Plasma-Activated Water Improve Wound Healing in Diabetic Rats by Influencing the Inflammatory and Remodelling Phase
Abstract
:1. Introduction
2. Results
2.1. Improved Wound Closure in Diabetic Rats After PAW Treatment
2.2. PAW Treatment Attenuates Inflammatory Response in Diabetic Rats
2.3. Increased Collagen Deposition in Diabetic Rats After PAW Treatment
2.4. The Effect of PAW Treatment on Gene Expression
3. Discussion
4. Materials and Methods
4.1. CAP Treatments of Distilled Water–PAW Preparation
4.2. Wound Healing Model
4.3. Measurement of the Wound Closure Area
4.4. Histological Analysis
4.5. Determination of Myeloperoxidase (MPO) and N-acetyl-b-D-glycosaminidase (NAG) Activities
4.6. Analysis of mRNA Expression by Quantitative Real-Time PCR (qPCR)
4.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Masson-Meyers, D.S.; Andrade, T.A.M.; Caetano, G.F.; Guimaraes, F.R.; Leite, M.N.; Leite, S.N.; Frade, M.A.C. Experimental models and methods for cutaneous wound healing assessment. Int. J. Exp. Pathol. 2020, 101, 21–37. [Google Scholar] [CrossRef] [PubMed]
- Lindley, L.E.; Stojadinovic, O.; Pastar, I.; Tomic-Canic, M. Biology and Biomarkers for Wound Healing. Plast. Reconstr. Surg. 2016, 138, 18S–28S. [Google Scholar] [CrossRef] [PubMed]
- Wilkinson, H.N.; Hardman, M.J. Wound healing: Cellular mechanisms and pathological outcomes. Open Biol. 2020, 10, 200223. [Google Scholar] [CrossRef] [PubMed]
- Broos, K.; Feys, H.B.; De Meyer, S.F.; Vanhoorelbeke, K.; Deckmyn, H. Platelets at work in primary hemostasis. Blood Rev. 2011, 25, 155–167. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.; DiPietro, L.A. Factors Affecting Wound Healing. J. Dent. Res. 2010, 89, 219–229. [Google Scholar] [CrossRef]
- Werner, S.; Krieg, T.; Smola, H. Keratinocyte–Fibroblast Interactions in Wound Healing. J. Investig. Dermatol. 2007, 127, 998–1008. [Google Scholar] [CrossRef]
- Bekeschus, S.; von Woedtke, T.; Emmert, S.; Schmidt, A. Medical gas plasma-stimulated wound healing: Evidence and mechanisms. Redox Biol. 2021, 46, 102116. [Google Scholar] [CrossRef]
- Shah, J.M.; Omar, E.; Pai, D.R.; Sood, S. Cellular events and biomarkers of wound healing. Indian J. Plast. Surg. 2012, 45, 220–228. [Google Scholar] [CrossRef]
- Loots, M.A.M.; Kenter, S.B.; Au, F.L.; van Galen, W.J.M.; Middelkoop, E.; Bos, J.D.; Mekkes, J.R. Fibroblasts derived from chronic diabetic ulcers differ in their response to stimulation with EGF, IGF-I, bFGF and PDGF-AB compared to controls. Eur. J. Cell Biol. 2002, 81, 153–160. [Google Scholar] [CrossRef] [PubMed]
- Everett, E.; Mathioudakis, N. Update on management of diabetic foot ulcers. Ann. N. Y. Acad. Sci. 2018, 1411, 153–165. [Google Scholar] [CrossRef]
- Armstrong, D.G.; Boulton, A.J.M.; Bus, S.A. Diabetic Foot Ulcers and Their Recurrence. N. Engl. J. Med. 2017, 376, 2367–2375. [Google Scholar] [CrossRef] [PubMed]
