The Effect of Rhizophagus intraradices on Cadmium Uptake and OsNRAMP5 Gene Expression in Rice
Abstract
:1. Introduction
2. Results
2.1. Mycorrhizal Colonization
2.2. Biomass
2.3. Cadmium Uptake by Rice
2.4. Uptake of Other Essential Elements in Rice
2.5. Cadmium Transport Gene Expression in Rice Leaves
3. Discussion
4. Materials and Methods
4.1. Experimental Materials
4.2. Experimental Design
4.3. Sample Determination
4.4. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
AMF | arbuscular mycorrhizal fungi |
Cd | cadmium |
CAX | cation2+/H+ exchanger |
HMA | heavy metal ATPase |
IRT | iron-regulated transporter |
LCT | low-affinity cation transporter |
NRAMP | natural resistance-associated macrophage protein |
P | osnramp5 mutant |
P+Ri | P with Ri inoculation |
P+Cd | P with Cd treatment |
P+Ri+Cd | P with Ri inoculation and Cd treatment |
Ri | Rhizophagus intraradices |
WT | Wild-type rice |
WT+Ri | WT with Ri inoculation |
WT+Cd | WT with Cd treatment |
WT+Ri+Cd | WT with Ri inoculation and Cd treatment |
ZIP | Zn-regulated transporter |
References
- Islam, S.; Akbor, M.A.; Chowdhury, F.N.; Hasan, M.; Nahar, A.; Bakar Siddique, M.A.; Moniruzzaman, M.; Reza, M.S.; Muhib, M.I.; Rahman, M.M. Heavy Metals in Commonly Consumed Rice Grains in Bangladesh and Associated Probabilistic Human Health Risks. Heliyon 2024, 10, e39561. [Google Scholar] [CrossRef]
- Ding, H.; Liu, J.; Liu, Q.; Guo, L.; Hang, Q.; Zhang, Y.; Jia, J.; Tao, T.; Liu, Q.; Ding, C. Risk Assessment and Source Tracing of Heavy Metals in Major Rice-Producing Provinces of Yangtze River Basin. J. Hazard. Mater. 2024, 480, 136206. [Google Scholar] [CrossRef]
- Satarug, S. Dietary Cadmium Intake and Its Effects on Kidneys. Toxics 2018, 6, 15. [Google Scholar] [CrossRef]
- Tang, L.; Mao, B.; Li, Y.; Lv, Q.; Zhang, L.; Chen, C.; He, H.; Wang, W.; Zeng, X.; Shao, Y.; et al. Knockout of OsNramp5 Using the CRISPR/Cas9 System Produces Low Cd-Accumulating Indica Rice without Compromising Yield. Sci. Rep. 2017, 7, 14438. [Google Scholar] [CrossRef]
- Chang, J.-D.; Huang, S.; Yamaji, N.; Zhang, W.; Ma, J.F.; Zhao, F.-J. OsNRAMP1 transporter Contributes to Cadmium and Manganese Uptake in Rice. Plant Cell Environ. 2020, 43, 2476–2491. [Google Scholar] [CrossRef]
- Hussain, B.; Umer, M.J.; Li, J.; Ma, Y.; Abbas, Y.; Ashraf, M.N.; Tahir, N.; Ullah, A.; Gogoi, N.; Farooq, M. Strategies for Reducing Cadmium Accumulation in Rice Grains. J. Clean. Prod. 2021, 286, 125557. [Google Scholar] [CrossRef]
- Chen, J.; Zou, W.; Meng, L.; Fan, X.; Xu, G.; Ye, G. Advances in the Uptake and Transport Mechanisms and QTLs Mapping of Cadmium in Rice. Int. J. Mol. Sci. 2019, 20, 3417. [Google Scholar] [CrossRef]
