Genome-Wide Characterization of Extrachromosomal Circular DNA in the Midgut of BmCPV-Infected Silkworms and Its Potential Role in Antiviral Responses
Abstract
1. Introduction
2. Results
2.1. Properties of eccDNA from Silkworm Midguts
2.2. Verification of Silkworm eccDNAs
2.3. The Motifs Flanking the Breaking Points of eccDNA Are Conserved
2.4. Profile of Differential Expression of eccDNAs in the Midguts of Silkworms
2.5. Association of Differentially Expressed Genes (DEGs) with BmCPV-Infection
2.6. Differentially Expressed miRNAs (DEMs) with BmCPV-Infection
2.7. Association Analysis of eccDNA-mRNA/miRNA/circRNA
3. Discussion
4. Materials and Methods
4.1. Sample Preparation
4.2. Circle-Seq
4.3. Validation of eccDNAs
4.4. Motifs of eccDNA Breaking Points
4.5. GO and KEGG Analyses
4.6. RNA-Seq Analysis
4.7. miRNA-Seq Analysis
4.8. Association Analysis of eccDNA-miRNA/circRNA
4.9. RNA Extraction and qPCR Analysis
4.10. Western Blot
4.11. Statistics
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hotta, Y.; Bassel, A. Molecular Size and Circularity of DNA in Cells of Mammals and Higher Plants. Proc. Natl. Acad. Sci. USA 1965, 53, 356–362. [Google Scholar] [CrossRef] [PubMed]
- Hull, R.M.; King, M.; Pizza, G.; Krueger, F.; Vergara, X.; Houseley, J. Transcription-induced formation of extrachromosomal DNA during yeast ageing. PLoS Biol. 2019, 17, e3000471. [Google Scholar] [CrossRef] [PubMed]
- Shoura, M.J.; Gabdank, I.; Hansen, L.; Merker, J.; Gotlib, J.; Levene, S.D.; Fire, A.Z. Intricate and Cell Type-Specific Populations of Endogenous Circular DNA (eccDNA) in Caenorhabditis elegans and Homo sapiens. G3-Genes Genom. Genet. 2017, 7, 3295–3303. [Google Scholar] [CrossRef] [PubMed]
- Cohen, S.; Agmon, N.; Yacobi, K.; Mislovati, M.; Segal, D. Evidence for rolling circle replication of tandem genes in Drosophila. Nucleic Acids Res. 2005, 33, 4519–4526. [Google Scholar] [CrossRef]
- Moller, H.D.; Ramos-Madrigal, J.; Prada-Luengo, I.; Gilbert, M.T.P.; Regenberg, B. Near-Random Distribution of Chromosome-Derived Circular DNA in the Condensed Genome of Pigeons and the Larger, More Repeat-Rich Human Genome. Genome Biol. Evol. 2020, 12, 3762–3777. [Google Scholar] [CrossRef]
- Yerlici, V.T.; Lu, M.W.; Hoge, C.R.; Miller, R.V.; Neme, R.; Khurana, J.S.; Bracht, J.R.; Landweber, L.F. Programmed genome rearrangements in Oxytricha produce transcriptionally active extrachromosomal circular DNA. Nucleic Acids Res. 2019, 47, 9741–9760. [Google Scholar] [CrossRef] [PubMed]
- Møller, H.D.; Mohiyuddin, M.; Prada-Luengo, I.; Sailani, M.R.; Halling, J.F.; Plomgaard, P.; Maretty, L.; Hansen, A.J.; Snyder, M.P.; Pilegaard, H.; et al. Circular DNA elements of chromosomal origin are common in healthy human somatic tissue. Nat. Commun. 2018, 9, 1069. [Google Scholar] [CrossRef]