- Jeyaraman, K.; Berhane, T.; Hamilton, M.; Chandra, A.P.; Falhammar, H. Mortality in patients with diabetic foot ulcer: A retrospective study of 513 cases from a single Centre in the Northern Territory of Australia. BMC Endocr. Disord. 2019, 19, 1. [Google Scholar] [CrossRef] [PubMed]
- Vijayakumar, V.; Samal, S.K.; Mohanty, S.; Nayak, S.K. Recent advancements in biopolymer and metal nanoparticle-based materials in diabetic wound healing management. Int. J. Biol. Macromol. 2019, 122, 137–148. [Google Scholar] [CrossRef]
- Patel, S.; Srivastava, S.; Singh, M.R.; Singh, D. Mechanistic insight into diabetic wounds: Pathogenesis, molecular targets and treatment strategies to pace wound healing. Biomed. Pharmacother. 2019, 112, 108615. [Google Scholar] [CrossRef] [PubMed]
- Bauer, S.M.; Bauer, R.J.; Velazquez, O.C. Angiogenesis, Vasculogenesis, and Induction of Healing in Chronic Wounds. Vasc. Endovasc. Surg. 2005, 39, 293–306. [Google Scholar] [CrossRef] [PubMed]
- Shukla, S.K.; Sharma, A.K.; Gupta, V.; Yashavarddhan, M.H. Pharmacological control of inflammation in wound healing. J. Tissue Viability 2019, 28, 218–222. [Google Scholar] [CrossRef] [PubMed]
- Kavitha, K.V.; Tiwari, S.; Purandare, V.B.; Khedkar, S.; Bhosale, S.S.; Unnikrishnan, A.G. Choice of wound care in diabetic foot ulcer: A practical approach. World J. Diabetes 2014, 5, 546–556. [Google Scholar] [CrossRef]
- Santra, S.; Rawat, A.; Pattarayan, D.; Roy, S. Chapter 3—Chronic infection and inflammation: Hallmarks of diabetic foot ulcers. In Wound Healing, Tissue Repair, and Regeneration in Diabetes; Bagchi, D., Das, A., Roy, S., Eds.; Academic Press: Cambridge, MA, USA, 2020; pp. 39–47. [Google Scholar] [CrossRef]
- Zhang, W.; Liu, W.; Long, L.; He, S.; Wang, Z.; Liu, Y.; Yang, L.; Chen, N.; Hu, C.; Wang, Y. Responsive multifunctional hydrogels emulating the chronic wounds healing cascade for skin repair. J. Control. Release 2023, 354, 821–834. [Google Scholar] [CrossRef]
- Wu, Y.; Zhang, J.; Lin, A.; Zhang, T.; Liu, Y.; Zhang, C.; Yin, Y.; Guo, R.; Gao, J.; Li, Y.; et al. Immunomodulatory poly(L-lactic acid) nanofibrous membranes promote diabetic wound healing by inhibiting inflammation, oxidation and bacterial infection. Burn. Trauma 2024, 12, tkae009. [Google Scholar] [CrossRef] [PubMed]
- Hamed, S.H.; Azooz, E.A.; Al-Mulla, E.A.J. Nanoparticles-assisted Wound Healing: A Review. Nano Biomed. Eng. 2023, 15, 425–435. [Google Scholar] [CrossRef]
- Privat-Maldonado, A.; Schmidt, A.; Lin, A.; Weltmann, K.-D.; Wende, K.; Bogaerts, A.; Bekeschus, S. ROS from Physical Plasmas: Redox Chemistry for Biomedical Therapy. Oxidative Med. Cell. Longev. 2019, 2019, 9062098. [Google Scholar] [CrossRef] [PubMed]
- Graves, D.B. Reactive Species from Cold Atmospheric Plasma: Implications for Cancer Therapy. Plasma Process. Polym. 2014, 11, 1120–1127. [Google Scholar] [CrossRef]
