TSLP and TSLPR Expression Levels in Peripheral Blood as Potential Biomarkers in Patients with Chronic Rhinosinusitis with Nasal Polyps
Abstract
:1. Introduction
2. Results
2.1. Characteristics of the Population Study
2.2. TSLPR and TSLP Expression in Peripheral Blood Samples
2.3. Characteristics of the Population of the Biopsy Study
2.4. TSLPR and TSLP Expression in Nasal Biopsy Samples
3. Discussion
4. Materials and Methods
4.1. Study Population
4.2. Clinical Measurements
4.3. RNA Isolation and RT-PCR
4.4. Quantitative PCR Expression Analysis
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fokkens, S.R.W.J.; Lund, V.J.; Hopkins, C.; Hellings, P.W.; Kern, R. International Rhinology Journal European Position Paper on Rhinosinusitis and Nasal Polyps. Epos 2020, 1, 7–8. [Google Scholar]
- Giunta, G.; Pirola, F.; Giombi, F.; Muci, G.; Pace, G.M.; Heffler, E.; Paoletti, G.; Puggioni, F.; Cerasuolo, M.; Ferreli, F.; et al. Care for Patients with Type-2 Chronic Rhinosinusitis. J. Pers. Med. 2023, 13, 618. [Google Scholar] [CrossRef]
- Chmielik, L.P.; Mielnik-Niedzielska, G.; Kasprzyk, A.; Stankiewicz, T.; Niedzielski, A. Health-Related Quality of Life Assessed in Children with Chronic Rhinitis and Sinusitis. Children 2021, 8, 1133. [Google Scholar] [CrossRef] [PubMed]
- De Corso, E.; Hellings, P.W.; Fokkens, W.J.; Klimek, L.; Peters, A.T.; Scadding, G.K.; Desrosiers, M.; Lee, S.E.; Mullol, J. Thymic Stromal Lymphopoietin (TSLP): Evidence in Respiratory Epithelial-driven Diseases Including Chronic Rhinosinusitis with Nasal Polyps. Curr. Allergy Asthma Rep. 2025, 25, 1–27. [Google Scholar] [CrossRef] [PubMed]
- Ledda, A.G.; Costanzo, G.; Sambugaro, G.; Caruso, C.; Bullita, M.; Di Martino, M.L.; Serra, P.; Firinu, D.; Del Giacco, S. Eosinophil Cationic Protein Variation in Patients with Asthma and CRSwNP Treated with Dupilumab. Life 2023, 13, 1884. [Google Scholar] [CrossRef]
- Woo, S.D.; Luu, Q.Q.; Park, H.S. NSAID-Exacerbated Respiratory Disease (NERD): From Pathogenesis to Improved Care. Front. Pharmacol. 2020, 11, 1147. [Google Scholar] [CrossRef] [PubMed]
- Brescia, G.; Zanotti, C.; Parrino, D.; Barion, U.; Marioni, G. Nasal polyposis pathophysiology: Endotype and phenotype open issues. Am. J. Otolaryngol. Head Neck Med. Surg. 2018, 39, 441–444. [Google Scholar] [CrossRef] [PubMed]
- Mamuladze, T.; Kipnis, J. Type 2 immunity in the brain and brain borders. Cell. Mol. Immunol. 2023, 20, 1290–1299. [Google Scholar] [CrossRef]
- Fornasa, G.; Tsilingiri, K.; Caprioli, F.; Botti, F.; Mapelli, M.; Meller, S.; Kislat, A.; Homey, B.; Di Sabatino, A.; Sonzogni, A.; et al. Dichotomy of short and long thymic stromal lymphopoietin isoforms in inflammatory disorders of the bowel and skin. J. Allergy Clin. Immunol. 2015, 136, 413–422. [Google Scholar] [CrossRef] [PubMed]
- Canè, L.; Poto, R.; Palestra, F.; Iacobucci, I.; Pirozzi, M.; Parashuraman, S.; Ferrara, A.L.; Illiano, A.; La Rocca, A.; Mercadante, E.; et al. Thymic Stromal Lymphopoietin (TSLP) Is Cleaved by Human Mast Cell Tryptase and Chymase. Int. J. Mol. Sci. 2024, 25, 4049. [Google Scholar] [CrossRef] [PubMed]
- Smolinska, S.; Antolín-Amérigo, D.; Popescu, F.D.; Jutel, M. Thymic Stromal Lymphopoietin (TSLP), Its Isoforms and the Interplay with the Epithelium in Allergy and Asthma. Int. J. Mol. Sci. 2023, 24, 12725. [Google Scholar] [CrossRef] [PubMed]
- Kashyap, M.; Rochman, Y.; Spolski, R.; Samsel, L.; Leonard, W.J. Thymic Stromal Lymphopoietin Is Produced by Dendritic Cells. J. Immunol. 2011, 187, 1207–1211. [Google Scholar] [CrossRef] [PubMed]