- Yang, Y.; Xiong, J.; Chen, R.; Fu, G.; Chen, T.; Tao, L. Excessive Nitrate Enhances Cadmium (Cd) Uptake by up-Regulating the Expression of OsIRT1 in Rice (Oryza sativa). Environ. Exp. Bot. 2016, 122, 141–149. [Google Scholar] [CrossRef]
- Sasaki, A.; Yamaji, N.; Mitani-Ueno, N.; Kashino, M.; Ma, J.F. A Node-localized Transporter OsZIP3 Is Responsible for the Preferential Distribution of Zn to Developing Tissues in Rice. Plant J. 2015, 84, 374–384. [Google Scholar] [CrossRef]
- Tian, S.; Liang, S.; Qiao, K.; Wang, F.; Zhang, Y.; Chai, T. Co-Expression of Multiple Heavy Metal Transporters Changes the Translocation, Accumulation, and Potential Oxidative Stress of Cd and Zn in Rice (Oryza sativa). J. Hazard. Mater. 2019, 380, 120853. [Google Scholar] [CrossRef]
- Tan, L.; Zhu, Y.; Fan, T.; Peng, C.; Wang, J.; Sun, L.; Chen, C. OsZIP7 Functions in Xylem Loading in Roots and Inter-Vascular Transfer in Nodes to Deliver Zn/Cd to Grain in Rice. Biochem. Biophys. Res. Commun. 2019, 512, 112–118. [Google Scholar] [CrossRef] [PubMed]
- Zou, W.; Chen, J.; Meng, L.; Chen, D.; He, H.; Ye, G. The Rice Cation/H+ Exchanger Family Involved in Cd Tolerance and Transport. Int. J. Mol. Sci. 2021, 22, 8186. [Google Scholar] [CrossRef]
- Duan, S.; Feng, G.; Limpens, E.; Bonfante, P.; Xie, X.; Zhang, L. Cross-Kingdom Nutrient Exchange in the Plant–Arbuscular Mycorrhizal Fungus–Bacterium Continuum. Nat. Rev. Microbiol. 2024, 22, 773–790. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.; Wang, X.; Wang, E. Mycorrhizal Symbiosis in Plant Growth and Stress Adaptation: From Genes to Ecosystems. Annu. Rev. Plant Biol. 2023, 74, 569–607. [Google Scholar] [CrossRef]
- Riaz, M.; Kamran, M.; Fang, Y.; Wang, Q.; Cao, H.; Yang, G.; Deng, L.; Wang, Y.; Zhou, Y.; Anastopoulos, I.; et al. Arbuscular Mycorrhizal Fungi-Induced Mitigation of Heavy Metal Phytotoxicity in Metal Contaminated Soils: A Critical Review. J. Hazard. Mater. 2021, 402, 123919. [Google Scholar] [CrossRef] [PubMed]
- Pu, Z.; Wang, D.; Song, W.; Wang, C.; Li, Z.; Chen, Y.; Shimozono, T.; Yang, Z.; Tian, Y.; Xie, Z. The Impact of Arbuscular Mycorrhizal Fungi and Endophytic Bacteria on Peanuts under the Combined Pollution of Cadmium and Microplastics. J. Hazard. Mater. 2024, 469, 133934. [Google Scholar] [CrossRef]
- Shi, W.; Zhang, Y.; Chen, S.; Polle, A.; Rennenberg, H.; Luo, Z. Physiological and Molecular Mechanisms of Heavy Metal Accumulation in Nonmycorrhizal versus Mycorrhizal Plants. Plant Cell Environ. 2019, 42, 1087–1103. [Google Scholar] [CrossRef] [PubMed]
