proportion of irregular curls was the highest, followed by α-helix, while extended strands and β-sheet were the lowest. The α-helix was the most stable of all the protein secondary structures. The lower proportion of α-helix in GmPIF indicates lower stability, which is consistent with the higher instability coefficient observed in the physicochemical analysis (Figure 3). The following pairs exhibited similar tertiary structures: GmPIF3a and GmPIF3c, GmPIF4a and GmPIF4c, and GmPIF1d and GmPIF1e. GmPIF1d and GmPIF1e did not have BHLH structural domains, which is consistent with previous results (Figure 2).

2.4. Collinearity Relation of GmPIF

To further elucidate the potential functions of the GmPIFs, their intraspecific homology was analyzed (Figure 4). The 22 GmPIFs were distributed on 13 of the 20 soybean chromosomes, each consisting of one to two GmPIFs. Forty homologous gene pairs of GmPIFs were identified (Supplemental Table S2), of which one or more GmPIF genes existed in homologous gene pairs, with the greatest quantity of GmPIF homologous gene pairs on chromosome 10. The findings indicate that fragment replication events were the primary driver behind the expansion of the GmPIF gene family.

2.5. Interaction Network Analysis of GmPIF Proteins

Protein interaction pairs with a composite score greater than 0.4 (medium) were screened from the STRING website, and interaction network analysis revealed the existence of 456 sets of protein interactions (Figure 5). Most of the proteins interacting with the PIF gene family belong to the photosensitive pigments (PHYB, PHYA, GmCRY1a, and I1MGE5) as well as proteins regulating hormone signaling, such as the GA signaling components (GAI, GAI2, and GAI-Like), and the related proteins of the signaling pathway GRAS (A0A0R0ENH4, I1LCF0, I1KD93, I1JW83, and I1KRT7). GmPIF1a, GmPIF1b, and GmPIF1c are involved in the light signaling pathway. GmPIF3a, GmPIF3j, and GmCRY1a have a cooperative role in blue light-induced signal pathway. GmPIF3i, GmPIF3g, GmPIF3k, GmPIF3b, and GmPIF3h have protein interactions with E3 ubiquitin ligase (A0A0R0IMJ3). GmPIF3b, GmPIF3h, and GmPIF3j exist in a regulatory network with FKF1 during cellulose synthesis. GmPIF3j and GmPIF4a interact with FT proteins involved in flower morphogenesis, and GmPIF7a is shown to interact with photochromes in the network interactions diagram; however, the proteins which GmPIF7b interacts with are hormone-associated regulatory factors that do not interact with photochromes. In summary, GmPIFs are widely involved in the complex processes of multiple regulatory networks through interactions with different functional proteins and related transcription factors.

2.6. Expression Analysis of GmPIF Family Genes in Different Temperature Environments

The levels of GmPIF3h and GmPIF3f expression varied significantly between HCK and LCK (Figure 6). Furthermore, higher expression levels of GmPIF3f were observed in the HCK and HBR groups, whereas lower expression levels were observed in the other six groups. In addition, GmPIF1a, GmPIF1d, and GmPIF7a were downregulated in the HBR and LBR groups. Notably, GmPIF1d and GmPIF7a showed higher expression levels in the HCK and LCK groups, whereas their expression was significantly downregulated in the other six hormone-treated groups. GmPIF3b, GmPIF4c, and GmPIF3f were downregulated only in the HBR group. Furthermore, under both high- and low-temperature conditions, the expression of GmPIF1d, GmPIF4a, and GmPIF7a was downregulated after GA treatment. In contrast, GmPIF3g, GmPIF1c, GmPIF3c, GmPIF4b, GmPIF7b, GmPIF3k, and GmPIF4d were significantly expressed in all three hormone treatments and control groups. Remarkably, the expression level of GmPIF3g significantly increased, highlighting the more critical role of GmPIF3g in the transcriptional regulation of hormone response and temperature regulation.
The response of the PIF genes to different environmental conditions was evident from the observed variations in their expression levels with changes in temperature and hormone treatment. These results suggest that the GmPIF gene family, similar to its function in Arabidopsis [40], has a significant part in responding to temperature fluctuations. Additionally, the expression patterns of PIF genes indicate that they are regulated by hormones.

2.7. Cis-Acting Element Analysis of the GmPIF Promoter

Through the analysis of the homologous elements of the GmPIF gene family promoters, the GmPIF promoter is classified into four categories: light, hormone, stress, and growth-related elements (Figure 7). There were twenty light-responsive elements, including BOX–4 (ATTAAT); seven hormone-responsive elements; five stress-responsive elements; and three cis-acting elements related to plant growth and development. GmPIF3 had the highest number (22) of photo-responsive elements. Meanwhile, GmPIF1a and GmPIF3c had the highest number (14) of hormone-responsive elements, followed by GmPIF3b, with 12. GmPIF3g contained nine abiotic stress response elements. In total, 15, 17, 12, 11, and 8 genes were identified in MeJA reactivity (CGTCA and TGACG motifs), ABA reactivity, SA reactivity, GA reactivity (GARE and TCCC motifs), and growth hormone reactivity (TGA element). The promoter regions of GmPIF3c and GmPIF3g contain hormone responsive elements, such as MeJA, ABA, GA, IAA, and SA. The presence of these components reveals the potential regulatory roles of GmPIF3c and GmPIF3g in plant hormone signaling. The GmPIF promoter also contained a number of elements linked to plant growth and development, including cis-elements related to maize alcohol-soluble protein metabolism (O2–site), meristem expression (CAT–box), and AT-rich DNA binding protein (AT-rich element)-related cis-elements.

2.8. Identification of GmPIF3g Promoter-Interacting Protein

It is essential to further analyze the transcription factors that bind to the cis-acting elements of the GmPIF3g promoter. By designing two promoter probes with a length of 100 bp, we aim to identify the proteins that interact with these probes and further elucidate the interaction network of GmPIF3g. In this study, a new method for identifying promoter-interacting proteins using biofilm interference technology (BLI) was selected(Figure 8). A comprehensive functional annotation was conducted on 67 identified interacting proteins by searching in the Uniprot database(Figure 9). The 30 major functional proteins were screened that are mainly involved in the following biological processes (Table 3) including cell wall synthesis, growth hormone synthesis, mitochondria, ubiquitin, DNA-binding family protein, signal transduction, and other functions; pendant protein results match predictions from protein interaction networks. The identified protein functioned varied and suggests there are several regulatory factors that interacted with the GmPIF3g promoter. Using the Cell mPLOC database to predict the subcellular localization of the thirty proteins under study, seven were predicted to be located in the nucleus (Table 3).

2.9. Y1H

We use AIPhaFoId3 to predict the possibility of interaction between GmPIF3g and Dof, and the results show that the pTM + ipTM score is higher than 0.5, which shows that there is interaction between GmPIF3g and Dof (Figure 10A). The binding of Dof upstream of the PIF promoter was predicted by AlphaFold Server(https://alphafold.com/) (accessed on 17 May 2024), which we further validated by Y1H (yeast one−hybrid) assay. Y1H assays were carried out to identify the specific binding of the candidate dofto the promoters of PIF. It was found that significant colony growth was observed in all groups on SD/− Ura/− Leu plates, indicating successful transformation and proper functioning of the system (Figure 10B). On the SD/−Ura/−Leu+100 AbA plate, the pPIF AbAi competent state transferred to the pGADT7 empty vector did not grow any colonies, while the p53 AbAi competent state transferred to the pGADT7Rec53 plasmid could grow larger colonies, indicating that the negative and positive controls worked normally in this system. The experimental group transferred with pGADT7 Dof plasmid was able to grow plaques on SD/−Ura/−Leu+100 AbA plates, indicating that PIF interacts with Dof.