- Morton, A.R.; Dogan-Artun, N.; Faber, Z.J.; MacLeod, G.; Bartels, C.F.; Piazza, M.S.; Allan, K.C.; Mack, S.C.; Wang, X.; Gimple, R.C.; et al. Functional Enhancers Shape Extrachromosomal Oncogene Amplifications. Cell 2019, 179, 1330–1341. [Google Scholar] [CrossRef]
- Sin, S.T.K.; Jiang, P.; Deng, J.; Ji, L.; Cheng, S.H.; Dutta, A.; Leung, T.Y.; Chan, K.C.A.; Chiu, R.W.K.; Lo, Y.M.D. Identification and characterization of extrachromosomal circular DNA in maternal plasma. Proc. Natl. Acad. Sci. USA 2020, 117, 1658–1665. [Google Scholar] [CrossRef]
- Cohen, S.; Houben, A.; Segal, D. Extrachromosomal circular DNA derived from tandemly repeated genomic sequences in plants. Plant J. 2008, 53, 1027–1034. [Google Scholar] [CrossRef]
- Koo, D.H.; Molin, W.T.; Saski, C.A.; Jiang, J.; Putta, K.; Jugulam, M.; Friebe, B.; Gill, B.S. Extrachromosomal circular DNA-based amplification and transmission of herbicide resistance in crop weed Amaranthus palmeri. Proc. Natl. Acad. Sci. USA 2018, 115, 3332–3337. [Google Scholar] [CrossRef]
- Molin, W.T.; Yaguchi, A.; Blenner, M.; Saski, C.A. The EccDNA Replicon: A Heritable, Extranuclear Vehicle That Enables Gene Amplification and Glyphosate Resistance in Amaranthus palmeri. Plant Cell 2020, 32, 2132–2140. [Google Scholar] [CrossRef] [PubMed]
- Nathanson, D.A.; Gini, B.; Mottahedeh, J.; Visnyei, K.; Koga, T.; Gomez, G.; Eskin, A.; Hwang, K.; Wang, J.; Masui, K.; et al. Targeted therapy resistance mediated by dynamic regulation of extrachromosomal mutant EGFR DNA. Science 2014, 343, 72–76. [Google Scholar] [CrossRef] [PubMed]
- Koche, R.P.; Rodriguez-Fos, E.; Helmsauer, K.; Burkert, M.; MacArthur, I.C.; Maag, J.; Chamorro, R.; Munoz-Perez, N.; Puiggròs, M.; Dorado Garcia, H.; et al. Extrachromosomal circular DNA drives oncogenic genome remodeling in neuroblastoma. Nat. Genet. 2020, 52, 29–34. [Google Scholar] [CrossRef] [PubMed]
- Paulsen, T.; Kumar, P.; Koseoglu, M.M.; Dutta, A. Discoveries of Extrachromosomal Circles of DNA in Normal and Tumor Cells. Trends Genet. 2018, 34, 270–278. [Google Scholar] [CrossRef] [PubMed]
- Liao, Z.; Jiang, W.; Ye, L.; Li, T.; Yu, X.; Liu, L. Classification of extrachromosomal circular DNA with a focus on the role of extrachromosomal DNA (ecDNA) in tumor heterogeneity and progression. Biochim. Biophys. Acta Rev. Cancer 2020, 1874, 188392. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Gujar, A.D.; Wong, C.H.; Tjong, H.; Ngan, C.Y.; Gong, L.; Chen, Y.A.; Kim, H.; Liu, J.; Li, M.; et al. Oncogenic extrachromosomal DNA functions as mobile enhancers to globally amplify chromosomal transcription. Cancer Cell 2021, 39, 694–707. [Google Scholar] [CrossRef] [PubMed]
- Paulsen, T.; Shibata, Y.; Kumar, P.; Dillon, L.; Dutta, A. Small extrachromosomal circular DNAs, microDNA, produce short regulatory RNAs that suppress gene expression independent of canonical promoters. Nucleic Acids Res. 2019, 47, 4586–4596. [Google Scholar] [CrossRef]