- Thangavel, P.; Anjum, N.A.; Muthukumar, T.; Sridevi, G.; Vasudhevan, P.; Maruthupandian, A. Arbuscular Mycorrhizae: Natural Modulators of Plant-Nutrient Relation and Growth in Stressful Environments. Arch. Microbiol. 2022, 204, 264. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Lambers, H.; Feng, J.; Tu, Y.; Peng, Z.; Huang, J. The Role of Arbuscular Mycorrhizal Fungi in Micronutrient Homeostasis and Cadmium Uptake and Transfer in Rice under Different Flooding Intensities. Ecotoxicol. Environ. Saf. 2024, 284, 116978. [Google Scholar] [CrossRef]
- Jin, X.; Liu, K.; Zhang, N.; Wu, A.; Dong, L.; Wu, Q.; Zhao, M.; Li, Y.; Wang, Y. The Combined Application of Arbuscular Mycorrhizal Fungi and Biochar Improves the Cd Tolerance of Cinnamomum Camphora Seedlings. Rhizosphere 2024, 31, 100939. [Google Scholar] [CrossRef]
- Kuang, Q.; Wu, Y.; Gao, Y.; An, T.; Liu, S.; Liang, L.; Xu, B.; Zhang, S.; Yu, M.; Shabala, S.; et al. Arbuscular Mycorrhizal Fungi Mitigate Cadmium Stress in Maize. Ecotoxicol. Environ. Saf. 2025, 289, 117600. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.-R.; Zhao, X.-Y.; Zhang, J.-M.; Lu, C.; Feng, F.-J. Arbuscular Mycorrhizal Fungus Regulates Cadmium Accumulation, Migration, Transport, and Tolerance in Medicago Sativa. J. Hazard. Mater. 2022, 435, 129077. [Google Scholar] [CrossRef] [PubMed]
- Sun, S.; Fan, X.; Feng, Y.; Wang, X.; Gao, H.; Song, F. Arbuscular Mycorrhizal Fungi Influence the Uptake of Cadmium in Industrial Hemp (Cannabis sativa L.). Chemosphere 2023, 330, 138728. [Google Scholar] [CrossRef]
- Zhao, T. Synergistic Effects of Combined Application of Biochar and Arbuscular Mycorrhizal Fungi on the Safe Production of Rice in Cadmium Contaminated Soil. Sci. Total Environ. 2024, 951, 175499. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Q.; Xu, P.; Lei, L.; Jing, Y. Transcriptome Analysis Reveals Decreased Accumulation and Toxicity of Cd in Upland Rice Inoculated with Arbuscular Mycorrhizal Fungi. Appl. Soil Ecol. 2022, 177, 104501. [Google Scholar] [CrossRef]
- Chen, X.W.; Wu, L.; Luo, N.; Mo, C.H.; Wong, M.H.; Li, H. Arbuscular Mycorrhizal Fungi and the Associated Bacterial Community Influence the Uptake of Cadmium in Rice. Geoderma 2019, 337, 749–757. [Google Scholar] [CrossRef]
- Fotovvat, M.; Najafi, F.; Khavari-Nejad, R.A.; Talei, D.; Rejali, F. Investigating the Simultaneous Effect of Chitosan and Arbuscular Mycorrhizal Fungi on Growth, Phenolic Compounds, PAL Enzyme Activity and Lipid Peroxidation in Salvia nemorosa L. Plant Physiol. Biochem. 2024, 210, 108617. [Google Scholar] [CrossRef]
- Li, A.; Wu, C.; Zheng, X.; Nie, R.; Tang, J.; Ji, X.; Zhang, J. Physiological and Biochemical Responses of Arbuscular Mycorrhizal Fungi in Symbiosis with Juglans nigra L. Seedlings to Alleviate Salt Stress. Rhizosphere 2024, 31, 100928. [Google Scholar] [CrossRef]