- Bjerkan, L.; Schreurs, O.; Engen, S.A.; Jahnsen, F.L.; Baekkevold, E.S.; Blix, I.J.; Schenck, K. The short form of TSLP is constitutively translated in human keratinocytes and has characteristics of an antimicrobial peptide. Mucosal Immunol. 2015, 8, 49–56. [Google Scholar] [CrossRef] [PubMed]
- Soumelis, V.; Reche, P.A.; Kanzler, H.; Yuan, W.; Edward, G.; Homey, B.; Gilliet, M.; Ho, S.; Antonenko, S.; Lauerma, A.; et al. Human epithelial cells trigger dendritic cell-mediated allergic inflammation by producing TSLP. Nat. Immunol. 2002, 3, 673–680. [Google Scholar] [CrossRef]
- Brister, D.L.; Omer, H.; Whetstone, C.E.; Ranjbar, M.; Gauvreau, G.M. Multifactorial Causes and Consequences of TLSP Production, Function, and Release in the Asthmatic Airway. Biomolecules 2024, 14, 401. [Google Scholar] [CrossRef] [PubMed]
- Omori, M.; Ziegler, S. Induction of IL-4 Expression in CD4+ T Cells by Thymic Stromal Lymphopoietin. J. Immunol. 2007, 178, 1396–1404. [Google Scholar] [CrossRef] [PubMed]
- Kabata, H.; Flamar, A.L.; Mahlakõiv, T.; Moriyama, S.; Rodewald, H.R.; Ziegler, S.F.; Artis, D. Targeted deletion of the TSLP receptor reveals cellular mechanisms that promote type 2 airway inflammation. Mucosal Immunol. 2020, 13, 626–636. [Google Scholar] [CrossRef] [PubMed]
- Ito, T.; Wang, Y.H.; Duramad, O.; Hori, T.; Delespesse, G.J.; Watanabe, N.; Qin, F.X.F.; Yao, Z.; Cao, W.; Liu, Y.J. TSLP-activated dendritic cells induce an inflammatory T helper type 2 cell response through OX40 ligand. J. Exp. Med. 2005, 202, 1213–1223. [Google Scholar] [CrossRef]
- Al-Shami, A.; Spolski, R.; Kelly, J.; Fry, T.; Schwartzberg, P.L.; Pandey, A.; Mackall, C.L.; Leonard, W.J. A role for thymic stromal lymphopoietin in CD4+ T cell development. J. Exp. Med. 2004, 200, 159–168. [Google Scholar] [CrossRef] [PubMed]
- Kitajima, M.; Lee, H.C.; Nakayama, T.; Ziegler, S.F. TSLP enhances the function of helper type 2 cells. Eur. J. Immunol. 2011, 41, 1862–1871. [Google Scholar] [CrossRef]
- Noti, M.; Wojno, E.D.T.; Kim, B.S.; Siracusa, M.C.; Giacomin, P.R.; Nair, M.G.; Benitez, A.J.; Ruymann, K.R.; Muir, A.B.; Hill, D.A.; et al. Thymic stromal lymphopoietin-elicited basophil responses promote eosinophilic esophagitis. Nat. Med. 2013, 19, 1005–1013. [Google Scholar] [CrossRef] [PubMed]
- Hussain, M.; Borcard, L.; Walsh, K.P.; Rodriguez, M.P.; Mueller, C.; Kim, B.S.; Kubo, M.; Artis, D.; Noti, M. Basophil-derived IL-4 promotes epicutaneous antigen sensitization concomitant with the development of food allergy. J. Allergy Clin. Immunol. 2018, 141, 223–234.e5. [Google Scholar] [CrossRef] [PubMed]
- Noti, M.; Kim, B.S.; Siracusa, M.C.; Rak, G.D.; Kubo, M.; Moghaddam, A.E.; Sattentau, Q.A.; Comeau, M.R.; Spergel, J.M.; Artis, D. Exposure to food allergens through inflamed skin promotes intestinal food allergy via TSLP-basophil axis. J. Allergy Clin. Immunol. 2014, 133, 1390–1399. [Google Scholar] [CrossRef] [PubMed]
- Kim, B.S.; Wang, K.; Siracusa, M.C.; Saenz, S.A.; Brestoff, J.R.; Monticelli, L.A.; Noti, M.; Tait Wojno, E.D.; Fung, T.C.; Kubo, M.; et al. Basophils promote innate lymphoid cell responses in inflamed skin. J. Immunol. 2014, 139, 3717–3725. [Google Scholar] [CrossRef]
- Duchesne, M.; Okoye, I.; Lacy, P. Epithelial cell alarmin cytokines: Frontline mediators of the asthma inflammatory response. Front. Immunol. 2022, 13, 975914. [Google Scholar] [CrossRef] [PubMed]