- Swevers, L.; Feng, M.; Ren, F.; Sun, J. Antiviral defense against Cypovirus 1 (Reoviridae) infection in the silkworm, Bombyx mori. Arch. Insect Biochem. Physiol. 2020, 103, e21616. [Google Scholar] [CrossRef]
- Gao, K.; Deng, X.Y.; Shang, M.K.; Qin, G.X.; Hou, C.X.; Guo, X.J. iTRAQ-based quantitative proteomic analysis of midgut in silkworm infected with Bombyx mori cytoplasmic polyhedrosis virus. J. Proteom. 2017, 152, 300–311. [Google Scholar] [CrossRef] [PubMed]
- Wu, P.; Han, S.; Chen, T.; Qin, G.; Li, L.; Guo, X. Involvement of microRNAs in infection of silkworm with Bombyx mori cytoplasmic polyhedrosis virus (BmCPV). PLoS ONE 2013, 8, e68209. [Google Scholar] [CrossRef]
- Zhao, Z.; Lin, S.; Wu, W.; Zhang, Z.; Wu, P.; Shen, M.; Qian, H.; Guo, X. A cypovirus encoded microRNA negatively regulates the NF-κB pathway to enhance viral multiplication in Silkworm, Bombyx mori. Dev. Comp. Immunol. 2022, 131, 104382. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Zhao, Z.; Lin, S.; Wu, W.; Tang, W.; Dong, Y.; Shen, M.; Wu, P.; Guo, X. Identification of long noncoding RNAs in silkworm larvae infected with Bombyx mori cypovirus. Arch. Insect Biochem. Physiol. 2021, 106, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.; Zhu, M.; Zhang, X.; Liu, B.; Liang, Z.; Huang, L.; Xu, J.; Yu, L.; Li, K.; Zar, M.S.; et al. Identification and characterization of circular RNAs in the silkworm midgut following Bombyx mori cytoplasmic polyhedrosis virus infection. RNA Biol. 2018, 15, 292–301. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zhang, X.; Dai, K.; Zhu, M.; Liang, Z.; Pan, J.; Zhang, Z.; Xue, R.; Cao, G.; Hu, X.; et al. Bombyx mori Akirin hijacks a viral peptide vSP27 encoded by BmCPV circRNA and activates the ROS-NF-κB pathway against viral infection. Int. J. Biol. Macromol. 2022, 194, 223–232. [Google Scholar] [CrossRef]
- Kumar, P.; Dillon, L.W.; Shibata, Y.; Jazaeri, A.A.; Jones, D.R.; Dutta, A. Normal and Cancerous Tissues Release Extrachromosomal Circular DNA (eccDNA) into the Circulation. Mol. Cancer Res. 2017, 15, 1197–1205. [Google Scholar] [CrossRef]
- Zou, S.; Chen, S.; Rao, G.; Zhang, G.; Ma, M.; Peng, B.; Du, X.; Huang, W.; Lin, W.; Tian, Y.; et al. Extrachromosomal circular MiR-17-92 amplicon promotes HCC. Hepatology 2024, 79, 79–95. [Google Scholar] [CrossRef] [PubMed]
- Zhu, M.; Tong, X.; Qiu, Q.; Pan, J.; Wei, S.; Ding, Y.; Feng, Y.; Hu, X.; Gong, C. Identification and characterization of extrachromosomal circular DNA in the silk gland of Bombyx mori. Insect Sci. 2023, 30, 1565–1578. [Google Scholar] [CrossRef]
- Gage, L.P. Polyploidization of the silk gland of Bombyx mori. J. Mol. Biol. 1974, 86, 97–108. [Google Scholar] [CrossRef]
- Perdrix-Gillot, S. DNA synthesis and endomitoses in the giant nuclei of the silkgland of Bombyx mori. Biochimie 1979, 61, 171–204. [Google Scholar] [CrossRef] [PubMed]