- Wei, H.; He, W.; Mao, X.; Liao, S.; Wang, Q.; Wang, Z.; Tang, M.; Xu, T.; Chen, H. Arbuscular Mycorrhizal Fungi and Exogenous Ca2+ Application Synergistically Enhance Salt and Alkali Resistance in Perennial Ryegrass through Diverse Adaptive Strategies. Microbiol. Res. 2024, 289, 127906. [Google Scholar] [CrossRef] [PubMed]
- Luo, N.; Li, X.; Chen, A.Y.; Zhang, L.J.; Zhao, H.M.; Xiang, L.; Cai, Q.Y.; Mo, C.H.; Wong, M.H.; Li, H. Does Arbuscular Mycorrhizal Fungus Affect Cadmium Uptake and Chemical Forms in Rice at Different Growth Stages? Sci. Total Environ. 2017, 599–600, 1564–1572. [Google Scholar] [CrossRef]
- Zhang, X.; Chen, B.; Ohtomo, R. Mycorrhizal Effects on Growth, P Uptake and Cd Tolerance of the Host Plant Vary among Different AM Fungal Species. Soil Sci. Plant Nutr. 2015, 61, 359–368. [Google Scholar] [CrossRef]
- Suárez, J.P.; Herrera, P.; Kalinhoff, C.; Vivanco-Galván, O.; Thangaswamy, S. Generalist Arbuscular Mycorrhizal Fungi Dominated Heavy Metal Polluted Soils at Two Artisanal and Small-Scale Gold Mining Sites in Southeastern Ecuador. BMC Microbiol. 2023, 23, 42. [Google Scholar] [CrossRef]
- Liao, D.; Sun, C.; Liang, H.; Wang, Y.; Bian, X.; Dong, C.; Niu, X.; Yang, M.; Xu, G.; Chen, A.; et al. SlSPX1-SlPHR Complexes Mediate the Suppression of Arbuscular Mycorrhizal Symbiosis by Phosphate Repletion in Tomato. Plant Cell 2022, 34, 4045–4065. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Liu, M.; Li, Y.; Che, Y.; Xiao, Y. Effects of Arbuscular Mycorrhizal Fungi, Biochar and Cadmium on the Yield and Element Uptake of Medicago sativa. Sci. Total Environ. 2019, 655, 1150–1158. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Luo, N.; Zhang, L.J.; Zhao, H.M.; Li, Y.W.; Cai, Q.Y.; Wong, M.H.; Mo, C.H. Do Arbuscular Mycorrhizal Fungi Affect Cadmium Uptake Kinetics, Subcellular Distribution and Chemical Forms in Rice? Sci. Total Environ. 2016, 571, 1183–1190. [Google Scholar] [CrossRef]
- Ting, Z.; Li, W.; Jixian, Y.; Fang, M. Causal Analysis Between Rice Growth and Cadmium Accumulation and Transfer under Arbuscular Mycorrhizal Inoculation. Rice Sci. 2024, 31, 226–236. [Google Scholar] [CrossRef]
- Gao, M.Y.; Chen, X.W.; Huang, W.X.; Wu, L.; Yu, Z.S.; Xiang, L.; Mo, C.H.; Li, Y.W.; Cai, Q.Y.; Wong, M.H.; et al. Cell Wall Modification Induced by an Arbuscular Mycorrhizal Fungus Enhanced Cadmium Fixation in Rice Root. J. Hazard. Mater. 2021, 416, 125894. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Gao, M.Y.; Mo, C.H.; Wong, M.H.; Chen, X.W.; Wang, J.-J. Potential Use of Arbuscular Mycorrhizal Fungi for Simultaneous Mitigation of Arsenic and Cadmium Accumulation in Rice. J. Exp. Bot. 2022, 73, 50–67. [Google Scholar] [CrossRef]
- Chang, J.-D.; Gao, W.; Wang, P.; Zhao, F.-J. OsNRAMP5 Is a Major Transporter for Lead Uptake in Rice. Environ. Sci. Technol. 2022, 56, 17481–17490. [Google Scholar] [CrossRef]