3. Discussion

In previous studies, the PIF gene family played a crucial role in plant growth regulation, developmental processes, and response mechanisms to external environmental stimuli [41,42,43,44,45]. In soybean, GmPIF4 had been identified to play an important biological function related to photoperiod and high temperature [46]. The overexpression of GmPIF4 showed intact plant architecture and a faster transition from the flowering stage to the mature stage without yield losses [47]. In this study, a total of 22 GmPIF genes were screened. The similar physical and chemical properties of PIF proteins from various plant species support the hypothesis of their functional similarity [48,49]. The nucleus is where the PIF family’s transcription factors primarily operate. Evolutionary analyses of PIF proteins from soybean, Arabidopsis, maize, and rice were performed. The findings demonstrated that every PIF used in the comparison came from a common ancestor (Figure 1. The GmPIF genes within each subfamily had identical structures (Figure 2). Both GmPIF1d and GmPIF1c were clustered in class 2 and homologous with AtPIF1c, indicating that these PIF factors in the same evolutionary clade likely perform similar functions. It has been postulated that GmPIF1d and GmPIF1c perform the same function as AtPIF1 and are implicated in NAD(P)H dehydrogenase complex-mediated electron transfer for chlororespiration [50]. In contrast, GmPIF4c in class 4 was distantly related to other GmPIF. GmPIF7a and GmPIF7b were homologous to AtPIF7 and AtPIF8 in class 5. We speculated that GmPIF7a and GmPIF7b in class 5 may be involved in epigenetic reprogramming to promote transcriptional responses to shade in Arabidopsis [51]. GmPIF3h, GmPIF3b, and GmPIF3j were located in class 7, and GmPIF4a, GmPIF4b, and GmPIF4d were homologous to AtPIF4 and AtPIF5. PIF4 regulates microtubule organization and mediates high temperature-induced hypocotyl elongation in Arabidopsis [52,53,54]. GmPIF3k, GmPIF3g, and GmPIF3i were homologous to AtPIF3d. The SUMOylation of AtPIF3d leads to a decrease in AtPIF3d activity, which promotes cotyledon expansion, inhibits hypocotyl elongation under red light, and impairs PIF3-mediated gene induction and photoprotection [55]. GmPIF3a, GmPIF3c, GmPIF3d, GmPIF3f, and GmPIF3e clustered in class 12; GmPIF1a, GmPIF1b, and GmPIF1c were homologous to AtPIF1b clustered in class 13. By suppressing photosynthetic genes in the endodermis, AtPIF1b controls the development of plastids. An analysis of the motif and gene structure of the GmPIFs family members revealed that most of the GmPIFs members contained Motif1 (BHLH motif), and all members showed a similar exon–intron distribution pattern, which was similar to that of PIFs in other plant species [56,57,58]. The composition of the UTR and CDS of a gene is important for determining its function. The difference in the number of similar exons and introns within the same type of PIF indicates that the insertion event of introns has an impact on gene structure. This structural change may be a key factor driving functional differentiation among PIF members.
Protein interaction network analyses revealed 453 histone interactions in GmPIFs (Figure 5). GmPIFs can interact with each other as well as with the bHLH (H2EUM8_SOYBN) family of proteins. PIF3 regulates plant morphogenesis through its APB or APA structural domains, where it binds to PhyB or PhyA [59]. Respectively, PIFs play an important role in regulating the synthesis and signaling of GA by inducing the production of GA receptor GID1 and assembling it into GA-GID1 complexes. This complex binds to DELLA protein and promotes the ubiquitination degradation of the PIF protein, thereby inhibiting the activity of PIF in downstream gene transcription and affecting the growth and development process of plants [60,61]. In environments with insufficient light, key transcription factors PIF1, PIF3, and PIF4 in the light signaling pathway interact with upstream genes of FT (flowering time) and CO (CONSTANS) to form a CO-PIF complex that inhibits the binding of CO protein to the FT gene promoter, thereby preventing flowering. On the contrary, under sufficient light conditions, CO-PIF complexes do not form, and CO protein can promote the expression of FT genes, thereby driving the flowering process of plants [11]. These indicate that PIF3 protein plays an important role in the light, temperature, and hormone regulatory networks.
GmPIF3g is highly expressed in samples treated with different light temperatures and hormones. We can better explore the intricate network of soybean internode growth and plant height regulation because GmPIF3g is engaged in the intricate regulatory mechanisms of light temperature and hormones [44]. The pattern and degree of gene expression are significantly influenced by the promoter’s structure and sequence [41], following a more thorough investigation of the cis-regulatory elements of the GmPIF gene’s promoter region. According to the findings, the GmPIF gene’s response elements (Figure 7) closely match those observed in Arabidopsis. Both hormone-responsive and photo-responsive components are present in GmPIF3g. Previous studies have shown that PIF protein controls the ability of plants to tolerate high and low temperatures [48,62,63,64], and how GmPIF3g regulates gene networks under different light and hormone environments. We also investigated the GmPIF3g fishing protein. The promoter region is a key site for gene regulation, which contains specific sites for transcription factor recognition and binding. In this study, we predicted the core region of the GmPIF3g promoter at the MEME site and designed two probes, GmPIF3g1 and GmPIF3g2, to further explore the interaction network of GmPIF3g by identifying proteins that interact with it through promoter probes. We developed a novel method using BLI technology, which offers advantages over the DNA pulldown technology, to identify promoter-interacting proteins [65]. This eliminates the time-consuming steps of isolating and purifying DNA–protein complexes, thereby reducing labor intensity. Additionally, it eliminates the need for extensive protein purification by directly capturing the peptide structure that binds to the DNA probes, thus saving time and resources. We discovered 29 key functional proteins that interact with GmPIF3g using this technique, such as the creation of cell walls, growth hormones, mitochondria, ubiquitination, and signal transmission, depend on these proteins (Table 3). These protein annotations suggest that proteins in several relevant regulatory pathways interact with the GmPIF3g promoter. By utilizing the Cell mPLOC database for subcellular localization prediction, we analyzed and found that out of the thirty identified proteins, seven were predicted to be located in the nucleus. This result suggests that these seven proteins play a major role in nuclear reactions. It has been previously demonstrated that light-activated photosensitive pigments are translocated to the nucleus to interact with PIF proteins, triggering the rapid degradation of PIF proteins [40,63,66]. The eight proteins were also found to be localized in the chloroplasts, and it has been shown that phy–PIF regulates chloroplast development by modulating light and genes. Moreover, PEP (plastid-encoded plastid RNA polymerase) activation in plastids during chloroplast biogenesis is redundantly repressed by multiple PIFs, and light-induced SIG (Small Inducible Gene) factors repressed by PIFs can act as cis-signals to activate PEPs in plastids and induce the expression of plastid photosynthesis genes. The molecular mechanism by which light and PIFs coordinate plastid transcription and nuclear photosynthesis through SIG cis-signaling has been revealed [67]. FRS5, a member of the FAR family, has been confirmed to be involved in the development of cell walls and can regulate the activity of the GmPIF3g promoter [68]. In addition, some transcription factors can bind DNA, RNA, or other proteins to participate in RNA metabolism, gene expression, or protein activity regulation [69,70,71,72].
The research found an interaction between PIF and Dof. We further validated the interaction between PIF and Dof using Y1H. Previous studies have shown that Dof transcription factors not only play an important role in regulating hormone signaling and responding to various biotic and abiotic stresses, but they are also widely involved in regulating various plant biological processes, such as carbon and nitrogen assimilation, dormancy, tissue differentiation, and carbohydrate metabolism [73,74,75,76]. The Arabidopsis DOF transcription factor COG1 in Arabidopsis regulates BR biosynthesis by binding to PIF4 and PIF5 promoters and inducing their expression, ultimately promoting hypocotyl growth. And AtCOG1 relies on light-induced photosensitizers but plays a negative regulatory role in the photosensitizer signaling pathway [77]. The overexpression of AtDOF 5.4/OBP4 leads to dwarfism in Arabidopsis plants by reducing cell size and quantity [78]. DOF protein can also enhance the survival ability of plants in extreme temperature environments. In Brassica plants, BnCDF1 is induced to express at low temperatures, and the overexpression of BnCDF1 enhances the plant’s cold tolerance [79]. DOF transcription factors have also been shown to mediate cell wall injury-induced wound healing and tissue regeneration [80]. All indicate that Dof is crucial in plant light-temperature and hormone signaling pathways. This is crucial for identifying upstream and downstream genes that interact with GmPIF3g, which will help us gain a deeper understanding of the regulatory network of GmPIF3g in light-temperature and hormone integration. Further research on the PIF regulatory network will help determine the roles of these downstream genes in plant development, growth, and environmental adaptation. It will also help identify novel breeding targets for plants. However, further studies are needed to determine how GmPIF3g specifically regulates these target genes and their functional changes under different physiological and environmental conditions. Among the fished proteins, we found an E3 ubiquitin ligase involved in syntaxin degradation, and PIF was modified by phytophosphorylation and degraded by ubiquitination in the light [81]; the precise alterations in this process are not entirely understood, though, and it is unclear if the pathway’s central element is an E3 ubiquitin ligase or a light-inducible protein kinase. These details should be clarified in the future.

4. Materials and Methods

4.1. Plant Materials and Growth Conditions

DN50 seeds provided by Northeast Agricultural University(Harbin, China) were sown in a nutrient bowl (diameter: 10 cm) and kept at 20–30 °C in a light incubator with a 16–8 h light–dark cycle. On the 9th day after germination, the seedlings grew faster throughout the entire elongation period, which is the time point characterized by a faster growth rate under shade conditions (500 μmol m−2s−1). To determine the effect of external hormones on the internode elongation of the soybean seedlings, 5 umol L−1 BR, 500 umol L−1 IAA, and 500 umol L−1 GA solutions were applied, and the epicotyls of the soybean seedlings were sampled 24 h later.

4.2. Physicochemical Property Analysis and Subcellular Localization Prediction of GmPIF

Drawing upon the eight PIF family members present in Arabidopsis. A total of 22 GmPIFs were successfully identified through a comparison with homologous protein sequences that are publicly available on the TAIR website (https://www.arabidopsis.org/) (accessed on 20 December 2022). The gene sequences and protein sequences of the GmPIFs were downloaded from the phytozome website (https://phytozome-next.jgi.doe.gov/) (accessed on 27 December 2022); the physicochemical properties of the soybean PIF proteins, including the number of amino acids, molecular weight, isoelectric point, and chromosomal location [82]. We used Expasy for analysis (http://web.expasy.org) (accessed on 6 January 2023), and the subcellular localization of the GmPIF protein was identified using the PSORT tool (https://psort.hgc.jp/) (accessed on 6 January 2023) [83].

4.3. Phylogenetic Tree Construction, Motif, and Gene Structure

The amino acid sequences of soybeans (GmPIFs), maize (ZmPIFs), rice (OsPIFs), and Arabidopsis thaliana (AtPIFs) were analyzed using the MEGA11.0.13 software. Using the Arabidopsis PIF protein sequence as the template, the protein sequence databases of soybean, maize, and rice were searched to identify homologous proteins to PIF. Full-length sequences of all amino acids were selected, and multiple sequence comparisons were performed in the ClustalW program in the MEGA11.0.13 software. A phylogenetic tree was constructed using the neighbor-joining method, and the reliability of the node statistics in the tree was assessed by performing the bootstrap repetition test 1000 times [84]. Phylogenetic trees were plotted using the ChiPlot software (https://www.chiplot.online/) (accessed on 8 January 2023). The motif of the GmPIF protein was analyzed using MEME version 11.1.1 (http://meme-suite.org/) (accessed on 14 January 2023); the number of motif searches was 10, the length range was 6–100, and the rest of the parameters were defaults [85]. The GmPIF gene was extracted using the Gene Structure View program of the TBtools software (TBtools_windows–x64_1_098667, Jiangsu, China) to visualize the analysis results [86].