- Dillon, L.W.; Kumar, P.; Shibata, Y.; Wang, Y.H.; Willcox, S.; Griffith, J.D.; Pommier, Y.; Takeda, S.; Dutta, A. Production of Extrachromosomal MicroDNAs Is Linked to Mismatch Repair Pathways and Transcriptional Activity. Cell Rep. 2015, 11, 1749–1759. [Google Scholar] [CrossRef] [PubMed]
- Henriksen, R.A.; Jenjaroenpun, P.; Sjøstrøm, I.B.; Jensen, K.R.; Prada-Luengo, I.; Wongsurawat, T.; Nookaew, I.; Regenberg, B. Circular DNA in the human germline and its association with recombination. Mol. Cell 2022, 82, 209–217. [Google Scholar] [CrossRef] [PubMed]
- Lv, W.; Pan, X.; Han, P.; Wang, Z.; Feng, W.; Xing, X.; Wang, Q.; Qu, K.; Zeng, Y.; Zhang, C.; et al. Circle-Seq reveals genomic and disease-specific hallmarks in urinary cell-free extrachromosomal circular DNAs. Clin. Transl. Med. 2022, 12, e817. [Google Scholar] [CrossRef] [PubMed]
- Shibata, Y.; Kumar, P.; Layer, R.; Willcox, S.; Gagan, J.R.; Griffith, J.D.; Dutta, A. Extrachromosomal microDNAs and chromosomal microdeletions in normal tissues. Science 2012, 336, 82–86. [Google Scholar] [CrossRef] [PubMed]
- Cao, M.; Qiu, Q.; Zhang, X.; Zhang, W.; Shen, Z.; Ma, C.; Zhu, M.; Pan, J.; Tong, X.; Cao, G.; et al. Identification and characterization of a novel small viral peptide (VSP59) encoded by Bombyx mori cypovirus (BmCPV) that negatively regulates viral replication. Microbiol. Spectr. 2024, 12, e0082624. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, M.; Djekidel, M.N.; Chen, H.; Liu, D.; Alt, F.W.; Zhang, Y. eccDNAs are apoptotic products with high innate immunostimulatory activity. Nature 2021, 599, 308–314. [Google Scholar] [CrossRef]
- Misra, R.; Matera, A.G.; Schmid, C.W.; Rush, M.G. Recombination mediates production of an extrachromosomal circular DNA containing a transposon-like human element, THE-1. Nucleic Acids Res. 1989, 17, 8327–8341. [Google Scholar] [CrossRef] [PubMed]
- Jones, R.S.; Potter, S.S. L1 sequences in HeLa extrachromosomal circular DNA: Evidence for circularization by homologous recombination. Proc. Natl. Acad. Sci. USA 1985, 82, 1989–1993. [Google Scholar] [CrossRef]
- van Loon, N.; Miller, D.; Murnane, J.P. Formation of extrachromosomal circular DNA in HeLa cells by nonhomologous recombination. Nucleic Acids Res. 1994, 22, 2447–2452. [Google Scholar] [CrossRef] [PubMed]
- Sunnerhagen, P.; Sjöberg, R.M.; Karlsson, A.L.; Lundh, L.; Bjursell, G. Molecular cloning and characterization of small polydisperse circular DNA from mouse 3T6 cells. Nucleic Acids Res. 1986, 14, 7823–7838. [Google Scholar] [CrossRef] [PubMed]
- Stanfield, S.W.; Lengyel, J.A. Small circular DNA of Drosophila melanogaster: Chromosomal homology and kinetic complexity. Proc. Natl. Acad. Sci. USA 1979, 76, 6142–6146. [Google Scholar] [CrossRef] [PubMed]
- Stanfield, S.W.; Helinski, D.R. Cloning and characterization of small circular DNA from Chinese hamster ovary cells. Mol. Cell Biol. 1984, 4, 173–180. [Google Scholar] [PubMed]