- Zhang, W.; Guan, M.; Chen, M.; Lin, X.; Xu, P.; Cao, Z. Mutation of OsNRAMP5 Reduces Cadmium Xylem and Phloem Transport in Rice Plants and Its Physiological Mechanism. Environ. Pollut. 2024, 341, 122928. [Google Scholar] [CrossRef]
- Zhang, H.; Sun, B.; Wu, W.; Li, Y.; Yin, Z.; Lu, C.; Zhao, H.; Kong, L.; Ding, X. The MYB Transcription Factor OsMYBxoc1 Regulates Resistance to Xoc by Directly Repressing Transcription of the Iron Transport Gene OsNRAMP5 in Rice. Plant Commun. 2024, 5, 100859. [Google Scholar] [CrossRef] [PubMed]
- Shahzad, M.; Peng, D.; Khan, A.; Ayyaz, A.; Askri, S.M.H.; Naz, S.; Huang, B.; Zhang, G. Sufficient Manganese Supply Is Necessary for OsNramp5 Knockout Rice Plants to Ensure Normal Growth and Less Cd Uptake. Ecotoxicol. Environ. Saf. 2024, 288, 117386. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Li, Y.; Fu, Y.; Xie, H.; Song, S.; Qiu, M.; Wen, J.; Chen, M.; Chen, G.; Tian, Y.; et al. Mutation at Different Sites of Metal Transporter Gene OsNramp5 Affects Cd Accumulation and Related Agronomic Traits in Rice (Oryza sativa L.). Front. Plant Sci. 2019, 10, 1081. [Google Scholar] [CrossRef]
- Chen, B.; Nayuki, K.; Kuga, Y.; Zhang, X.; Wu, S.; Ohtomo, R. Uptake and Intraradical Immobilization of Cadmium by Arbuscular Mycorrhizal Fungi as Revealed by a Stable Isotope Tracer and Synchrotron Radiation μX-Ray Fluorescence Analysis. Microbes Environ. 2018, 33, 257–263. [Google Scholar] [CrossRef] [PubMed]
- Alvarado-López, C.J.; Dasgupta-Schubert, N.; Ambriz, J.E.; Arteaga-Velazquez, J.C.; Villegas, J.A. Lead Uptake by the Symbiotic Daucus carota L.—Glomus intraradices System and Its Effect on the Morphology of Extra- and Intraradical Fungal Microstructures. Environ. Sci. Pollut. Res. 2019, 26, 381–391. [Google Scholar] [CrossRef]
- Luo, F.Z.; Xiang, L.; Li, H.; Zhang, L.J.; Feng, N.X.; Li, Y.W.; Zhao, H.M.; Cai, Q.Y.; Mo, C.H. Effects of arbuscular mycorrhizal fungi (AMF) on growth and Cd accumulation of upland rice and soil enzyme activities in cadmium contaminated soil. J. Agro-Environ. Sci. 2015, 34, 1090–1095. [Google Scholar] [CrossRef]
- Xue, L.; Klinnawee, L.; Zhou, Y.; Saridis, G.; Vijayakumar, V.; Brands, M.; Dörmann, P.; Gigolashvili, T.; Turck, F.; Bucher, M. AP2 Transcription Factor CBX1 with a Specific Function in Symbiotic Exchange of Nutrients in Mycorrhizal Lotus japonicus. Proc. Natl. Acad. Sci. USA 2018, 115, E9239–E9246. [Google Scholar] [CrossRef]