- Bradu, C.; Kutasi, K.; Magureanu, M.; Puač, N.; Živković, S. Reactive nitrogen species in plasma-activated water: Generation, chemistry and application in agriculture. J. Phys. D Appl. Phys. 2020, 53, 223001. [Google Scholar] [CrossRef]
- Conrads, H.; Schmidt, M. Plasma generation and plasma sources. Plasma Sources Sci. Technol. 2000, 9, 441. [Google Scholar] [CrossRef]
- Wu, Y.; Yu, S.; Zhang, X.; Wang, X.; Zhang, J. The Regulatory Mechanism of Cold Plasma in Relation to Cell Activity and Its Application in Biomedical and Animal Husbandry Practices. Int. J. Mol. Sci. 2023, 24, 7160. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.; Wang, S.; Li, B.; Qi, M.; Feng, R.; Li, Q.; Zhang, H.; Chen, H.; Kong, M.G. Effects of Plasma-Activated Water on Skin Wound Healing in Mice. Microorganisms 2020, 8, 1091. [Google Scholar] [CrossRef] [PubMed]
- Arndt, S.; Unger, P.; Wacker, E.; Shimizu, T.; Heinlin, J.; Li, Y.F.; Thomas, H.M.; Morfill, G.E.; Zimmermann, J.L.; Bosserhoff, A.K.; et al. Cold atmospheric plasma (CAP) changes gene expression of key molecules of the wound healing machinery and improves wound healing in vitro and in vivo. PLoS ONE 2013, 8, e79325. [Google Scholar] [CrossRef]
- Schmidt, A.; Bekeschus, S.; Wende, K.; Vollmar, B.; von Woedtke, T. A cold plasma jet accelerates wound healing in a murine model of full-thickness skin wounds. Exp. Dermatol. 2017, 26, 156–162. [Google Scholar] [CrossRef]
- Dang, C.P.; Weawseetong, S.; Charoensappakit, A.; Sae-Khow, K.; Thong-Aram, D.; Leelahavanichkul, A. Non-Thermal Atmospheric Pressure Argon-Sourced Plasma Flux Promotes Wound Healing of Burn Wounds and Burn Wounds with Infection in Mice through the Anti-Inflammatory Macrophages. Appl. Sci. 2021, 11, 5343. [Google Scholar] [CrossRef]
- Schmidt, A.; von Woedtke, T.; Weltmann, K.-D.; Bekeschus, S. YAP/TAZ, beta-catenin, and TGFb pathway activation in medical plasma-induced wound healing in diabetic mice. J. Adv. Res. 2024; in press. [Google Scholar] [CrossRef] [PubMed]
- Amini, M.R.; Sheikh Hosseini, M.; Fatollah, S.; Mirpour, S.; Ghoranneviss, M.; Larijani, B.; Mohajeri-Tehrani, M.R.; Khorramizadeh, M.R. Beneficial effects of cold atmospheric plasma on inflammatory phase of diabetic foot ulcers; a randomized clinical trial. J. Diabetes Metab. Disord. 2020, 19, 895–905. [Google Scholar] [CrossRef] [PubMed]
- Zhou, R.; Zhou, R.; Wang, P.; Xian, Y.; Mai-Prochnow, A.; Lu, X.; Cullen, P.J.; Ostrikov, K.; Bazaka, K. Plasma-activated water: Generation, origin of reactive species and biological applications. J. Phys. D Appl. Phys. 2020, 53, 303001. [Google Scholar] [CrossRef]
- Dunnill, C.; Patton, T.; Brennan, J.; Barrett, J.; Dryden, M.; Cooke, J.; Leaper, D.; Georgopoulos, N.T. Reactive oxygen species (ROS) and wound healing: The functional role of ROS and emerging ROS-modulating technologies for augmentation of the healing process. Int. Wound J. 2017, 14, 89–96. [Google Scholar] [CrossRef] [PubMed]