- Paulsen, T.; Malapati, P.; Shibata, Y.; Wilson, B.; Eki, R.; Benamar, M.; Abbas, T.; Dutta, A. MicroDNA levels are dependent on MMEJ, repressed by c-NHEJ pathway, and stimulated by DNA damage. Nucleic Acids Res. 2021, 49, 11787–11799. [Google Scholar] [CrossRef]
- Cohen, S.; Mechali, M. A novel cell-free system reveals a mechanism of circular DNA formation from tandem repeats. Nucleic Acids Res. 2001, 29, 2542–2548. [Google Scholar] [CrossRef]
- Møller, H.D.; Parsons, L.; Jørgensen, T.S.; Botstein, D.; Regenberg, B. Extrachromosomal circular DNA is common in yeast. Proc. Natl. Acad. Sci. USA 2015, 112, E3114–E3122. [Google Scholar] [CrossRef]
- Haynes, S.R.; Jelinek, W.R. Low molecular weight RNAs transcribed in vitro by RNA polymerase III from Alu-type dispersed repeats in Chinese hamster DNA are also found in vivo. Proc. Natl. Acad. Sci. USA 1981, 78, 6130–6134. [Google Scholar] [CrossRef] [PubMed]
- Jackson, M.; Heller, D.; Leinwand, L. Transcriptional measurements of mouse repeated DNA sequences. Nucleic Acids Res. 1985, 13, 3389–3403. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Stevanovic, M.; Drakulic, D.; Lazic, A.; Ninkovic, D.S.; Schwirtlich, M.; Mojsin, M. SOX Transcription Factors as Important Regulators of Neuronal and Glial Differentiation During Nervous System Development and Adult Neurogenesis. Front. Mol. Neurosci. 2021, 14, 654031. [Google Scholar] [CrossRef]
- Zheng, H.; Liu, M.; Shi, S.; Huang, H.; Yang, X.; Luo, Z.; Song, Y.; Xu, Q.; Li, T.; Xue, L.; et al. MAP4K4 and WT1 mediate SOX6-induced cellular senescence by synergistically activating the ATF2-TGFβ2-Smad2/3 signaling pathway in cervical cancer. Mol. Oncol. 2024, 18, 1327–1346. [Google Scholar] [CrossRef]
- Baccas, M.; Ganesan, V.; Leung, A.; Pineiro, L.; McKillop, A.N.; Liu, J. SEM-2/SoxC regulates multiple aspects of C. elegans postembryonic mesoderm development. bioRxiv 2024. [Google Scholar]
- Wang, P.; Cong, M.; Liu, T.; Li, Y.; Liu, L.; Sun, S.; Sun, L.; Zhu, Z.; Ma, H.; You, H.; et al. FoxA2 inhibits the proliferation of hepatic progenitor cells by reducing PI3K/Akt/HK2-mediated glycolysis. J. Cell Physiol. 2020, 235, 9524–9537. [Google Scholar] [CrossRef]
- Yang, Y.; Seok, M.J.; Kim, Y.E.; Choi, Y.; Song, J.J.; Sulistio, Y.A.; Kim, S.H.; Chang, M.Y.; Oh, S.J.; Nam, M.H.; et al. Adeno-associated virus (AAV) 9-mediated gene delivery of Nurr1 and Foxa2 ameliorates symptoms and pathologies of Alzheimer disease model mice by suppressing neuro-inflammation and glial pathology. Mol. Psychiatry 2023, 28, 5359–5374. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Cao, G.; Zhu, L.; Chen, F.; Zar, M.S.; Wang, S.; Hu, X.; Wei, Y.; Xue, R.; Gong, C. Integrin beta and receptor for activated protein kinase C are involved in the cell entry of Bombyx mori cypovirus. Appl. Microbiol. Biotechnol. 2017, 101, 3703–3716. [Google Scholar] [CrossRef] [PubMed]
- Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B Stat. Methodol. 1995, 57, 289–300. [Google Scholar] [CrossRef]