4.4. GmPIF Protein Secondary and Tertiary Structure Prediction

The secondary structure information of the GmPIF protein was obtained from the SOPMA (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html) (accessed on 28 January 2023) website [87]. The protein sequences of 22 soybean PIF genes were selected to construct tertiary structure models using the SWISSMODEL (https://swissmodel.expasy.org/) (accessed on 28 January 2023) [88].

4.5. Collinearity Relation of GmPIF

Based on the Ensemble Plants database (https://plants.ensembl.org/index.html) (accessed on 6 February 2023) [89], the DNA sequences, the GFF3 annotated file of soybean, and the linear relationships within soybean species were generated using the TBtools software.

4.6. GmPIF Protein Interaction Network Analysis

The STRING database (https://string-db.org/) (accessed on 8 April 2023)was selected to predict interaction network relationships with the GmPIF gene [30]. Protein and functional information were compared by referring to the UniProt (https://www.uniprot.org/) (accessed on 8 April 2023) and Soybase websites (https://www.soybase.org/) (accessed on 8 April 2023), respectively.

4.7. Quantitative Real-Time PCR Analysis

We extracted total RNA from soybean elongation internodes 24 h after hormone treatment. The quantitative detection of GmPIF gene expression levels after treatment with three exogenous hormones (IAA, GA, and BR) was performed using RT-PCR. The expression levels of GmPIFs from untreated elongating internodes were referred to as the controls (CK). The samples collected from 20 °C were referred to as LCK (no hormone treatment), LIAA (applied with 500 umol L−1 IAA solution), LGA (applied with 500 umol L−1 GA solution), and LBR (applied with 5 umol L−1 BR solution), while the samples collected from 30 °C were referred to as HCK (no hormone treatment), HIAA (applied with 500 umol L−1 IAA solution), HGA (applied with 500 umol L−1 GA solution), and HBR (Applied with 5 umol L−1 BR solution). Use RNA kit to extract RNA from the above samples (E.Z.N.A® Plant RNA Kit, OMEGA, Beijing, China); use a spectrophotometer to check the concentration and integrity of RNA (≥100 ng/L), and calculate the required RNA dosage according to the kit (FSQ-301,TOYOBO, Beijing, China). After the thermal denaturation of RNA at 65 °C for 5 min, it was immediately cooled on ice. The reaction system is shown in Table 4. Reverse transcription to obtain soybean cDAN sequence. The reverse transcription reaction is shown in Table 5. All the primers used for the qRT–PCR analysis are listed in Supplementary Table S3 [90,91]. The preparation of real-time quantitative qRT-PCR (T100TM Thermal Cycler, Bio-Rad; USA) system, Table 6. The real-time quantitative qRT-PCR program settings are shown in Table 7. Each qRT–PCR reaction was performed thrice on three biological replicates (technical replicates), and the transcript levels of GmPIF were calculated based on the 2−ΔΔCt method. The expression level of Actin 11 was used as an internal control to calculate gene expression. The data were analyzed and plotted using the TBtools and Excel software version 2010 [92].

4.8. Analysis of Cis-Acting Elements of the GmPIF Promoter

The promoter sequence up to 2000 bp upstream of the GmPIF gene was downloaded from the Phytozome database and analyzed using the PlantCARE software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) (accessed on 30 April 2023) to predict the type and number of cis-acting elements in the promoter [93]. Visualization was performed using the TBtools software.

4.9. Promoter Probe Preparation of GmPIF3g

The 2000 bp sequence of the GmPIF3g promoter was downloaded from the Phytozome website. The promoter functional elements of the GmPIF3g gene were identified using the MEME (https://meme-suite.org/meme/) (accessed on 2 June 2023). A 100 bp sequence containing the key elements of the promoter was synthesized by Sangon Biotech (Shanghai, China). The single-stranded DNA with biotin-labeled 5′-end and 3′-end was synthesized by the Shanghai Bioengineering Company (Table 8), and the double-stranded DNA probes containing biotin at both ends were synthesized. The components of the annealing reaction system were as follows: 40 μL of nuclease-free water, 20 μL of annealing buffer for DNA oligos (5×), 20 μL of oligoA, and 20 μL of oligoB. The annealing reaction was performed in a gene-amplifying instrument (Veriti; Thermo Fisher Scientific, Waltham, MA, USA) with the following procedure: (1) The annealing reaction was performed at 95 °C for 2 min. (2) The reaction rate was decreased by 0.1 °C every 8 s to 25 °C, which took approximately 90 min.

4.10. Extraction of Total Soybean Protein

The total protein from the elongating internodes of the soybean samples was extracted using a cytosolic and cytoplasmic protein extraction kit (Beyoutime, Shanhai; China). Firstly, we took 60 mg of elongated internodes and cut them into small pieces. We mixed them with cytoplasmic protein extraction reagent AB [cytoplasmic protein reagent A (P0027–1) and cytoplasmic protein reagent B (P0027–2)] in a ratio of 20:1 (by volume). Afterwards, the tissues were homogenized on ice and transferred to a sterile centrifuge tube in an ice bath for 15 min; this step was repeated for another 15 min. Subsequently, the tissues were centrifuged at 15,000 rpm for 5 min at 4 °C, and the supernatant was aspirated to obtain cytoplasmic proteins. Ten volumes of cytosolic protein extract A1 [PMSF was added to cytosolic protein reagent A (P0027–1)] were added to the precipitate to reach the final concentration of 1 mmol/L. The tubes were shaken vigorously for 5 s and placed in an ice bath for 15 min; then, we added 10 μL of cytoplasmic protein extract B and kept it in an ice bath for 1 min. The solution was centrifuged at 13,000 rpm for 5 min at 4 °C after vortexing for 5 s. The cytoplasmic proteins were extracted by moving the supernatant to a fresh centrifuge tube. The final concentration of 1 mmol/L was then reached by adding 50 μL of cytosolic protein extract C [PMSF was added to cytosolic protein reagent (P0027–3)], and the supernatant was centrifuged at 13,000 rpm for 10 min at 4 °C. Finally, we transferred the supernatant cytoplasmic protein to a sterile centrifuge tube.

4.11. Fishing Proteins to Interact with GmPIF3

Fishing for proteins interacting with GmPIF3 was conducted using a biolayer interferometry platform (Octet RED96; Pall, Port Washington, NY, USA). First, two activated streptavidin sensors with 200 μL of TE buffer were prepared. Then, two 200 μL (100 μg/mL) of biotin-labeled DNA, 400 μL of TE buffer, 200 μL of protein solution, 200 μL of protein solvent, and 200 μL of aqueous 0.1% formic acid by volume percent were prepared and added to the different wells of a 96-well plate in front-to-back order. Afterwards, the sensors were set to undergo baseline equilibration in TE buffer for 60 s. Subsequently, the sensors were immobilized in the wells and spiked with different DNA probes for 60 s; curing was completed after 60 s. The sensors were then fixed in the wells with different DNA probes. Then, the sensors with the immobilized probes as described above continued to undergo baseline equilibration in protein solvent for 60 s. Subsequently, the sensors with the immobilized probes were saturated bound (pendant) with 200 μL of the protein solution; after sufficient binding, the proteins bound to the different probe wells corresponding to the binding curves were eluted off separately using an elution solution (aqueous solution with a v/v ratio of 0.1% formic acid) to obtain the elution product, which was the protein containing the solution of the protein interacting with the promoter.

4.12. Mass Spectrometry Identification

Fishing proteins were identified using a high-resolution Q Exactive plus hybrid quadrupole-Orbitrap mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA). The identified peptide sequences were searched to match the proteins on the UniProt website (https://www.uniprot.org/) (accessed on 8 August 2023). The subcellular localization of the fished proteins was predicted using the cell–Ploc website (http://www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc-2/) (accessed on 8 August 2023) [94].

4.13. Y1H

DNA binding sites were identified and analyzed by analyzing the expression of reporter genes in yeast cells [95]. Single colonies of p53-AbAi and pPIF-AbAi were picked and connected to YPDA liquid medium, respectively, and a small number of feelers were prepared. p53-AbAi feelers were single-transfected with pGADT7-Rec53 plasmid as a positive control. pPIF-AbAi feelers were single-transfected with pGADT7 and pGADT7-Dof plasmid, respectively, and the ones transfected with the empty pGADT7 were the negative control, and the latter was the experimental group. After the transformation was completed, the plasmids were coated on SD/-Ura/-Leu plates without AbA and SD/-Ura/-Leu plates with the lowest AbA inhibitory concentration and incubated at 30 °C for 4–5 days for observation. The six monoclones were picked from SD/-Ura/-Leu plates and added to 100 µL of 0.9% NaCl and mixed by shaking, and then spotted onto SD/-Ura/-Leu and the lowest AbA inhibitory concentration of SD/-Ura/-Leu plate, each with 5 µL of bacterial solution, incubated at 30 °C for 4–5 days (Boyuan Biological Company, Wuhan, China) [96].