- Yamashita, Y.; Terada, K.; Kodama, Y.; Nakadegawa, R.; Masumitsu, H.; Motobayashi, Y.; Osada, R.; Takayasu, H.; Masumoto, N.; Kaneko, T.; et al. Tezepelumab improved chronic rhinosinusitis with nasal polyps in a Patient with aspirin exacerbated respiratory disease. Respir. Med. Case Rep. 2024, 50, 102041. [Google Scholar] [CrossRef] [PubMed]
- Dobrican-Băruța, C.T.; Deleanu, D.M.; Muntean, I.A.; Nedelea, I.; Bălan, R.G.; Filip, G.A.; Procopciuc, L.M. The Alarmin Triad—IL-25, IL-33, and TSLP—Serum Levels and Their Clinical Implications in Chronic Spontaneous Urticaria. Int. J. Mol. Sci. 2024, 25, 2026. [Google Scholar] [CrossRef] [PubMed]
- Nagarkar, D.R.; Poposki, J.A.; Tan, B.K.; Comeau, M.R.; Peters, A.T.; Hulse, K.E.; Suh, L.A.; Norton, J.; Harris, K.E.; Grammar, L.C.; et al. Thymic stromal lymphopoietin activity is increased in nasal polyps of patients with chronic rhinosinusitis. J. Allergy Clin. Immunol. 2013, 132, 593–600.e12. [Google Scholar] [CrossRef]
- Murrison, L.B.; Ren, X.; Preusse, K.; He, H.; Kroner, J.; Chen, X.; Jenkins, S.; Johansson, E.; Biagini, J.M.; Weirauch, M.T.; et al. TSLP disease-associated genetic variants combined with airway TSLP expression influence asthma risk. J. Allergy Clin. Immunol. 2022, 149, 79–88. [Google Scholar] [CrossRef]
- Yoo, J.; Omori, M.; Gyarmati, D.; Zhou, B.; Aye, T.; Brewer, A.; Comeau, M.R.; Campbell, D.J.; Ziegler, S.F. Spontaneous atopic dermatitis in mice expressing an inducible thymic stromal lymphopoietin transgene specifically in the skin. J. Exp. Med. 2005, 202, 541–549. [Google Scholar] [CrossRef]
- Dogan, M.; Sahin, M.; Yenisey, C. Increased TSLP, IL-33, IL-25, IL-19, IL 21 and amphiregulin (AREG) levels in chronic rhinosinusitis with nasal polyp. Eur. Arch. Oto-Rhino-Laryngol. 2019, 276, 1685–1691. [Google Scholar] [CrossRef]
- Kimura, S.; Pawankar, R.; Mori, S.; Nonaka, M.; Masuno, S.; Yagi, T.; Okubo, K. Increased expression and role of thymic stromal lymphopoietin in nasal polyposis. Allergy Asthma Immunol. Res. 2011, 3, 186–193. [Google Scholar] [CrossRef]
- Hui, C.C.K.; Yu, A.; Heroux, D.; Akhabir, L.; Sandford, A.J.; Neighbour, H.; Denburg, J.A. Thymic stromal lymphopoietin (TSLP) secretion from human nasal epithelium is a function of TSLP genotype. Mucosal Immunol. 2015, 8, 993–999. [Google Scholar] [CrossRef]
- Kaur, D.; Doe, C.; Woodman, L.; Wan, W.Y.H.; Sutcliffe, A.; Hollins, F.; Brightling, C. Mast cell-airway smooth muscle crosstalk: The role of thymic stromal lymphopoietin. Chest 2012, 142, 76–85. [Google Scholar] [CrossRef] [PubMed]
- Marković, I.; Savvides, S.N. Modulation of Signaling Mediated by TSLP and IL-7 in Inflammation, Autoimmune Diseases, and Cancer. Front. Immunol. 2020, 11, 1557. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wang, W.; Lv, Z.; Li, Y.; Chen, Y.; Huang, K.; Corrigan, C.J.; Ying, S. Elevated Expression of IL-33 and TSLP in the Airways of Human Asthmatics In Vivo: A Potential Biomarker of Severe Refractory Disease. J. Immunol. 2018, 200, 2253–2262. [Google Scholar] [CrossRef]
- Hong, H.; Liao, S.; Chen, F.; Yang, Q.; Wang, D.Y. Role of IL-25, IL-33, and TSLP in triggering united airway diseases toward type 2 inflammation. Allergy Eur. J. Allergy Clin. Immunol. 2020, 75, 2794–2804. [Google Scholar] [CrossRef]
- Ketelaar, M.E.; Portelli, M.A.; Dijk, F.N.; Shrine, N.; Faiz, A.; Vermeulen, C.J.; Xu, C.J.; Hankinson, J.; Bhaker, S.; Henry, A.P.; et al. Phenotypic and functional translation of IL33 genetics in asthma. J. Allergy Clin. Immunol. 2021, 147, 144–157. [Google Scholar] [CrossRef] [PubMed]