- Kechin, A.; Boyarskikh, U.; Kel, A.; Filipenko, M. cutPrimers: A New Tool for Accurate Cutting of Primers from Reads of Targeted Next Generation Sequencing. J. Comput. Biol. 2017, 24, 1138–1143. [Google Scholar] [CrossRef] [PubMed]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef]
- Friedländer, M.R.; Mackowiak, S.D.; Li, N.; Chen, W.; Rajewsky, N. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Res. 2012, 40, 37–52. [Google Scholar] [CrossRef] [PubMed]
- Vaz, C.; Ahmad, H.M.; Sharma, P.; Gupta, R.; Kumar, L.; Kulshreshtha, R.; Bhattacharya, A. Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood. BMC Genom. 2010, 11, 288. [Google Scholar] [CrossRef]
- Friedman, R.C.; Farh, K.K.; Burge, C.B.; Bartel, D.P. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 2009, 19, 92–105. [Google Scholar] [CrossRef] [PubMed]
- Betel, D.; Koppal, A.; Agius, P.; Sander, C.; Leslie, C. Comprehensive modeling of microRNA targets predicts functional non-conserved and non-canonical sites. Genome Biol. 2010, 11, R90. [Google Scholar] [CrossRef] [PubMed]
- Smoot, M.E.; Ono, K.; Ruscheinski, J.; Wang, P.L.; Ideker, T. Cytoscape 2.8: New features for data integration and network visualization. Bioinformatics 2011, 27, 431–432. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Dong, R.; Zhang, Y.; Zhang, J.; Luo, Z.; Zhang, J.; Chen, L.; Yang, L. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Res. 2016, 26, 1277–1287. [Google Scholar] [CrossRef] [PubMed]
- Thorvaldsdóttir, H.; Robinson, J.T.; Mesirov, J.P. Integrative Genomics Viewer (IGV): High-performance genomics data visualization and exploration. Brief. Bioinform. 2013, 14, 178–192. [Google Scholar] [CrossRef]
Sample | Raw Reads | Clean Reads | Mapped Reads | Mapped Rate |
---|---|---|---|---|
CPV-JS-1 | 221,627,248 | 221,622,188 | 168,621,706 | 76.09% |
CPV-JS-2 | 196,407,022 | 196,398,878 | 152,921,996 | 77.86% |
CPV-JS-3 | 153,286,150 | 153,274,728 | 116,076,328 | 75.73% |
Con-JS-1 | 148,156,952 | 148,146,262 | 120,498,260 | 81.34% |
Con-JS-2 | 146,219,962 | 146,211,074 | 111,350,696 | 76.16% |
Con-JS-3 | 137,831,542 | 137,778,670 | 75,362,596 | 54.70% |
Sample | Raw Reads | Clean Reads | Mapped Reads | Mapped Rate |
---|---|---|---|---|
CPV-JS-1 | 47,659,218 | 47,513,488 | 38,211,453 | 80.42% |
CPV-JS-2 | 46,644,662 | 46,533,786 | 37,816,326 | 81.27% |
CPV-JS-3 | 40,258,640 | 40,161,644 | 30,718,884 | 76.49% |
Con-JS-1 | 50,932,130 | 50,791,626 | 40,712,037 | 80.16% |
Con-JS-2 | 50,553,920 | 50,450,864 | 39,448,288 | 78.19% |
Con-JS-3 | 56,244,622 | 56,113,548 | 44,780,534 | 79.80% |
Sample | Raw Reads | Mapped Reads | Mapped Rate | Q30 |
---|---|---|---|---|
CPV-JS-1 | 38,306,407 | 35,285,596 | 92.11% | 96.03% |
CPV-JS-2 | 36,566,873 | 33,470,524 | 91.53% | 96.21% |
CPV-JS-3 | 31,781,525 | 28,761,924 | 90.50% | 95.38% |