5. Conclusions

In this study, we conducted bioinformatics analysis on the GmPIF gene family and investigated the effects of GA, BR, and IAA hormone treatments on changes in GmPIF gene expression under different environmental conditions. Our results revealed that GmPIF3 was significantly expressed, prompting us to develop a new method to identify the reciprocal proteins of GmPIF3. This allowed us to establish a network of Dof-GmPIF3-regulated genes. While our findings provide valuable insights into the molecular function of GmPIF3, further research is necessary to gain a more comprehensive understanding of its role in plant growth and development.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms26020551/s1.

Author Contributions

Z.J. and X.L. designed the study. Z.J., X.L. and Z.L. wrote the initial draft of the manuscript. Z.J., X.L., C.Z., D.H., Q.C., J.C. and M.Y. contributed to data collection, analysis, and interpretation of the data. All authors have read and agreed to the published version of the manuscript.

Funding

This study is financially supported by the Science and Technology Innovation 2030—Major project, biological breeding technology application and germplasm innovation of high-oil and high-yield soybeans in northern Northeast China No. 2023ZD0403101 and the Chinese National Natural Science Foundation No. 32172072, 31571693 and Joint Funds of the Natural Science Foundation of Heilongjiang Province of China (LH2021C025).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Written informed consent has been obtained from the patient(s) to publish this paper.

Data Availability Statement

Data are not available due to privacy or moral restrictions.