- Xue, L.; Cui, H.; Buer, B.; Vijayakumar, V.; Delaux, P.-M.; Junkermann, S.; Bucher, M. Network of GRAS Transcription Factors Involved in the Control of Arbuscule Development in Lotus japonicus. Plant Physiol. 2015, 167, 854–871. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Wang, Y.; Chen, J.; Wei, J.; Liu, H.; Sui, F.; Li, C.; Zhao, P. OsAMT1.1 Knockout-Induced Decrease in Cadmium Absorption and Accumulation by Rice Related to Cadmium Absorption-Related Gene Downregulation. Ecotoxicol. Environ. Saf. 2024, 288, 117377. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Rao, X.; Huang, X.; Zhou, Z.; Lin, X. An Improvement of the 2−ΔΔCT Method for Quantitative Real-Time Polymerase Chain Reaction Data Analysis. Biostat. Bioinform. Biomath. 2013, 3, 71. [Google Scholar]
- Schmittgen, T.D.; Livak, K.J. Analyzing Real-Time PCR Data by the Comparative CT Method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Liu, J.; Liu, J.; Cui, M.; Huang, Y.; Tian, Y.; Chen, A.; Xu, G. The Potassium Transporter SlHAK10 Is Involved in Mycorrhizal Potassium Uptake. Plant Physiol. 2019, 180, 465–479. [Google Scholar] [CrossRef]
- Liu, J.; Bao, X.; Qiu, G.; Li, H.; Wang, Y.; Chen, X.; Fu, Q.; Guo, B. Genome-Wide Identification and Expression Analysis of SlNRAMP Genes in Tomato under Nutrient Deficiency and Cadmium Stress during Arbuscular Mycorrhizal Symbiosis. Int. J. Mol. Sci. 2024, 25, 8269. [Google Scholar] [CrossRef] [PubMed]
Varieties | Indicator | CK | Ri | Cd | Ri+Cd |
---|---|---|---|---|---|
WT | Height (cm) | 102.0 ± 2.5 a | 99.2 ± 1.4 a | 104.0 ± 1.4 a | 100.8 ± 1.7 a |
Root length (cm) | 32.8 ± 2.8 a | 29.6 ± 2.7 a | 36.8 ± 2.7 a | 36.2 ± 3.3 a | |
Seeds (g) | 19.4 ± 1.4 c | 21.6 ± 0.6 bc | 31.6 ± 0.5 a | 28.4 ± 3.3 ab | |
Shoots (g) | 29.7 ± 3.1 b | 29.2 ± 1.5 b | 42.6 ± 1.6 a | 30.9 ± 3.9 b | |
Roots (g) | 3.8 ± 0.7 a | 3.8 ± 1.0 a | 4.4 ± 0.7 a | 4.1 ± 0.6 a | |
P | Height (cm) | 94.4 ± 0.9 a | 93.3 ± 1.6 a | 99.2 ± 1.9 a | 92.8 ± 1.3 a |
Root length (cm) | 35.6 ± 1.5 b | 44.0 ± 2.1 a | 37.8 ± 1.3 b | 38.0 ± 2.0 b | |
Seeds (g) | 22.1 ± 1.5 b | 21.8 ± 1.5 b | 29.3 ± 1.6 a | 21.1 ± 2.1 b | |
Shoots (g) | 36.1 ± 4.2 a | 33.8 ± 3.2 a | 35.2 ± 2.4 a | 28.3 ± 3.0 a | |
Roots (g) | 3.4 ± 0.4 ab | 2.6 ± 0.1 b | 3.7 ± 0.5 ab | 4.5 ± 0.8 a |
Varieties | Elements | Different Parts | CK | Ri | Cd | Ri+Cd |
---|---|---|---|---|---|---|
WT | K g/kg | Grain | 3.6 ± 0.2 b | 3.8 ± 0.1 b | 4.3 ± 0.3 a | 4.6 ± 0.4 a |
Shoot | 25.2 ± 3.9 a | 29.4 ± 7.3 a | 27.2 ± 3.1 a | 30.0 ± 0.8 a | ||
Root | 1.6 ± 0.0 c | 2.1 ± 0.1 bc | 2.5 ± 0.7 ab | 2.9 ± 0.5 a | ||
Ca g/kg | Grain | 1.7 ± 0.3 b | 2.0 ± 0.3 ab | 1.9 ± 0.2 ab | 2.1 ± 0.1 a | |
Shoot | 7.7 ± 0.8 c | 13.1 ± 1.7 a | 10.1 ± 0.7 b | 9.2 ± 1.2 bc | ||
Root | 14.0 ± 0.7 a | 13.4 ± 0.7 a | 11.6 ± 2.0 a | 12.4 ± 1.6 a | ||
Fe g/kg | Grain | 0.0 ± 0.0 ab | 0.0 ± 0.0 b | 0.1 ± 0.0 a | 0.1 ± 0.0 a | |
Shoot | 0.5 ± 0.2 b | 1.3 ± 0.5 a | 0.6 ± 0.1 b | 0.8 ± 0.1 b | ||
Root | 27.1 ± 5.6 a | 28.5 ± 4.0 a | 28.0 ± 1.5 a | 31.0 ± 4.5 a | ||