- Sen, C.K.; Roy, S. Redox signals in wound healing. Biochim. Biophys. Acta 2008, 1780, 1348–1361. [Google Scholar] [CrossRef] [PubMed]
- Brownlee, M. Biochemistry and molecular cell biology of diabetic complications. Nature 2001, 414, 813–820. [Google Scholar] [CrossRef] [PubMed]
- Mirpour, S.; Fathollah, S.; Mansouri, P.; Larijani, B.; Ghoranneviss, M.; Mohajeri Tehrani, M.; Amini, M.R. Cold atmospheric plasma as an effective method to treat diabetic foot ulcers: A randomized clinical trial. Sci. Rep. 2020, 10, 10440. [Google Scholar] [CrossRef] [PubMed]
- Stratmann, B.; Costea, T.C.; Nolte, C.; Hiller, J.; Schmidt, J.; Reindel, J.; Masur, K.; Motz, W.; Timm, J.; Kerner, W.; et al. Effect of Cold Atmospheric Plasma Therapy vs Standard Therapy Placebo on Wound Healing in Patients With Diabetic Foot Ulcers: A Randomized Clinical Trial. JAMA Netw. Open 2020, 3, e2010411. [Google Scholar] [CrossRef] [PubMed]
- Strohal, R.; Dietrich, S.; Mittlböck, M.; Hämmerle, G. Chronic wounds treated with cold atmospheric plasmajet versus best practice wound dressings: A multicenter, randomized, non-inferiority trial. Sci. Rep. 2022, 12, 3645. [Google Scholar] [CrossRef]
- Bogdanov, T.; Marinova, P.; Traikov, L.; Gateva, P.; Sedloev, T.; Petrov, A.; Vodenicharov, V.; Georgiev, R.; Bakalov, D.; Sabit, Z.; et al. The Effect of Low-Temperature Microwave Plasma on Wound Regeneration in Diabetic Rats. Processes 2023, 11, 3399. [Google Scholar] [CrossRef]
- Fathollah, S.; Mirpour, S.; Mansouri, P.; Dehpour, A.R.; Ghoranneviss, M.; Rahimi, N.; Safaie Naraghi, Z.; Chalangari, R.; Chalangari, K.M. Investigation on the effects of the atmospheric pressure plasma on wound healing in diabetic rats. Sci. Rep. 2016, 6, 19144. [Google Scholar] [CrossRef]
- Jacofsky, M.; Lubahn, C.; McDonnell, C.; Seepersad, Y.; Fridman, G.; Fridman, A.; Dobrynin, D. Spatially Resolved Optical Emission Spectroscopy of a Helium Plasma Jet and its Effects on Wound Healing Rate in a Diabetic Murine Model. Plasma Med. 2014, 4, 177–191. [Google Scholar] [CrossRef]
- Cheng, K.-Y.; Lin, Z.-H.; Cheng, Y.-P.; Chiu, H.-Y.; Yeh, N.-L.; Wu, T.-K.; Wu, J.-S. Wound Healing in Streptozotocin-Induced Diabetic Rats Using Atmospheric-Pressure Argon Plasma Jet. Sci. Rep. 2018, 8, 12214. [Google Scholar] [CrossRef]
- Vyas, H.K.N.; Xia, B.; Alam, D.; Gracie, N.P.; Rothwell, J.G.; Rice, S.A.; Carter, D.; Cullen, P.J.; Mai-Prochnow, A. Plasma activated water as a pre-treatment strategy in the context of biofilm-infected chronic wounds. Biofilm 2023, 6, 100154. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Xu, D.; Qi, M.; Li, B.; Peng, S.; Li, Q.; Zhang, H.; Liu, D. Plasma-Activated Water Promotes Wound Healing by Regulating Inflammatory Responses. Biophysica 2021, 1, 297–310. [Google Scholar] [CrossRef]