Acknowledgments

Thanks to all the researchers for their efforts.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Leivar, P.; Monte, E. PIFs: Systems integrators in plant development. Plant Cell 2014, 26, 56–78. [Google Scholar] [CrossRef] [PubMed]
  2. Huai, J.; Zhang, X.; Li, J.; Ma, T.; Zha, P.; Jing, Y.; Lin, R. SEUSS and PIF4 coordinately regulate light and temperature signaling pathways to control plant growth. Mol. Plant 2018, 11, 928–942. [Google Scholar] [CrossRef]
  3. Leivar, P.; Quail, P.H. PIFs: Pivotal components in a cellular signaling hub. Trends Plant Sci. 2011, 16, 19–28. [Google Scholar] [CrossRef] [PubMed]
  4. Leivar, P.; Monte, E.; Al-Sady, B.; Carle, C.; Storer, A.; Alonso, J.M.; Ecker, J.R.; Quail, P.H. The Arabidopsis phytochrome–interacting factor PIF7, together with PIF3 and PIF4, regulates responses to prolonged red light by modulating phyB levels. Plant Cell 2008, 20, 337–352. [Google Scholar] [CrossRef] [PubMed]
  5. Leivar, P.; Tepperman, J.M.; Monte, E.; Calderon, R.H.; Liu, T.L.; Quail, P.H. Definition of early transcriptional circuitry involved in light–induced reversal of PIF–imposed repression of photomorphogenesis in young Arabidopsis seedlings. Plant Cell 2009, 21, 3535–3553. [Google Scholar] [CrossRef] [PubMed]
  6. Lyu, X.; Cheng, Q.; Qin, C.; Li, Y.; Liu, B. GmCRY1s modulate gibberellin metabolism to regulate Soybean shade avoidance in response to reduced blue light. Mol. Plant 2020, 14, 298–314. [Google Scholar] [CrossRef] [PubMed]
  7. Huq, E.; Al-Sady, B.; Hudson, M.; Kim, C.; Apel, K.; Quail, P.H. Phytochrome–interacting factor 1 is a critical bHLH regulator of chlorophyll biosynthesis. Science 2004, 305, 1937–1941. [Google Scholar] [CrossRef] [PubMed]
  8. Wang, Z.; Wang, W.; Zhao, D.; Song, Y.; Lin, X.; Shen, M.; Chi, C.; Xu, B.; Zhao, J.; Deng, X.W.; et al. Light-induced remodeling of phytochrome B enables signal transduction by phytochrome-interacting factor. Cell 2024, 187, 6235–6250.E19. [Google Scholar] [CrossRef]
  9. Legris, M.; Nieto, C.; Sellaro, R.; Prat, S.; Casal, J.J. Perception and signalling of light and temperature cues in plants. Plant J. 2017, 90, 683–697. [Google Scholar] [CrossRef]
  10. Oh, E.; Zhu, J.Y.; Wang, Z.Y. Interaction between BZR1 and PIF4 integrates brassinosteroid and environmental responses. Nat. Cell Biol. 2012, 14, 802–809. [Google Scholar] [CrossRef]
  11. Feng, S.; Martinez, C.; Gusmaroli, G.; Wang, Y.U.; Zhou, J.; Wang, F.; Chen, L.; Yu, L.; Iglesias-Pedraz, J.M.; Kircher, S.; et al. Coordinated regulation of Arabidopsis thaliana development by light and gibberellins. Nature 2008, 451, 475–479. [Google Scholar] [CrossRef] [PubMed]
  12. Kumar, S.V.; Lucyshyn, D.; Jaeger, K.E.; Alós, E.; Alvey, E.; Harberd, N.P.; Wigge, P.A. Transcription factor PIF4 controls the thermosensory activation of flowering. Nature 2012, 484, 242–245. [Google Scholar] [CrossRef]
  13. Galvão, V.C.; Collani, S.; Horrer, D.; Schmid, M. Gibberellic acid signaling is required for ambient temperature-mediated induction of flowering in Arabidopsis thaliana. Plant J. 2015, 84, 949–962. [Google Scholar] [CrossRef] [PubMed]
  14. Kim, K.; Jeong, J.; Kim, J.; Lee, N.; Kim, M.E.; Lee, S.; Kim, S.C.; Choi, G. PIF1 regulates plastid development by repressing photosynthetic genes in the endodermis. Mol. Plant 2016, 9, 1415–1427. [Google Scholar] [CrossRef] [PubMed]
  15. Sun, W.; Han, H.; Deng, L.; Sun, C.; Xu, Y.; Lin, L.; Ren, P.R.; Zhao, J.H.; Zhai, Q.Z.; Li, C. Mediator subunit MED25 physically interacts with PHYTOCHROME INTERACTING FACTOR4 to regulate shade–induced hypocotyl elongation in tomato. Plant Physiol. 2020, 184, 1549–1562. [Google Scholar] [CrossRef] [PubMed]
  16. Li, K.; Yu, R.; Fan, L.M.; Wei, N.; Chen, H.; Deng, X.W. DELLA–mediated PIF degradation contributes to coordination of light and gibberellin signalling in Arabidopsis. Nat. Commun. 2016, 7, 11868. [Google Scholar] [CrossRef] [PubMed]
  17. De Lucas, M.; Daviere, J.M.; Rodríguez-Falcón, M.; Pontin, M.; Iglesias-Pedraz, J.M.; Lorrain, S.; Fankhauser, C.; Blázquez, N.A.; Titarenko, E.; Prat, S. A molecular framework for light and gibberellin control of cell elongation. Nature 2008, 451, 480–484. [Google Scholar] [CrossRef] [PubMed]
  18. Rizza, A.; Walia, A.; Lanquar, V.; Frommer, W.B.; Jones, A.M. In vivo gibberellin gradients visualized in rapidly elongating tissues. Nat. Plants 2017, 3, 803–813. [Google Scholar] [CrossRef]
  19. Liang, S.; Gao, X.; Wang, Y.; Zhang, H.; Yin, K.; Chen, S.; Zhang, M.; Zhao, R. Phytochrome–interacting factors regulate seedling growth through ABA signaling. Biochem. Biophys. Res. Commun. 2020, 526, 1100–1105. [Google Scholar] [CrossRef] [PubMed]
  20. Michaud, O.; Krahmer, J.; Galbier, F.; Lagier, M.; Galvão, V.C.; Ince, Y.Ç.; Trevisan, M.; Knerova, J.; Dickinson, P.; Hibberd, J.M.; et al. Abscisic acid modulates neighbor proximity–induced leaf hyponasty in Arabidopsis. Plant Physiol. 2023, 191, 542–557. [Google Scholar] [CrossRef] [PubMed]
  21. Wang, J.; Sun, N.; Zheng, L.; Zhang, F.; Xiang, M.; Chen, H.; Deng, X.W.; Wei, N. Brassinosteroids promote etiolated apical structures in darkness by amplifying the ethylene response via the EBF–EIN3/PIF3 circuit. Plant Cell 2023, 35, 390–408. [Google Scholar] [CrossRef] [PubMed]
  22. Guo, Y.; Deng, C.; Feng, G.; Liu, D. Genome-wide analysis of phytochrome-interacting factor (PIF) families and their potential roles in light and gibberellin signaling in Chinese pine. BMC Genom. 2024, 25, 1017. [Google Scholar] [CrossRef]
  23. Yang, D.L.; Yao, J.; Mei, C.S.; Tong, X.H.; Zeng, L.J.; Li, Q.; Xiao, L.T.; Sun, T.; Li, J.; Deng, X. Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling cascade. Proc. Natl. Acad. Sci. USA 2012, 109, E1192–E1200. [Google Scholar] [CrossRef] [PubMed]
  24. Casal, J.J. Plant growth: Sentinel leaf tip communicates the shade threat to its base. Curr. Biol. 2023, 33, R25–R27. [Google Scholar] [CrossRef] [PubMed]
  25. Ljung, K.; Nemhauser, J.L.; Perata, P. New mechanistic links between sugar and hormone signalling networks. Curr. Opin. Plant Biol. 2015, 25, 130–137. [Google Scholar] [CrossRef] [PubMed]
  26. Jeong, J.; Choi, G. Phytochrome–interacting factors have both shared and distinct biological roles. Mol. Cells 2013, 35, 371–380. [Google Scholar] [CrossRef] [PubMed]
  27. Hauvermale, A.L.; Ariizumi, T.; Steber, C.M. Gibberellin signaling: A theme and variations on DELLA repression. Plant Physiol. 2012, 160, 83–92. [Google Scholar] [CrossRef] [PubMed]
  28. Whitehouse, A.S.; Tisdale, M.J. Increased expression of the ubiquitin–proteasome pathway in murine myotubes by proteolysis-inducing factor (PIF) is associated with activation of the transcription factor NF-κB. Br. J. Cancer 2003, 89, 1116–1122. [Google Scholar] [CrossRef] [PubMed]
  29. Arana, M.V.; Marín-de la Rosa, N.; Maloof, J.N.; Blázquez, M.A.; Alabadí, D. Circadian oscillation of gibberellin signaling in Arabidopsis. Proc. Natl. Acad. Sci. USA 2011, 108, 9292–9297. [Google Scholar] [CrossRef] [PubMed]
  30. Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P.; et al. The STRING database in 2021: Customizable protein–protein networks, and functional characterization of user–uploaded gene/measurement sets. Nucleic Acids Res. 2021, 49, D605–D612. [Google Scholar] [CrossRef] [PubMed]
  31. Zhang, Z.; Zhu, J.Y.; Roh, J.; Marchive, C.; Kim, S.K.; Meyer, C.; Sun, Y.; Wang, W.F.; Wang, Z.Y. TOR signaling promotes accumulation of BZR1 to balance growth with carbon availability in Arabidopsis. Curr. Biol. 2016, 26, 1854–1860. [Google Scholar] [CrossRef]
  32. Jia, D.; Chen, L.G.; Yin, G.; Yang, X.; Gao, Z.; Guo, Y.; Sun, Y.; Tang, W. Brassinosteroids regulate outer ovule integument growth in part via the control of INNER NO OUTER by BRASSINOZOLE-RESISTANT family transcription factors. J. Integr. Plant Biol. 2020, 62, 1093–1111. [Google Scholar] [CrossRef]
  33. Bernardo-García, S.; de Lucas, M.; Martínez, C.; Espinosa-Ruiz, A.; Daviere, J.M.; Prat, S. BR–dependent phosphorylation modulates PIF4 transcriptional activity and shapes diurnal hypocotyl growth. Genes Dev. 2014, 28, 1681–1694. [Google Scholar] [CrossRef] [PubMed]
  34. Hao, Y.; Zong, X.; Ren, P.; Qian, Y.; Fu, A. Basic Helix–Loop–Helix (bHLH) transcription factors regulate a wide range of functions in Arabidopsis. Int. J. Mol. Sci. 2021, 22, 7152. [Google Scholar] [CrossRef] [PubMed]
  35. Zhu, J.Y.; Oh, E.; Wang, T.; Wang, Z.Y. TOC1–PIF4 interaction mediates the circadian gating of thermoresponsive growth in Arabidopsis. Nat. Commun. 2016, 7, 13692. [Google Scholar] [CrossRef] [PubMed]
  36. Tatematsu, K.; Kumagai, S.; Muto, H.; Sato, A.; Watahiki, M.K.; Harper, R.M.; Liscum, E.; Yamamoto, K.T. MASSUGU2 encodes Aux/IAA19, an auxin-regulated protein that functions together with the transcriptional activator NPH4/ARF7 to regulate differential growth responses of hypocotyl and formation of lateral roots in Arabidopsis thaliana. Plant Cell 2004, 16, 379–393. [Google Scholar] [CrossRef] [PubMed]