- Aneas, I.; Decker, D.C.; Howard, C.L.; Sobreira, D.R.; Sakabe, N.J.; Blaine, K.M.; Stein, M.M.; Hrusch, C.L.; Montefiori, L.E.; Tena, J.; et al. Asthma-associated genetic variants induce IL33 differential expression through an enhancer-blocking regulatory region. Nat. Commun. 2021, 12, 6115. [Google Scholar] [CrossRef]
- Harada, M.; Hirota, T.; Jodo, A.I.; Hitomi, Y.; Sakashita, M.; Tsunoda, T.; Miyagawa, T.; Doi, S.; Kameda, M.; Fujita, K.; et al. Thymic stromal lymphopoietin gene promoter polymorphisms are associated with susceptibility to bronchial asthma. Am. J. Respir. Cell Mol. Biol. 2011, 44, 787–793. [Google Scholar] [CrossRef]
- Cianferoni, A.; Spergel, J. The importance of TSLP in allergic disease and its role as a potential therapeutic target. Expert Rev. Clin. Immunol. 2014, 10, 1463–1474. [Google Scholar] [CrossRef] [PubMed]
- Buysschaert, I.D.; Grulois, V.; Eloy, P.; Jorissen, M.; Rombaux, P.; Bertrand, B.; Collet, S.; Bobic, S.; Vlaminck, S.; Hellings, P.W.; et al. Genetic evidence for a role of IL33 in nasal polyposis. Allergy Eur. J. Allergy Clin. Immunol. 2010, 65, 616–622. [Google Scholar] [CrossRef]
- Nakayama, T.; Hirota, T.; Asaka, D.; Sakashita, M.; Ninomiya, T.; Morikawa, T.; Okano, M.; Haruna, S.; Yoshida, N.; Takeno, S.; et al. A genetic variant near TSLP is associated with chronic rhinosinusitis with nasal polyps and aspirin-exacerbated respiratory disease in Japanese populations. Allergol. Int. 2020, 69, 138–140. [Google Scholar] [CrossRef] [PubMed]
- Henmyr, V.; Vandeplas, G.; Halldén, C.; Säll, T.; Olze, H.; Bachert, C.; Cardell, L.O. Replication study of genetic variants associated with chronic rhinosinusitis and nasal polyposis. J. Allergy Clin. Immunol. 2014, 133, 273–275. [Google Scholar] [CrossRef]
- Ko, H.K.; Cheng, S.L.; Lin, C.H.; Lin, S.H.; Hsiao, Y.H.; Su, K.C.; Yu, C.J.; Wang, H.C.; Sheu, C.C.; Chiu, K.C.; et al. Blood tryptase and thymic stromal lymphopoietin levels predict the risk of exacerbation in severe asthma. Sci. Rep. 2021, 11, 8425. [Google Scholar] [CrossRef]
- Ruffner, M.A.; Cianferoni, A. Phenotypes and endotypes in eosinophilic esophagitis. Ann. Allergy Asthma Immunol. 2020, 124, 233–239. [Google Scholar] [CrossRef] [PubMed]
- Higgins, L.L.; Beitia, R.; Speck, O. Utility of a Noninvasive Serum Biomarker Panel for Diagnosis and monitoring of eosinophilic esophagitis: A prospective study. Off. J. Am. Coll. Gastroenterol. 2016, 2015, 821–827. [Google Scholar]
- Nakajima, S.; Kabata, H.; Kabashima, K.; Asano, K. Anti-TSLP antibodies: Targeting a master regulator of type 2 immune responses. Allergol. Int. 2020, 69, 197–203. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.R.; Chen, N.T.; Hsu, N.Y.; Kuo, I.Y.; Chang, H.W.; Wang, J.Y.; Su, H.J. Associations among phthalate exposure, DNA methylation of TSLP, and childhood allergy. Clin. Epigenetics 2021, 13, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Junge, K.M.; Bauer, T.; Geissler, S.; Hirche, F.; Thürmann, L.; Bauer, M.; Trump, S.; Bieg, M.; Weichenhan, D.; Gu, L.; et al. Increased Vitamin D levels at birth and in early infancy increase offspring allergy risk—Evidence for involvement of epigenetic mechanisms. J. Allergy Clin. Immunol. 2016, 137, 610–613. [Google Scholar] [CrossRef] [PubMed]
- Wang, I.J.; Chen, S.L.; Lu, T.P.; Chuang, E.Y.; Chen, P.C. Prenatal smoke exposure, DNA methylation, and childhood atopic dermatitis. Clin. Exp. Allergy 2013, 43, 535–543. [Google Scholar] [CrossRef] [PubMed]