- Zubair, M.; Ahmad, J. Role of growth factors and cytokines in diabetic foot ulcer healing: A detailed review. Rev. Endocr. Metab. Disord. 2019, 20, 207–217. [Google Scholar] [CrossRef] [PubMed]
- Morey, M.; O’Gaora, P.; Pandit, A.; Hélary, C. Hyperglycemia acts in synergy with hypoxia to maintain the pro-inflammatory phenotype of macrophages. PLoS ONE 2019, 14, e0220577. [Google Scholar] [CrossRef]
- Yan, S.F.; Ramasamy, R.; Schmidt, A.M. Mechanisms of Disease: Advanced glycation end-products and their receptor in inflammation and diabetes complications. Nat. Clin. Pract. Endocrinol. Metab. 2008, 4, 285–293. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.-P.; Guo, L.; Chen, Q.-L.; Zhang, K.-Y.; Wang, T.; An, G.-Z.; Zhang, X.-F.; Li, H.-P.; Ding, G.-R. Effects and mechanisms of cold atmospheric plasma on skin wound healing of rats. Contrib. Plasma Phys. 2019, 59, 92–101. [Google Scholar] [CrossRef]
- Souza, L.B.d.; Silva, J.I.d.S.; Bagne, L.; Pereira, A.T.; Oliveira, M.A.d.; Lopes, B.B.; Amaral, M.E.C.d.; de Aro, A.A.; Esquisatto, M.A.M.; Santos, G.M.T.d.; et al. Argon Atmospheric Plasma Treatment Promotes Burn Healing by Stimulating Inflammation and Controlling the Redox State. Inflammation 2020, 43, 2357–2371. [Google Scholar] [CrossRef] [PubMed]
- Nasruddin; Nakajima, Y.; Mukai, K.; Rahayu, H.S.E.; Nur, M.; Ishijima, T.; Enomoto, H.; Uesugi, Y.; Sugama, J.; Nakatani, T. Cold plasma on full-thickness cutaneous wound accelerates healing through promoting inflammation, re-epithelialization and wound contraction. Clin. Plasma Med. 2014, 2, 28–35. [Google Scholar] [CrossRef]
- Marches, A.; Clement, E.; Albérola, G.; Rols, M.-P.; Cousty, S.; Simon, M.; Merbahi, N. Cold Atmospheric Plasma Jet Treatment Improves Human Keratinocyte Migration and Wound Closure Capacity without Causing Cellular Oxidative Stress. Int. J. Mol. Sci. 2022, 23, 10650. [Google Scholar] [CrossRef] [PubMed]
- Kubinova, S.; Zaviskova, K.; Uherkova, L.; Zablotskii, V.; Churpita, O.; Lunov, O.; Dejneka, A. Non-thermal air plasma promotes the healing of acute skin wounds in rats. Sci. Rep. 2017, 7, 45183. [Google Scholar] [CrossRef] [PubMed]
- Ladwig, G.P.; Robson, M.C.; Liu, R.; Kuhn, M.A.; Muir, D.F.; Schultz, G.S. Ratios of activated matrix metalloproteinase-9 to tissue inhibitor of matrix metalloproteinase-1 in wound fluids are inversely correlated with healing of pressure ulcers. Wound Repair Regen. 2002, 10, 26–37. [Google Scholar] [CrossRef]
- Nee, L.E.; McMorrow, T.; Campbell, E.; Slattery, C.; Ryan, M.P. TNF-alpha and IL-1beta-mediated regulation of MMP-9 and TIMP-1 in renal proximal tubular cells. Kidney Int. 2004, 66, 1376–1386. [Google Scholar] [CrossRef] [PubMed]
- Cheng, C.-Y.; Kuo, C.-T.; Lin, C.-C.; Hsieh, H.-L.; Yang, C.-M. IL-1β induces expression of matrix metalloproteinase-9 and cell migration via a c-Src-dependent, growth factor receptor transactivation in A549 cells. Br. J. Pharmacol. 2010, 160, 1595–1610. [Google Scholar] [CrossRef] [PubMed]