Con-JS-1 | 37,520,823 | 34,732,059 | 92.57% | 95.94% |
Con-JS-2 | 33,285,246 | 30,442,799 | 91.46% | 96.12% |
Con-JS-3 | 28,481,404 | 26,107,336 | 91.66% | 95.94% |
Name | Forward Primer | Reverse Primer |
---|---|---|
eccDNA-1 | AGTACGTCACCTACCTTCGCA | CACAGGTACTGCACAAAGGAA |
eccDNA-2 | GCTACCAGCGTATAGGTAGGC | CCTACCCATAATACCGCGCC |
eccDNA-3 | AATGGCTTCACTTGTAGCACG | GGGCGGGTTCGGATAATCA |
eccDNA-4 | AAGAGCCTCACAGAGTGCTT | CGCGAGTAGCGTTCAATGAT |
eccDNA-5 | GCTCGTCGGTCAAATAATGCT | GATTCGGCCACAACCGAAAT |
BMSK0008930 | ACGAAGGATCCCTTTCCGTT | AGGCCTCTACGTCCATCAAG |
BMSK0015239 | CCTGTTCAGCAGAAGGAGGA | TGGAAGCCAATGAAGGCAAC |
BMSK0016016 | GTCTTCGGGACTTTGGGAGA | TAGACGACCACCGTAACTGG |
BMSK0016068 | CAGGAACAGGCTCTTCTGGA | GACCAAGCGTATTCGTAGCC |
BMSK0006530 | AGCGCGTTCTATTCATGCAG | TTCCTGCAGGTAAGGTTGGT |
BMSK0006538 | CCCTTGGGCAACTACAGAGG | CGAGAGCTTTGCTGGTGTAG |
RT-miR-3334 | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTGTCCTT | |
RT-miR-6498-3p | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACTGTAT | |
RT-miR-1b-5p | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTATGGAAT | |
RT-miR-2998 | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTTTATCTA | |
bmo -miR-3334 | ACACTCCAGCTGGGTGAACCAGAATGATGGAA | CTCAACTGGTGTCGTGGAGTCG |
bmo -miR-6498-3p | ACACTCCAGCTGGGAACGTCTGCGATGAT | CTCAACTGGTGTCGTGGAGTCG |
bmo -miR-1b-5p | ACACTCCAGCTGGGCCATACTTCTTTACAT | CTCAACTGGTGTCGTGGAGTCG |
bmo-miR-2998 | ACACTCCAGCTGGGAAGAACAGGATGAGGTA | CTCAACTGGTGTCGTGGAGTCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tong, X.; Lei, C.; Liu, Y.; Yin, M.; Peng, H.; Qiu, Q.; Feng, Y.; Hu, X.; Gong, C.; Zhu, M. Genome-Wide Characterization of Extrachromosomal Circular DNA in the Midgut of BmCPV-Infected Silkworms and Its Potential Role in Antiviral Responses. Int. J. Mol. Sci. 2025, 26, 818. https://doi.org/10.3390/ijms26020818
Tong X, Lei C, Liu Y, Yin M, Peng H, Qiu Q, Feng Y, Hu X, Gong C, Zhu M. Genome-Wide Characterization of Extrachromosomal Circular DNA in the Midgut of BmCPV-Infected Silkworms and Its Potential Role in Antiviral Responses. International Journal of Molecular Sciences. 2025; 26(2):818. https://doi.org/10.3390/ijms26020818
Chicago/Turabian StyleTong, Xinyu, Chao Lei, Yilin Liu, Mei Yin, Huan Peng, Qunnan Qiu, Yongjie Feng, Xiaolong Hu, Chengliang Gong, and Min Zhu. 2025. "Genome-Wide Characterization of Extrachromosomal Circular DNA in the Midgut of BmCPV-Infected Silkworms and Its Potential Role in Antiviral Responses" International Journal of Molecular Sciences 26, no. 2: 818. https://doi.org/10.3390/ijms26020818
APA StyleTong, X., Lei, C., Liu, Y., Yin, M., Peng, H., Qiu, Q., Feng, Y., Hu, X., Gong, C., & Zhu, M. (2025). Genome-Wide Characterization of Extrachromosomal Circular DNA in the Midgut of BmCPV-Infected Silkworms and Its Potential Role in Antiviral Responses. International Journal of Molecular Sciences, 26(2), 818. https://doi.org/10.3390/ijms26020818