- Van Bodegom, D.; Zhong, J.; Kopp, N.; Dutta, C.; Kim, M.S.; Bird, L.; Weigert, O.; Tyner, J.; Pandey, A.; Yoda, A.; et al. Differences in signaling through the B-cell leukemia oncoprotein CRLF2 in response to TSLP and through mutant JAK2. Blood 2012, 120, 2853–2863. [Google Scholar] [CrossRef]
- Luo, Y.; Zhou, B.; Zhao, M.; Tang, J.; Lu, Q. Promoter demethylation contributes to TSLP overexpression in skin lesions of patients with atopic dermatitis. Clin. Exp. Dermatol. 2014, 39, 48–53. [Google Scholar] [CrossRef] [PubMed]
- Henry, E.K.; Inclan-Rico, J.M.; Siracusa, M.C. Type 2 cytokine responses: Regulating immunity to helminth parasites and allergic inflammation. Curr. Pharmacol. Rep. 2018, 3, 346–359. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Jiao, J.; Gao, Y.; Zhang, Y.; Zhang, L. Association between methylation in nasal epithelial TSLP gene and chronic rhinosinusitis with nasal polyps. Allergy Asthma Clin. Immunol. 2019, 15, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Bagnasco, D.; De Ferrari, L.; Bondi, B.; Candeliere, M.G.; Mincarini, M.; Riccio, A.M.; Braido, F. Thymic Stromal Lymphopoietin and Tezepelumab in Airway Diseases: From Physiological Role to Target Therapy. Int. J. Mol. Sci. 2024, 25, 5972. [Google Scholar] [CrossRef] [PubMed]
- Hoy, S.M. Tezepelumab: First Approval. Drugs 2022, 82, 461–468. [Google Scholar] [CrossRef] [PubMed]
- Jacobs, J.; Hoyte, F.; Spahn, J.; Ambrose, C.; Martin, N.; Vong, S.; Caveney, S.; Cook, B. Gene Colice. Tezepelumab Efficacy By SNOT-22 Score In Patients With Severe, Uncontrolled Asthma And Comorbid Nasal Polyps In NAVIGATOR. J. Allergy Clin. Immunol. 2023, 151, AB17. [Google Scholar] [CrossRef]
- Shen, S.; Xian, M.; Yan, B.; Lan, F.; Wang, C.; Zhang, L. Anti-thymic stromal lymphopoietin monoclonal antibody in patients with chronic rhinosinusitis with nasal polyps (DUBHE): Rationale and design of a multicenter, randomized, double-blind, placebo-controlled study. Asia Pac. Allergy 2024, 14, 26–31. [Google Scholar] [CrossRef] [PubMed]
- Singh, D.; Deykin, A.; Lloyd, P.; Nestorov, I.; Kalra, A.; Biswas, S.; Sinha, A.; Brickman, C.; Becker, O. A Multiple Ascending-dose Study With Verekitug, A Novel Antibody to the Human Thymic Stromal Lymphopoietin Receptor, in Adults With Asthma. Am. J. Respir. Crit. Care Med. 2024, 209, A6996. [Google Scholar]
- Upstream Bio. Upstream Bio Initiates a Phase 2 Clinical Trial of Verekitug (UPB-101) in Severe Asthma and Doses First Patients. 2024. Available online: https://upstreambio.com/press-releases/upstream-bio-initiates-a-phase-2-clinical-trial-of-verekitug-upb-101-in-severe-asthma-and-doses-first-patients/ (accessed on 11 September 2024).
- PatSnap. 3 June 2024. Phase 2 Trial Begins for Verekitug in CRSwNP Patients. Available online: https://synapse.patsnap.com/article/phase-2-trial-begins-for-verekitug-in-crswnp-patients (accessed on 11 September 2024).
- Ziegler, S.F.; Roan, F.; Bell, B.D.; Stoklasek, T.A.; Kitajima, M.; Han, H. The Biology of Thymic Stromal Lymphopoietin (TSLP). Adv. Pharmacol. 2013, 66, 129–155. [Google Scholar] [PubMed]
- Vrsalović, R.; Korošec, P.; Štefanović, I.M.; Bidovec-Stojkovič, U.; Čičak, B.; Harjaček, M.; Škrgat, S. Value of thymic stromal lymphopoietin as a biomarker in children with asthma. Respir. Med. 2022, 193, 106757. [Google Scholar] [CrossRef] [PubMed]
- Verstraete, K.; Van Schie, L.; Vyncke, L.; Bloch, Y.; Tavernier, J.; Pauwels, E.; Peelman, F.; Savvides, S.N. Structural basis of the proinflammatory signaling complex mediated by TSLP. Nat. Struct. Mol. Biol. 2014, 21, 375–382. [Google Scholar] [CrossRef]