  37. Saud, S.; Shi, Z.; Xiong, L.; Danish, S.; Datta, R.; Ahmad, I.; Fahad, F.; Banout, J. Recognizing the basics of phytochrome-interacting factors in plants for abiotic stress tolerance. Plant Stress 2022, 3, 100050. [Google Scholar] [CrossRef]
  38. Jiang, Z.F.; Liu, D.D.; Wang, T.Q.; Liang, X.L.; Cui, Y.H.; Liu, Z.H.; Li, W.B. Concentration difference of Auxin involved in stem development in Soybean. J. Integr. Agric. 2020, 19, 953–964. [Google Scholar] [CrossRef]
  39. Xu, G.; Guo, C.; Shan, H.; Kong, H. Divergence of duplicate genes in exon–intron structure. Proc. Natl. Acad. Sci. USA 2012, 109, 1187–1192. [Google Scholar] [CrossRef]
  40. Nie, N.; Huo, J.; Sun, S.; Zuo, Z.; Chen, Y.; Liu, Q.; He, S.Z.; Gao, S.P.; Zhang, H.; Zhao, N.; et al. Genome–Wide Characterization of the PIFs Family in Sweet Potato and Functional Identification of IbPIF3.1 under Drought and Fusarium Wilt Stresses. Int. J. Mol. Sci. 2023, 24, 4092. [Google Scholar] [CrossRef] [PubMed]
  41. Rach, E.A.; Winter, D.R.; Benjamin, A.M.; Corcoran, D.L.; Ni, T.; Zhu, J.; Ohler, U. Transcription initiation patterns indicate divergent strategies for gene regulation at the chromatin level. PLoS Genet. 2011, 7, e1001274. [Google Scholar] [CrossRef] [PubMed]
  42. Wolters, H.; Jürgens, G. Survival of the flexible: Hormonal growth control and adaptation in plant development. Nat. Rev. Genet. 2009, 10, 305–317. [Google Scholar] [CrossRef]
  43. Xu, Y.; Zhu, Z. PIF4 and PIF4–interacting proteins: At the nexus of plant light, temperature and hormone signal integrations. Int. J. Mol. Sci. 2021, 22, 10304. [Google Scholar] [CrossRef]
  44. Yang, Q.; Lin, G.; Lv, H.; Wang, C.; Yang, Y.; Liao, H. Environmental and genetic regulation of plant height in soybean. BMC Plant Biol. 2021, 21, 1–15. [Google Scholar] [CrossRef] [PubMed]
  45. Zhang, L.; He, G.; Li, Y.; Yang, Z.; Liu, T.; Xie, X.; Kong, X.Y.; Sun, J. PIL transcription factors directly interact with SPLs and repress tillering/branching in plants. New Phytol. 2022, 233, 1414–1425. [Google Scholar] [CrossRef] [PubMed]
  46. Arya, H.; Singh, M.B.; Bhalla, P.L. Genomic and molecular analysis of conserved and unique features of soybean PIF4. Sci. Rep. 2018, 8, 12569. [Google Scholar] [CrossRef] [PubMed]
  47. Arya, H.; Singh, M.B.; Bhalla, P.L. Overexpression of PIF4 affects plant morphology and accelerates reproductive phase transitions in soybean. Food Energy Secur. 2021, 10, e291. [Google Scholar] [CrossRef]
  48. Shor, E.; Paik, I.; Kangisser, S.; Green, R.; Huq, E. PHYTOCHROME INTERACTING FACTORS mediate metabolic control of the circadian system in Arabidopsis. New Phytol. 2017, 215, 217–228. [Google Scholar] [CrossRef] [PubMed]
  49. Chen, S.; Wang, Y.; Yu, L.; Zheng, T.; Wang, S.; Yue, Z.; Jiang, J.; Kumari, S.; Zheng, C.F.; Tang, H.B.; et al. Genome sequence and evolution of Betula platyphylla. Hortic. Res. 2021, 8. [Google Scholar] [CrossRef] [PubMed]
  50. Wang, D.; Portis, A.R., Jr. A novel nucleus–encoded chloroplast protein, PIFI, is involved in NAD (P) H dehydrogenase complex–mediated chlororespiratory electron transport in Arabidopsis. Plant Physiol. 2007, 144, 1742–1752. [Google Scholar] [CrossRef]
  51. Yang, C.; Zhu, T.; Zhou, N.; Huang, S.; Zeng, Y.; Jiang, W.; Xie, Y.; Shen, W.H.; Li, L. PIF7-mediated epigenetic reprogramming promotes the transcriptional response to shade in Arabidopsis. EMBO J. 2023, 42, e111472. [Google Scholar] [CrossRef] [PubMed]
  52. Zhang, Y.; Verhoeff, N.I.; Chen, Z.; Chen, S.; Wang, M.; Zhu, Z.; Ouwerkerk, P.B.F. Functions of OsDof25 in regulation of OsC4PPDK. Plant Mol. Biol. 2015, 89, 229–242. [Google Scholar] [CrossRef] [PubMed]
  53. Li, N.; Bo, C.; Zhang, Y.; Wang, L. PHYTOCHROME INTERACTING FACTORS PIF4 and PIF5 promote heat stress induced leaf senescence in Arabidopsis. J. Exp. Bot. 2021, 72, 4577–4589. [Google Scholar] [CrossRef] [PubMed]
  54. Zhou, D.; Wang, X.; Wang, X.; Mao, T. PHYTOCHROME INTERACTING FACTOR 4 regulates microtubule organization to mediate high temperature–induced hypocotyl elongation in Arabidopsis. Plant Cell 2023, 35, 2044–2061. [Google Scholar] [CrossRef] [PubMed]
  55. Bernula, P.; Pettkó-Szandtner, A.; Hajdu, A.; Kozma-Bognár, L.; Josse, E.M.; Ádám, É.; Nagy, F.; Viczián, A. SUMOylation of PHYTOCHROME INTERACTING FACTOR 3 promotes photomorphogenesis in Arabidopsis thaliana. New Phytol. 2021, 229, 2050–2061. [Google Scholar] [CrossRef]
  56. Moon, J.; Zhu, L.; Shen, H.; Huq, E. PIF1 directly and indirectly regulates chlorophyll biosynthesis to optimize the greening process in Arabidopsis. Proc. Natl. Acad. Sci. USA 2008, 105, 9433–9438. [Google Scholar] [CrossRef] [PubMed]
  57. Chen, A.; Huang, P.; Guo, S.; Liu, S.; Hu, X.; Liu, X. Comprehensive Analysis of Betula platyphylla Suk. PIF Gene Family and Their Potential Functions in Growth and Development. Int. J. Mol. Sci. 2022, 23, 15326. [Google Scholar] [CrossRef] [PubMed]
  58. Wang, X.; Liu, Y.; Huai, D.; Chen, Y.; Jiang, Y.; Ding, Y.; Kang, Y.P.; Wang, Z.H.; Yan, L.Y.; Jiang, H.F.; et al. Genome–wide identification of peanut PIF family genes and their potential roles in early pod development. Gene 2021, 781, 145539. [Google Scholar] [CrossRef] [PubMed]
  59. Castillon, A.; Shen, H.; Huq, E. Phytochrome interacting factors: Central players in phytochrome–mediated light signaling networks. Trends Plant Sci. 2007, 12, 514–521. [Google Scholar] [CrossRef]
  60. Sun, T. Gibberellin–GID1–DELLA: A pivotal regulatory module for plant growth and development. Plant Physiol. 2010, 154, 567–570. [Google Scholar] [CrossRef]
  61. Sun, T. The molecular mechanism and evolution of the GA–GID1–DELLA signaling module in plants. Curr. Biol. 2011, 21, R338–R345. [Google Scholar] [CrossRef] [PubMed]
  62. Oh, E.; Yamaguchi, S.; Hu, J.; Yusuke, J.; Jung, B.; Paik, I.; Lee, H.S.; Sun, T.P.; Kamiya, Y.J.; Choi, G. PIL5, a phytochrome–interacting bHLH protein, regulates gibberellin responsiveness by binding directly to the GAI and RGA promoters in Arabidopsis seeds. Plant Cell 2007, 19, 1192–1208. [Google Scholar] [CrossRef]
  63. Sun, F.; Cheng, H.; Song, Z.; Yan, H.; Liu, H.; Xiao, X.; Zhang, Z.C.; Luo, M.T.; Wu, F.; Lu, J.; et al. Phytochrome-interacting factors play shared and distinct roles in regulating shade avoidance responses in Populus trees. Plant Cell Environ. 2024, 47, 2058–2073. [Google Scholar] [CrossRef] [PubMed]
  64. Qiu, Y.; Li, M.; Kim RJ, A.; Moore, C.M.; Chen, M. Daytime temperature is sensed by phytochrome B in Arabidopsis through a transcriptional activator HEMERA. Nat. Commun. 2019, 10, 140. [Google Scholar] [CrossRef]
  65. Jutras, B.L.; Verma, A.; Stevenson, B. Identification of novel DNA-binding proteins using DNA-affinity chromatography/pull down. Curr. Protoc. Microbiol. 2012, 24, 1F.1.1–1F.1.13. [Google Scholar] [CrossRef] [PubMed]
  66. Ni, M.; Tepperman, J.M.; Quail, P.H. PIF3, a phytochrome–interacting factor necessary for normal photoinduced signal transduction, is a novel basic helix–loop–helix protein. Cell 1998, 95, 657–667. [Google Scholar] [CrossRef] [PubMed]
  67. Dong, J.; Ni, W.; Yu, R.; Deng, X.W.; Chen, H.; Wei, N. Light–dependent degradation of PIF3 by SCFEBF1/2 promotes a photomorphogenic response in Arabidopsis. Curr. Biol. 2017, 27, 2420–2430. [Google Scholar] [CrossRef]
  68. Iberkleid, I.; Sela, N.; Brown Miyara, S. Meloidogyne javanica fatty acid-and retinol-binding protein (Mj-FAR-1) regulates expression of lipid-, cell wall-, stress-and phenylpropanoid-related genes during nematode infection of tomato. BMC Genom. 2015, 16, 1–26. [Google Scholar] [CrossRef]
  69. Tsai, R.Y.; Reed, R.R. Identification of DNA recognition sequences and protein interaction domains of the multiple-Zn-finger protein Roaz. Mol. Cell Biol. 1998, 18, 6447–6456. [Google Scholar] [CrossRef]
  70. Gamsjaeger, R.; Liew, C.K.; Loughlin, F.E.; Crossley, M.; Mackay, J.P. Sticky fingers: Zinc-fingers as protein-recognition motifs. Trends Biochem. Sci. 2007, 32, 63–70. [Google Scholar] [CrossRef] [PubMed]
  71. Lee, B.M.; Xu, J.; Clarkson, B.K.; Martinez-Yamout, M.A.; Dyson, H.J.; Case, D.A.; Gottesfeld, J.M.; Wright, P.E. Induced fit and “lock and key” recognition of 5S RNA by zinc fingers of transcription factor IIIA. J. Mol. Biol. 2006, 357, 275–291. [Google Scholar] [CrossRef]
  72. Czarnocka, W.; Van Der Kelen, K.; Willems, P.; Szechyńska-Hebda, M.; Shahnejat-Bushehri, S.; Balazadeh, S.; Balazadeh, S.; Rusaczonek, A.; Mueller-Roeber, B.; Breusegem, F.V.; et al. The dual role of LESION SIMULATING DISEASE 1 as a condition-dependent scaffold protein and transcription regulator. Plant Cell Environ. 2017, 40, 2644–2662. [Google Scholar] [CrossRef] [PubMed]
  73. Chen, M.; Liu, X.; Huan, L.; Sun, M.; Liu, L.; Chen, X.; Gao, D.S.; Li, L. Genome-wide analysis of Dof family genes and their expression during bud dormancy in peach (Prunus persica). Sci. Hortic. 2017, 214, 18–26. [Google Scholar] [CrossRef]
  74. Ramachandran, V.; Tobimatsu, Y.; Masaomi, Y.; Sano, R.; Umezawa, T.; Demura, T.; Ohtani, M. Plant-specific Dof transcription factors VASCULAR-RELATED DOF1 and VASCULAR-RELATED DOF2 regulate vascular cell differentiation and lignin biosynthesis in Arabidopsis. Plant Mol. Biol. 2020, 104, 263–281. [Google Scholar] [CrossRef] [PubMed]