Zn mg/kg | Grain | 24.8 ± 4.4 a | 29.7 ± 5.2 a | 26.5 ± 1.7 a | 26.5 ± 0.3 a | |
Shoot | 44.3 ± 3.6 b | 38.6 ± 11.5 b | 43.4 ± 14.4 b | 71.3 ± 1.7 a | ||
Root | 76.9 ± 12.0 b | 78.0 ± 15.3 b | 81.5 ± 24.7 b | 130.4 ± 33.2 a | ||
P | K g/kg | Grain | 3.8 ± 0.4 c | 4.4 ± 0.2 b | 4.4 ± 0.2 b | 4.8 ± 0.1 a |
Shoot | 28.0 ± 1.5 b | 30.4 ± 4.5 ab | 29.9 ± 1.3 ab | 33.9 ± 1.8 a | ||
Root | 3.0 ± 0.3 b | 2.4 ± 0.5 c | 2.6 ± 0.2 bc | 4.1 ± 0.2 a | ||
Ca g/kg | Grain | 2.0 ± 0.1 a | 1.8 ± 0.2 a | 2.1 ± 0.2 a | 1.9 ± 0.3 a | |
Shoot | 8.1 ± 1.6 b | 9.9 ± 0.8 a | 8.5 ± 1.1 ab | 8.6 ± 0.1 ab | ||
Root | 10.4 ± 1.3 b | 10.5 ± 1.2 b | 13.6 ± 2.4 a | 12.0 ± 2.0 ab | ||
Fe g/kg | Grain | 0.1 ± 0.0 a | 0.1 ± 0.0 a | 0.1 ± 0.0 a | 0.1 ± 0.0 a | |
Shoot | 0.7 ± 0.1 a | 0.5 ± 0.0 a | 0.6 ± 0.3 a | 0.7 ± 0.1 a | ||
Root | 24.1 ± 6.8 b | 19.6 ± 2.6 b | 32.5 ± 3.5 a | 24.4 ± 6.6 ab | ||
Zn mg/kg | Grain | 33.0 ± 2.8 a | 35.1 ± 4.1 a | 35.0 ± 7.6 a | 35.7 ± 5.3 a | |
Shoot | 34.9 ± 3.6 ab | 45.5 ± 12.4 a | 29.5 ± 8.2 b | 30.2 ± 4.6 b | ||
Root | 68.2 ± 16.9 b | 116.8 ± 37.3 a | 82.6 ± 47.0 ab | 99.3 ± 22.2 ab |
Primer Name | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
OsACTIN | CAACACCCCTGCTATGTACG | CATCACCAGAGTCCAACACAA |
OsNRAMP1 | CATCGGCATCGTGCTGTTC | TGGCTACCTGTGCTTTCTCG |
OsNRAMP5 | AGCAGCAGTAAGAGCAAGATGG | GGGGAGGTCGTTGTGGATG |
OsIRT1 | GAACCGCGTCGTCGTTCAG | CCATCCCCTCGAACATCTGG |
OsZIP3 | AAGGTGTAGGTTTGGGTGGTTG | TCCTGCTGAGGCTGAGTTGAAG |
OsZIP7 | CCTTGCAATCTGGGCCTGAA | CAGATTAGTCTCACGCCCATGA |
OsCAX1a | TGTGGGTGTTCGCTCTTAGT | GTGCAATCTGCTCTGTGAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bao, X.; Liu, J.; Qiu, G.; Chen, X.; Zhang, J.; Wang, H.; Zhang, Q.; Guo, B. The Effect of Rhizophagus intraradices on Cadmium Uptake and OsNRAMP5 Gene Expression in Rice. Int. J. Mol. Sci. 2025, 26, 1464. https://doi.org/10.3390/ijms26041464
Bao X, Liu J, Qiu G, Chen X, Zhang J, Wang H, Zhang Q, Guo B. The Effect of Rhizophagus intraradices on Cadmium Uptake and OsNRAMP5 Gene Expression in Rice. International Journal of Molecular Sciences. 2025; 26(4):1464. https://doi.org/10.3390/ijms26041464
Chicago/Turabian StyleBao, Xiaoqi, Junli Liu, Gaoyang Qiu, Xiaodong Chen, Junbo Zhang, Hua Wang, Quan Zhang, and Bin Guo. 2025. "The Effect of Rhizophagus intraradices on Cadmium Uptake and OsNRAMP5 Gene Expression in Rice" International Journal of Molecular Sciences 26, no. 4: 1464. https://doi.org/10.3390/ijms26041464
APA StyleBao, X., Liu, J., Qiu, G., Chen, X., Zhang, J., Wang, H., Zhang, Q., & Guo, B. (2025). The Effect of Rhizophagus intraradices on Cadmium Uptake and OsNRAMP5 Gene Expression in Rice. International Journal of Molecular Sciences, 26(4), 1464. https://doi.org/10.3390/ijms26041464