- Cieplak, P.; Strongin, A.Y. Matrix metalloproteinases—From the cleavage data to the prediction tools and beyond. Biochim. Biophys. Acta (BBA)—Mol. Cell Res. 2017, 1864, 1952–1963. [Google Scholar] [CrossRef] [PubMed]
- Cassini-Vieira, P.; Moreira, C.F.; da Silva, M.F.; Barcelos, L.d.S. Estimation of Wound Tissue Neutrophil and Macrophage Accumulation by Measuring Myeloperoxidase (MPO) and N-Acetyl-β-D-glucosaminidase (NAG) Activities. Bio-Protocol 2015, 5, e1662. [Google Scholar] [CrossRef]
Name | 5′-3′ Sequence | |
---|---|---|
Il-1b | fw | AGCAGCTTTCGACAGTGAGG |
rev | CTCCACGGGCAAGACATAGG | |
Il-6 | fw | GTTTCTCTCCGCAAGAGACTT |
rev | ATACTGGTCTGTTGTGGGTGG | |
Tnf | fw | GCCACCACGCTCTTCTGTCT |
rev | CGCTTGGTGGTTTGCTACGAC | |
Tgf-b1 | fw | CAGAACCCCCATTGCTGTCC |
rev | CCCTGTATTCCGTCTCCTTGG | |
Acta2 | fw | ATCCGACCTTGCTAACGGAG |
rev | AGAGTCCAGCACAATACCAGTTG | |
Col3-a1 | fw | AATGGGTGGCTATCCTGGAC |
rev | GGGTCTTCCTGACTCTCCATC | |
Col1-a1 | fw | CACTGCAAGAACAGCGTAGC |
rev | AAGTTCCGGTGTGACTCGTG | |
Mmp-9 | fw | GGGAACGTATCTGGAAATTCGAC |
rev | GTTGTGGAAACTCACACGCC | |
Timp-1 | fw | TCTGCAACTCGGACCTGGTTAT |
rev | AAACTCCTCGCTGCGGTTCT | |
Tbp | fw | CTATGACCCCTATCACTCCTGC |
rev | GCAGTTGTTCGTGGCTCTCTTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rajić, J.; Grdović, N.; Marković, A.; Škoro, N.; Dinić, S.; Uskoković, A.; Arambašić Jovanović, J.; Đorđević, M.; Sarić, A.; Vidaković, M.; et al. Plasma-Activated Water Improve Wound Healing in Diabetic Rats by Influencing the Inflammatory and Remodelling Phase. Int. J. Mol. Sci. 2025, 26, 1265. https://doi.org/10.3390/ijms26031265
Rajić J, Grdović N, Marković A, Škoro N, Dinić S, Uskoković A, Arambašić Jovanović J, Đorđević M, Sarić A, Vidaković M, et al. Plasma-Activated Water Improve Wound Healing in Diabetic Rats by Influencing the Inflammatory and Remodelling Phase. International Journal of Molecular Sciences. 2025; 26(3):1265. https://doi.org/10.3390/ijms26031265
Chicago/Turabian StyleRajić, Jovana, Nevena Grdović, Anđelija Marković, Nikola Škoro, Svetlana Dinić, Aleksandra Uskoković, Jelena Arambašić Jovanović, Marija Đorđević, Ana Sarić, Melita Vidaković, and et al. 2025. "Plasma-Activated Water Improve Wound Healing in Diabetic Rats by Influencing the Inflammatory and Remodelling Phase" International Journal of Molecular Sciences 26, no. 3: 1265. https://doi.org/10.3390/ijms26031265
APA StyleRajić, J., Grdović, N., Marković, A., Škoro, N., Dinić, S., Uskoković, A., Arambašić Jovanović, J., Đorđević, M., Sarić, A., Vidaković, M., Puač, N., & Mihailović, M. (2025). Plasma-Activated Water Improve Wound Healing in Diabetic Rats by Influencing the Inflammatory and Remodelling Phase. International Journal of Molecular Sciences, 26(3), 1265. https://doi.org/10.3390/ijms26031265