- Verstraete, K.; Peelman, F.; Braun, H.; Lopez, J.; Van Rompaey, D.; Dansercoer, A.; Vandenberghe, I.; Pauwels, K.; Tavernier, J.; Lambrecht, B.N.; et al. Structure and antagonism of the receptor complex mediated by human TSLP in allergy and asthma. Nat. Commun. 2017, 8, 14937. [Google Scholar] [CrossRef]
- Kuan, E.L.; Ziegler, S.F. Thymic Stromal Lymphopoietin (TSLP) and Cancer. J. Immunol. 2014, 193, 4283–4288. [Google Scholar] [CrossRef]
- Ziegler, S.F.; Artis, D. Sensing the outside world: TSLP regulates barrier immunity. Nat. Immunol. 2010, 11, 289–293. [Google Scholar] [CrossRef] [PubMed]
- Redhu, N.S.; Gounni, A.S. Function and mechanisms of TSLP/TSLPR complex in asthma and COPD. Clin. Exp. Allergy 2012, 42, 994–1005. [Google Scholar] [CrossRef] [PubMed]
- Buchheit, K.M.; Cahill, K.N.; Katz, H.R.; Murphy, K.C.; Feng, C.; Lee-Sarwar, K.; Lai, J.; Bhattacharyya, N.; Israel, E.; Boyce, J.A.; et al. Thymic stromal lymphopoietin controls prostaglandin D2 generation in aspirin-exacerbated respiratory disease. J. Allergy Clin. Immunol. 2016, 137, 1566–1576.e5. [Google Scholar] [CrossRef] [PubMed]
- Boita, M.; Garzaro, M.; Raimondo, L.; Riva, G.; Mazibrada, J.; Vizio, B.; Bellone, G.; Pecorari, G.; Bucca, C.; Rolla, G.; et al. The expression of tslp receptor in chronic rhinosinusitis with and without nasal polyps. Int. J. Immunopathol. Pharmacol. 2011, 24, 761–768. [Google Scholar] [CrossRef]
- Klimek, L.; Hagemann, J.; Welkoborsky, H.J.; Cuevas, M.; Casper, I.; Förster-Ruhrmann, U.; Klimek, F.; Hintschich, C.A.; Huppertz, T.; Bergmann, C.; et al. Epithelial immune regulation of inflammatory airway diseases: Chronic rhinosinusitis with nasal polyps (CRSwNP). Allergol. Select. 2022, 6, 148–166. [Google Scholar] [CrossRef]
- Peng, Y.; Zi, X.X.; Tian, T.F.; Lee, B.; Lum, J.; Tang, S.A.; Tan, K.S.; Qiu, Q.H.; Ye, J.; Shi, L.; et al. Whole-transcriptome sequencing reveals heightened inflammation and defective host defence responses in chronic rhinosinusitis with nasal polyps. Eur. Respir. J. 2019, 54, 1900732. [Google Scholar] [CrossRef] [PubMed]
- Drake, V.E.; Rafaels, N.; Kim, J. Peripheral blood eosinophilia correlates with hyperplastic nasal polyp growth. Int. Forum Allergy Rhinol. 2016, 6, 926–934. [Google Scholar] [CrossRef] [PubMed]
- Cao, P.; Wang, B.; Zhang, Y.; You, X.; Gao, Q.; Cui, Y.; Liu, Z. TSLP Signaling and TH2-type Inflammation is Enhanced in Eosinophilic but not Noneosinophilic Nasal Polyps. J. Allergy Clin. Immunol. 2011, 127, AB140. [Google Scholar] [CrossRef]
- Liao, B.; Cao, P.-P.; Zeng, M.; Zhen, Z.; Wang, H.; Zhang, Y.-N.; Hu, C.-Y.; Ma, J.; Li, Z.-Y.; Song, J.; et al. Interaction of thymic stromal lymphopoietin, IL -33, and their receptors in epithelial cells in eosinophilic chronic rhinosinusitis with nasal polyps. Allergy 2015, 70, 1169–1180. [Google Scholar] [CrossRef]
- Wang, W.W.; Lu, D.M.; Zheng, M.; Zhang, J.G.; Zhang, B. TSLP regulates eotaxin-1 production by nasal epithelial cells from patients with eosinophilic CRSwNP. Rhinology 2018, 56, 370–377. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.F.; Cao, P.P.; Norton, J.E.; Poposki, J.A.; Klingler, A.I.; Suh, L.A.; Carter, R.; Huang, J.H.; Bai, J.; Stevens, W.W.; et al. Evidence that oncostatin M synergizes with IL-4 signaling to induce TSLP expression in chronic rhinosinusitis with nasal polyps. J. Allergy Clin. Immunol. 2023, 151, 1379–1390.e11. [Google Scholar] [CrossRef] [PubMed]