  75. Kurai, T.; Wakayama, M.; Abiko, T.; Yanagisawa, S.; Aoki, N.; Ohsugi, R. Introduction of the ZmDof1 gene into rice enhances carbon and nitrogen assimilation under low-nitrogen conditions. Plant Biotechnol. J. 2011, 9, 826–837. [Google Scholar] [CrossRef]
  76. Tanaka, M.; Takahata, Y.; Nakayama, H.; Nakatani, M.; Tahara, M. Altered carbohydrate metabolism in the storage roots of sweetpotato plants overexpressing the SRF1 gene, which encodes a Dof zinc finger transcription factor. Planta 2009, 230, 737–746. [Google Scholar] [CrossRef] [PubMed]
  77. Wei, Z.; Zhang, H.; Fang, M.; Lin, S.; Zhu, M.; Li, Y.; Jiang, L.; Cui, T.L.; Cui, L.W.; Kui, H.; et al. The Dof transcription factor COG1 acts as a key regulator of plant biomass by promoting photosynthesis and starch accumulation. Mol. Plant 2023, 16, 1759–1772. [Google Scholar] [CrossRef] [PubMed]
  78. Sun, S.; Wang, B.; Jiang, Q.; Li, Z.; Jia, S.; Wang, Y.; Guo, H. Genome-wide analysis of BpDof genes and the tolerance to drought stress in birch (Betula platyphylla). PeerJ 2021, 9, e11938. [Google Scholar] [CrossRef] [PubMed]
  79. Xu, J.; Dai, H. Brassica napus Cycling Dof Factor1 (BnCDF1) is involved in flowering time and freezing tolerance. Plant Growth Regul. 2016, 80, 315–322. [Google Scholar] [CrossRef]
  80. Zhang, A.; Matsuoka, K.; Kareem, A.; Robert, M.; Roszak, P.; Blob, B.; Bisht, A.; Veylder, L.D.; Voiniciuc, C.; Asahina, M.; et al. Cell-wall damage activates DOF transcription factors to promote wound healing and tissue regeneration in Arabidopsis thaliana. Curr. Biol. 2022, 32, 1883–1894.e7. [Google Scholar] [CrossRef]
  81. Liu, W.; Lowrey, H.; Xu, A.; Leung, C.C.; Adamchek, C.; He, J.; Du, J.; Chen, M.; Gendron, J.M. A circadian clock output functions independently of phyB to sustain daytime PIF3 degradation. Proc. Natl. Acad. Sci. USA 2024, 121, e2408322121. [Google Scholar] [CrossRef]
  82. Artimo, P.; Jonnalagedda, M.; Arnold, K.; Baratin, D.; Csardi, G.; De Castro, E.; Duvaud, S.; Flegel, V.; Fortier, V.; Gasteiger, E.; et al. ExPASy: SIB bioinformatics resource portal. Nucleic Acids Res. 2012, 40, W597–W603. [Google Scholar] [CrossRef]
  83. Horton, P.; Park, K.J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35 (Suppl. 2), W585–W587. [Google Scholar] [CrossRef]
  84. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
  85. Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [PubMed]
  86. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
  87. Geourjon, C.; Deleage, G. SOPMA: Significant improvements in protein secondary structure prediction by consensus prediction from multiple alignments. Bioinformatics 1995, 11, 681–684. [Google Scholar] [CrossRef] [PubMed]
  88. Bienert, S.; Waterhouse, A.; De Beer, T.A.; Tauriello, G.; Studer, G.; Bordoli, L.; Schwede, T. The SWISS-MODEL Repository-new features and functionality. Nucleic Acids Res. 2017, 45, D313–D319. [Google Scholar] [CrossRef]
  89. Bolser, D.; Staines, D.M.; Pritchard, E.; Kersey, P. Ensembl plants: Integrating tools for visualizing, mining, and analyzing plant genomics data. Methods Protoc. 2016, 2016, 115–140. [Google Scholar] [CrossRef]
  90. Nolan, T.; Hands, R.E.; Bustin, S.A. Quantification of mRNA using real–time RT–PCR. Nat. Protoc. 2006, 1, 1559–1582. [Google Scholar] [CrossRef] [PubMed]
  91. Quint, M.; Delker, C.; Franklin, K.A.; Wigge, P.A.; Halliday, K.J.; Van Zanten, M. Molecular and genetic control of plant thermomorphogenesis. Nat. Plants 2016, 2, 15190. [Google Scholar] [CrossRef]
  92. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis–acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
  93. Ji, X.; Wang, L.; Zang, D.; Wang, Y. Transcription factor-centered yeast one-hybrid assay. Methods Mol. Biol. 2018, 1794, 183–194. [Google Scholar] [CrossRef] [PubMed]
  94. Chou, K.C.; Shen, H.B. Cell–PLoc 2.0: An improved package of web–servers for predicting subcellular localization of proteins in various organisms. Nat. Sci. 2010, 2, 1090. [Google Scholar] [CrossRef]
  95. Fields, S.; Song, O. A novel genetic system to detect protein–protein interactions. Nature 1989, 340, 245–246. [Google Scholar] [CrossRef] [PubMed]
  96. Yang, G.; Chao, D.; Ming, Z.; Xia, J. A simple method to detect the inhibition of transcription factor-DNA binding due to protein–protein interactions in vivo. Genes 2019, 10, 684. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Phylogenetic analysis of the GmPIF family. Note: Phylogenetic analysis of phytochrome-interacting factor (PIF) family members from rice (Os), maize (Zm), Arabidopsis (At), and soybean (Gm). Color blocks pertaining to the different PIF classes are shown on the right;the red color in the picture highlights the GmPIF family members.
Figure 1. Phylogenetic analysis of the GmPIF family. Note: Phylogenetic analysis of phytochrome-interacting factor (PIF) family members from rice (Os), maize (Zm), Arabidopsis (At), and soybean (Gm). Color blocks pertaining to the different PIF classes are shown on the right;the red color in the picture highlights the GmPIF family members.
Ijms 26 00551 g001
Figure 2. The conserved protein sequence motif of GmPIF family and the gene structure of GmPIF family. Note: protein sequence motifs of members of GmPIF family and gene structure of GmPIF family. Color blocks are displayed on the right.
Figure 2. The conserved protein sequence motif of GmPIF family and the gene structure of GmPIF family. Note: protein sequence motifs of members of GmPIF family and gene structure of GmPIF family. Color blocks are displayed on the right.
Ijms 26 00551 g002
Figure 3. Tertiary structure of the GmPIF family members.
Figure 3. Tertiary structure of the GmPIF family members.
Ijms 26 00551 g003
Figure 4. Collinearity analysis of genes in the GmPIF family. Note: Homology analysis of 22 GmPIF genes. Chromosomes 1–20 are indicated by blue rectangles. Lines, heat maps, and histograms along the rectangles indicate the gene densities on the chromosomes. The red scale shows chromosome lengths in Mb, black highlighted curves show regions of GmPIF covariance, and gray curves show genome-wide covariance in soybeans.
Figure 4. Collinearity analysis of genes in the GmPIF family. Note: Homology analysis of 22 GmPIF genes. Chromosomes 1–20 are indicated by blue rectangles. Lines, heat maps, and histograms along the rectangles indicate the gene densities on the chromosomes. The red scale shows chromosome lengths in Mb, black highlighted curves show regions of GmPIF covariance, and gray curves show genome-wide covariance in soybeans.
Ijms 26 00551 g004
Figure 5. String analysis of the GmPIF family member. Note: Functional interaction networks of GmPIFs in soybean according to orthologs in Arabidopsis. Network nodes represent proteins and lines represent protein–protein associations.
Figure 5. String analysis of the GmPIF family member. Note: Functional interaction networks of GmPIFs in soybean according to orthologs in Arabidopsis. Network nodes represent proteins and lines represent protein–protein associations.
Ijms 26 00551 g005
Figure 6. Expression profiles of GmPIF under different growth regulator treatments. Note: HCK: High-temperature environment blank control; HBR: BR treatment in high-temperature environment; HGA: GA treatment in high-temperature environment; HIAA: IAA treatment in high-temperature environment; LCK: low-temperature environment blank control; LBR: BR treatment in low-temperature environment; LGA: GA treatment in low-temperature environment; LIAA: IAA treatment in low-temperature environment. The results are shown as a heat map, with red indicating high levels of transcription and green indicating low levels of transcription. The icons are shown on the right side, and the outermost color block is the clustering result.
Figure 6. Expression profiles of GmPIF under different growth regulator treatments. Note: HCK: High-temperature environment blank control; HBR: BR treatment in high-temperature environment; HGA: GA treatment in high-temperature environment; HIAA: IAA treatment in high-temperature environment; LCK: low-temperature environment blank control; LBR: BR treatment in low-temperature environment; LGA: GA treatment in low-temperature environment; LIAA: IAA treatment in low-temperature environment. The results are shown as a heat map, with red indicating high levels of transcription and green indicating low levels of transcription. The icons are shown on the right side, and the outermost color block is the clustering result.
Ijms 26 00551 g006
Figure 7. Analysis of cis-acting elements in the promoter region 2 kb upstream of the GmPIF start codon. Note: Number of cis-acting elements in the promoter region 2 kb upstream of the translation start site) of the GmPIF gene. Right stacking diagram of GmPIF. The cis-acting elements were classified into four major categories based on their functional annotations: light, phytohormone responses, abiotic and biotic stress responses, and plant growth and development.