- Ogasawara, N.; Poposki, J.A.; Klingler, A.I.; Tan, B.K.; Hulse, K.E.; Stevens, W.W.; Peters, A.T.; Grammar, L.C.; Welch, K.C.; Smith, S.S.; et al. Role of RANK-L as a potential inducer of ILC2-mediated type 2 inflammation in chronic rhinosinusitis with nasal polyps. J. Allergy Clin. Immunol. 2020, 13, 86–95. [Google Scholar] [CrossRef]
- Pathinayake, P.S.; Hsu, A.C.Y.; Nichol, K.S.; Horvat, J.C.; Hansbro, P.M.; Wark, P.A.B. Endoplasmic reticulum stress enhances the expression of TLR3-induced TSLP by airway epithelium. Am. J. Physiol. Lung Cell. Mol. Physiol. 2024, 326, L618–L626. [Google Scholar] [CrossRef] [PubMed]
- Poposki, J.A.; Klingler, A.I.; Stevens, W.W.; Peters, A.T.; Hulse, K.E.; Grammar, L.C.; Schleimer, R.P.; Welch, K.C.; Smith, S.S.; Sidle, D.M.; et al. Proprotein convertases generate a highly functional heterodimeric form of thymic stromal lymphopoietin in humans. J. Allergy Clin. Immunol. 2017, 139, 1559–1567.e8. [Google Scholar] [CrossRef] [PubMed]
- Corren, J.; Parnes, J.R.; Wang, L.; Mo, M.; Roseti, S.L.; Griffiths, J.M.; van der Merwe, R. Tezepelumab in Adults with Uncontrolled Asthma. N. Engl. J. Med. 2017, 377, 936–946. [Google Scholar] [CrossRef]
- Menzies-Gow, A.; Corren, J.; Bourdin, A.; Chupp, G.; Israel, E.; Wechsler, M.E.; Brightling, C.E.; Griffiths, J.M.; Hellqvist, Å.; Bowen, K.; et al. Tezepelumab in Adults and Adolescents with Severe, Uncontrolled Asthma. N. Engl. J. Med. 2021, 384, 1800–1809. [Google Scholar] [CrossRef] [PubMed]
- GINA. GINA 2024—Iniciativa Global para a Asma—GINA. 2024, p. 263. Available online: https://ginasthma.org/2024-report/ (accessed on 11 September 2024).
- GEMA. GEMA 5.1. Spanish Guide for the Management of Asthma. 2024. Available online: https://www.gemasma.com (accessed on 11 September 2024).
- San Segundo-Val, I.; García-Sánchez, A.; Sanz, C.; Cornejo-García, J.A.; Isidoro-García, M.; Dávila, I. Promoter genotyping and mRNA expression-based analysis of the PTGDR gene in allergy. J. Investig. Allergol. Clin. Immunol. 2020, 30, 117–126. [Google Scholar] [CrossRef]
- Sub-Committee on Skin Tests of the European Academy of Allergology and Clinical Immunology. Skin tests used in type I allergy testing Position paper. Allergy Asthma Clin. Immunol. 1989, 44, 11–59. [Google Scholar]
- Kennedy, J.L.; Hubbard, M.A.; Huyett, P.; Patrie, J.T.; Borish, L.; Payne, S.C. Surgical Improvement in Patients with Chronic Sinusitis. Ann. Allergy Asthma Immunol. 2014, 111, 246–251. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Primer 3.0. Available online: http://bioinfo.ut.ee/primer3-0.4.0/ (accessed on 10 November 2021).
- Beacon Designer. Available online: www.premierbiosoft.com (accessed on 10 November 2021).
- Applied Biosystems. Guide to Performing Relative Quantification of Gene Expression Using Real-Time Quantitative PCR; Applied Biosystems: Waltham, MA, USA, 2008. [Google Scholar]
HCs | PATIENTS | ||||
---|---|---|---|---|---|
Total | CRSwNP | CRSwNP +Asthma | N-ERD | ||
N | 45 | 111 | 49 | 41 | 21 |
Age (y) (mean ± SD) | 55.51 ± 18.76 | 54.68 ± 16.43 | 53.29 ± 17.41 | 55.98 ± 16.60 | 55.43 ± 14.04 |
Sex, F (%) | 35 (77.8) a | 42 (37.8) * | 10 (20.4) c | 20 (48.8) b | 12 (57.1) a,b |
Atopy (%) | 0 a | 49 (44.1) * | 18 (36.7) b | 21 (51.2) b | 10 (47.6) b |
Total IgE (kU/L) | 41.97 ± 49.77 | 225.18 ± 424.56 * | 141.09 ± 206.52 * | 344.90 ± 628.37 *¥ | 179.15 ± 187.34 * |
PBE(cells/µL) | 133.02 ± 86.75 | 395.37 ± 362.82 * | 327.28 ± 221.33 * | 427.25 ± 433.64 * | 483.81 ± 447.07 * |
SNOT-22 | - | 48.93 ± 20.51 | 42.57 ± 17.72 | 53.91 ± 21.29 | 52.27 ± 22.62 |
FeNO (ppb) | - | 67.89 ± 62.69 | - | 78.24 ± 67.03 | 49.45 ± 49.11 |
HCs | PATIENTS | ||||
---|---|---|---|---|---|
Total | CRSwNP | CRSwNP +Asthma | N-ERD | ||
N | 45 | 111 | 49 | 41 | 21 |
TSLPR | 0.45 ± 0.47 | 1.01 ± 0.97 * | 1.11 ± 1.11 * | 0.81 ± 0.57 * | 1.18 ± 1.18 * |
TSLP | 2.15 ± 1.45 | 4.31 ± 3.86 * | 4.99 ± 4.68 * | 3.61 ± 2.90 * | 4.09 ± 3.27 * |
HCs | PATIENTS | ||||
---|---|---|---|---|---|
Total | CRSwNP | CRSwNP +Asthma | N-ERD | ||
N | 11 | 33 | 11 | 11 | 11 |
Age (y) (mean ± SD) | 54.36 ± 17.05 | 54.55 ± 16.93 | 55.09 ± 18.67 | 55.00 ± 18.24 | 53.55 ± 15.29 |
Sex, F (%) | 9 (81.8) a | 19 (57.6) | 4 (36.4) a | 8 (72.7) a | 7 (63.6) a |
Atopy (%) | 0 a | 20 (60.6) * | 6 (54.5) b | 7 (63.6) b | 7 (63.6) b |
Total IgE (kU/L) | 39.52 ± 71.50 | 220.59 ± 276.05 * | 172.87 ± 307.36 | 280.70 ± 308.46 * | 212.96 ± 216.88 * |
PBE (cells/µL) | 114.55 ± 97.20 | 345.94 ± 185.85 * | 250.91 ± 83.60 | 391.00 ± 150.51 * | 400.00 ± 254.01 * |
EO biopsy | - | 71.84 ± 64.67 | 57.50 ± 49.67 | 99.14 ± 81.39 | 60.50 ± 60.46 |
SNOT-22 | - | 51.14 ± 22.70 | 46.50 ± 11.47 | 49.00 ± 28.58 | 56.50 ± 24.95 |
FeNO (ppb) | - | 54.58 ± 48.35 | - | 67.83 ± 56.95 | 47.20 ± 39.87 |
HCs | PATIENTS | ||||
---|---|---|---|---|---|
Total | CRSwNP | CRSwNP +Asthma | N-ERD | ||
N | 11 | 33 | 11 | 11 | 11 |
TSLPR biopsy | 2.06 ± 1.44 | 7.01 ± 17.99 | 2.79 ± 2.15 | 13.98 ± 30.65 | 4.25 ± 3.24 |
TSLP biopsy | 34.14 ± 34.35 | 99.37 ± 98.68 * | 72.41 ± 53.64 * | 104.49 ± 76.78 * | 121.23 ± 145.03 * |
TSLPR blood | 0.51 ± 0.38 | 0.97 ± 0.68 * | 1.00 ± 0.53 * | 0.91 ± 0.69 | 1.01 ± 0.86 |
TSLP blood | 3.56 ± 3.30 | 3.95 ± 2.54 | 3.84 ± 2.26 | 3.86 ± 2.73 | 4.14 ± 2.84 |
Primer | Sequence 5′-3′ | |
---|---|---|
TSLP | Forward | CGTAAACTTTGCCGCCTATGA |
Reverse | TTCTTCATTGCCTGAGTAGCATTTAT | |
TSLPR | Forward | AAGCGACTGGTCAGAGGTGACA |
Reverse | GAGGAGAGACACCATCAGAAGG | |
GAPDH | Forward | CTCTGCTCCTCCTGTTCGAC |
Reverse | ACGACCAAATCCGTTGACTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moreno-Jiménez, E.; Morgado, N.; Gómez-García, M.; Sanz, C.; Gil-Melcón, M.; Isidoro-García, M.; Dávila, I.; García-Sánchez, A. TSLP and TSLPR Expression Levels in Peripheral Blood as Potential Biomarkers in Patients with Chronic Rhinosinusitis with Nasal Polyps. Int. J. Mol. Sci. 2025, 26, 1227. https://doi.org/10.3390/ijms26031227
Moreno-Jiménez E, Morgado N, Gómez-García M, Sanz C, Gil-Melcón M, Isidoro-García M, Dávila I, García-Sánchez A. TSLP and TSLPR Expression Levels in Peripheral Blood as Potential Biomarkers in Patients with Chronic Rhinosinusitis with Nasal Polyps. International Journal of Molecular Sciences. 2025; 26(3):1227. https://doi.org/10.3390/ijms26031227
Chicago/Turabian StyleMoreno-Jiménez, Emma, Natalia Morgado, Manuel Gómez-García, Catalina Sanz, María Gil-Melcón, María Isidoro-García, Ignacio Dávila, and Asunción García-Sánchez. 2025. "TSLP and TSLPR Expression Levels in Peripheral Blood as Potential Biomarkers in Patients with Chronic Rhinosinusitis with Nasal Polyps" International Journal of Molecular Sciences 26, no. 3: 1227. https://doi.org/10.3390/ijms26031227
APA StyleMoreno-Jiménez, E., Morgado, N., Gómez-García, M., Sanz, C., Gil-Melcón, M., Isidoro-García, M., Dávila, I., & García-Sánchez, A. (2025). TSLP and TSLPR Expression Levels in Peripheral Blood as Potential Biomarkers in Patients with Chronic Rhinosinusitis with Nasal Polyps. International Journal of Molecular Sciences, 26(3), 1227. https://doi.org/10.3390/ijms26031227