Figure 7. Analysis of cis-acting elements in the promoter region 2 kb upstream of the GmPIF start codon. Note: Number of cis-acting elements in the promoter region 2 kb upstream of the translation start site) of the GmPIF gene. Right stacking diagram of GmPIF. The cis-acting elements were classified into four major categories based on their functional annotations: light, phytohormone responses, abiotic and biotic stress responses, and plant growth and development.
Ijms 26 00551 g007
Figure 8. Fishing for GmPIF3g−interacting protein using the Octet RED96. Note: A2 is the graph of the binding intensity of GmPIF3g1 to the inter−combinant protein, and B2 is a graph of the binding intensity of GmPIF3g1 to the inter−combinant protein solvent. C2 is the binding intensity graph of GmPIF3g1 with the interacting protein, and D2 is the binding intensity graph of GmPIF3g1 with the interacting protein solvent.
Figure 8. Fishing for GmPIF3g−interacting protein using the Octet RED96. Note: A2 is the graph of the binding intensity of GmPIF3g1 to the inter−combinant protein, and B2 is a graph of the binding intensity of GmPIF3g1 to the inter−combinant protein solvent. C2 is the binding intensity graph of GmPIF3g1 with the interacting protein, and D2 is the binding intensity graph of GmPIF3g1 with the interacting protein solvent.
Ijms 26 00551 g008
Figure 9. Fishing proteins that bind to the GmPIF3g promoter. Note: Yellow circles represent promoters, and purple circles represent proteins bound to promoters.
Figure 9. Fishing proteins that bind to the GmPIF3g promoter. Note: Yellow circles represent promoters, and purple circles represent proteins bound to promoters.
Ijms 26 00551 g009
Figure 10. (A) Prediction of Interaction between PIF and Dof; (B) Yeast monoculture of PIF and Dof.
Figure 10. (A) Prediction of Interaction between PIF and Dof; (B) Yeast monoculture of PIF and Dof.
Ijms 26 00551 g010
Table 1. Physicochemical properties and subcellular localization of the GmPIF gene family.
Table 1. Physicochemical properties and subcellular localization of the GmPIF gene family.
NameGene IDNumber of Amino Acids (aa)Molecular Weight (kD)Isoelectric Point (pI)Chromosome Number LocationInstability IndexSubcellular Localization
GmPIF1aGlyma.03G17030050255.045.86Chr0367.51Nuclear
GmPIF1bGlyma.10G04280048954.025.84Chr1065.8Nuclear
GmPIF1cGlyma.13G13010050956.365.68Chr1362.48Nuclear
GmPIF1dGlyma.07G02990027229.768.05Chr0734.14Nuclear
GmPIF1eGlyma.08G21300027730.326.44Chr0844.53Nuclear
GmPIF3aGlyma.01G18760037540.905.61Chr0176.09Nuclear
GmPIF3bGlyma.03G22500051757.398.75Chr0357.03Nuclear
GmPIF3cGlyma.11G05460038141.505.87Chr1173.06Nuclear
GmPIF3dGlyma.14G08420029732.638.5Chr1468.25Nuclear
GmPIF3eGlyma.17G18080029632.406.4Chr1768.22Nuclear
GmPIF3fGlyma.17G24100016018.489.16Chr1889.58Nuclear
GmPIF3gGlyma.10G14260069174.156.43Chr1059.7Nuclear
GmPIF3hGlyma.10G13880044949.168.33Chr1051.75Nuclear
GmPIF3iGlyma.19G22470063368.915.72Chr1953.17Nuclear
GmPIF3jGlyma.19G22200039543.839.37Chr1951.5Nuclear
GmPIF3kGlyma.20G09120072277.255.95Chr2058.88Nuclear
GmPIF4aGlyma.02G28210056262.236.58Chr0259.27Nuclear
GmPIF4bGlyma.08G30390052557.816.41Chr0854.57Nuclear
GmPIF4cGlyma.14G10220056262.116.97Chr1455.43Nuclear
GmPIF4dGlyma.18G11570054760.536.58Chr1861.23Nuclear
GmPIF7aGlyma.01G07690045849.178.88Chr0147.61Nuclear
GmPIF7bGlyma.03G03400039744.199.41Chr0351.91Nuclear
Table 2. Secondary structure and subcellular localization of GmPIFs.
Table 2. Secondary structure and subcellular localization of GmPIFs.
Nameα-Helixβ-SheetRandom CoilExtended Strand
GmPIF1a27.60%1.99%66.14%4.18%
GmPIF1b29.94%2.24%62.93%4.89%
GmPIF1c26.89%2.52%64.71%5.88%
GmPIF1d15.07%8.64%51.84%24.63%
GmPIF1e18.05%8.66%48.01%25.27%
GmPIF3a24.00%1.33%65.07%9.60%
GmPIF3b21.47%2.13%69.05%7.35%
GmPIF3c25.20%2.36%60.10%12.34%
GmPIF3d23.23%2.36%62.63%11.78%
GmPIF3e32.50%3.12%52.50%11.88%
GmPIF3f27.36%2.70%60.14%9.80%
GmPIF3g17.80%2.17%72.65%7.38%
GmPIF3h26.50%1.11%65.70%6.68%
GmPIF3i21.01%1.90%69.98%7.11%
GmPIF3j28.19%2.90%60.04%8.88%
GmPIF3k19.67%2.35%71.88%6.09%
GmPIF4a21.53%2.85%69.40%6.23%
GmPIF4b23.24%2.10%68.95%5.71%
GmPIF4c21.71%2.14%70.82%5.34%
GmPIF4d21.94%1.83%71.12%5.12%
GmPIF7a27.51%1.09%67.03%4.37%
GmPIF7b33.50%1.51%59.95%5.04%
Table 3. Main functional proteins regulating the GmPIF3g promoter.
Table 3. Main functional proteins regulating the GmPIF3g promoter.
DNAProteinDescriptionSubcellular Localization
GmPIF3g1A0A178UH44Signal recognition particle, endoplasmic reticulum targetingCytoplasm
GmPIF3g1A0A654FBE6Small GTPase-mediated signal transductionGolgi apparatus, nucleus
GmPIF3g1I1LHH9Dof-type zinc finger DNA-binding family proteinNucleus
GmPIF3g1I1M744Response to auxin stimulusNucleus
GmPIF3g1K7L9W3MitochondrionCytoplasm
GmPIF3g1K7LKV8Cellulose synthase (UDP-forming)Chloroplast, Golgi apparatus
GmPIF3g1K7LWI4MitochondrionChloroplast
GmPIF3g1Q0WLB4Floral repressor gene FLOWERING LOCUS C (FLC)Chloroplast nucleus
GmPIF3g2A0A0R0JEC6Steroid biosynthetic processChloroplast, Golgi apparatus
GmPIF3g2Q9ZPT6FRS5; regulation of transcription, DNA-templatedChloroplast
GmPIF3g2A0A0R0JTV5Translation elongation factor EF–1 alpha/Tu Cytoplasm, nucleus
GmPIF3g2A0A0R0KHR2Carbohydrate metabolic processCell membrane
GmPIF3g2A0A178U7H3Folic acid-containing compound metabolic processPeroxisome
GmPIF3g2A0A1P8ATW4Golgi organizationCell membrane, nucleus
GmPIF3g2A0A1P8B118Raumatin and (Z)–3–hexen–1–yl acetate biosynthesisNucleus
GmPIF3g2A0A654G701E3 ubiquitin ligase involved in syntaxin degradationNucleus
GmPIF3g2A0A7G2E5T9Negative regulation of endopeptidase activityVacuole
GmPIF3g2A0A7G2E6Q4Folic acid-containing compound biosynthetic processChloroplast
GmPIF3g2A0A7G2E7M8Protein acetyltransferase complexNucleus
GmPIF3g2A0A7G2F610Ubiquitin activating enzyme 2Nucleus
GmPIF3g2C6TLV3Mitochondrial respiratory chain complex IV assemblyChloroplast peroxisome
GmPIF3g2I1JKS8Secondary metabolite biosynthetic processEndoplasmic reticulum
GmPIF3g2I1LL69Cell wallCell wall
GmPIF3g2I1MMT5Tonoplast monosaccharide transporter3Cell membrane
GmPIF3g2K7KQ57Superpathway of acetyl–CoA biosynthesisChloroplast
GmPIF3g2K7L045Signal transductionCell membrane
GmPIF3g2K7L7Q1Indole–3–acetate activation IEndoplasmic reticulum
GmPIF3g2K7LBX5Signal transductionNucleus
GmPIF3g2K7LWI4Chloroplast plastid thylakoidChloroplast
GmPIF3g2Q5GFS0MitochondrionChloroplast, mitochondrion
Table 4. RNA reaction system.
Table 4. RNA reaction system.
ComponentsThe Amount Every Tube (µL)
5x RT Master Mix
RNA template
2 µL
1 pg−1 μg
Nuclease-free waterTo 10 µL
Table 5. Reverse transcription program.
Table 5. Reverse transcription program.
TemperatureTime
37 °C
15 °C
15 min
5 min
Ijms 26 00551 i001Reverse transcription reaction
98 °C10 sEnzyme inactivation
4 °C∞ (preserve)
Note: After the reaction, store at −20 °C. Real-time PCR, as a template directly or after dilution.
Table 6. qRT-PCR system.
Table 6. qRT-PCR system.
ComponentsThe Amount Every Tube (µL)
GREEN Master Mix10
Primer1 (10 µM)0.5
Primer2 (10 µM)0.5
cDNA template1
ddH2O8
Table 7. qRT-PCR program.
Table 7. qRT-PCR program.
ProgramCycleTemperatureTime
Stage 1
Pre-denaturation
Reps: 195 °C5 min
Stage 2
Cyclic reaction
Reps: 4095 °C10 s
55 °C30 s
Stage 3
Dissolution curve
Machine self-contained
Table 8. Key promoter sequence of GmPIF3g.
Table 8. Key promoter sequence of GmPIF3g.
Primer NamePrimer Sequence
GmPIF3g1–DNA oligoA5′TTGAGTTGACCCCACCAACACAACACACACTTAAGGACTTACGACGACTAATCCCTTTTTGTTTTTTCTTTCTTTCTTTTCTTATTTTTATTCTAACTTA3′
GmPIF3g1–DNA oligoB3′AACTCAACTGGGGTGGTTGTGTTGTGTGTGCCAACCTGAATGCTGCTGATTAGGGAAAAACAAAAAAGAAAGAAAGAAAAGAATAAAAATAAGATTGAAT5′
GmPIF3g2–DNA oligoA5′CTTAAACCACGACAACTTTTGACTAAACCATGGTTAGAACTTAGAAAGTAGAAACCCCTGAATTTCTCACTCTTTTCTGTTCCTGTCTGTCTCTTTTGTG3′
GmPIF3g2–DNA oligoB3′GAATTTGGTGCTGTTGAAAACTGATTTGGTACCAATCTTGAATCTTTCATCTTTGGGGACTTAAAGAGTGAGAAAAGACAAGGACAGACAGAGAAAACAC5′
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liang, X.; Zhao, C.; Cui, J.; Liu, Z.; Han, D.; Chen, Q.; Yang, M.; Jiang, Z. Genome-Wide Identification of GmPIF Family and Regulatory Pathway Analysis of GmPIF3g in Different Temperature Environments. Int. J. Mol. Sci. 2025, 26, 551. https://doi.org/10.3390/ijms26020551

AMA Style

Liang X, Zhao C, Cui J, Liu Z, Han D, Chen Q, Yang M, Jiang Z. Genome-Wide Identification of GmPIF Family and Regulatory Pathway Analysis of GmPIF3g in Different Temperature Environments. International Journal of Molecular Sciences. 2025; 26(2):551. https://doi.org/10.3390/ijms26020551

Chicago/Turabian Style

Liang, Xuefeng, Caitong Zhao, Jiayang Cui, Zhihua Liu, Dezhi Han, Qingshan Chen, Mingliang Yang, and Zhenfeng Jiang. 2025. "Genome-Wide Identification of GmPIF Family and Regulatory Pathway Analysis of GmPIF3g in Different Temperature Environments" International Journal of Molecular Sciences 26, no. 2: 551. https://doi.org/10.3390/ijms26020551

APA Style

Liang, X., Zhao, C., Cui, J., Liu, Z., Han, D., Chen, Q., Yang, M., & Jiang, Z. (2025). Genome-Wide Identification of GmPIF Family and Regulatory Pathway Analysis of GmPIF3g in Different Temperature Environments. International Journal of Molecular Sciences, 26(2), 551. https://doi.org/10.3390/ijms26020551

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop