Electrochemical Genosensing of E. coli Based on Padlock Probes and Rolling Circle Amplification
Abstract
:1. Introduction
2. Materials and Methods
2.1. Instrumentation
2.2. Chemicals and Biochemicals
2.3. Design of the Padlock, Capture and Readout Probes
2.4. Selection of the Readout Probe Sequence and Optimization of the Rolling Circle Amplification
2.5. Rolling Circle Amplification on Streptavidin Magnetic Particles and Electrochemical Genosensing
2.6. Direct and Indirect Readout Approach
2.7. Electrochemical Genosensing of E. coli.
3. Results and Discussion
3.1. Selection of the Readout Probe Sequence and Optimization of the Rolling Circle Amplification
3.2. Rolling Circle Amplification on Streptavidin Magnetic Particles and Electrochemical Genosensing. Direct and Indirect Readout Approach
3.3. Rolling Circle Amplification on Streptavidin Magnetic Particles and Electrochemical Genosensing
3.4. Electrochemical Genosensing of E. coli
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Russo, T.A.; Johnson, J.R. A proposal for an inclusive designation for extraintestinal pathogenic Escherichia coli: ExPEC. J. Infect. Dis. 2000, 181, 1753–1754. [Google Scholar] [CrossRef] [Green Version]
- Bonacorsi, S.; Bingen, E. Molecular epidemiology of Escherichia coli causing neonatal meningitis. Int. J. Med. Microbiol. 2005, 295, 373–381. [Google Scholar] [CrossRef]
- Breland, E.J.; Eberly, A.R.; Hadjifrangiskou, M. An Overview of Two-Component Signal Transduction Systems Implicated in Extra-Intestinal Pathogenic E. coli Infections. Front. Cell. Infect. Microbiol. 2017, 7, 162. [Google Scholar] [CrossRef]
- Russo, T.A.; Johnson, J.R. Medical and economic impact of extraintestinal infections due to Escherichia coli: Focus on an increasingly important endemic problem. Microbes Infect. 2003, 5, 449–456. [Google Scholar] [CrossRef]
- Bergsten, G.; Wullt, B.; Svanborg, C. Escherichia coli, fimbriae, bacterial persistence and host response induction in the human urinary tract. Int. J. Med. Microbiol. 2005, 295, 487–502. [Google Scholar] [CrossRef]
- Biran, D.; Ron, E.Z. Extraintestinal pathogenic Escherichia coli. Curr. Top. Microbiol. Immunol. 2018, 416, 149–161. [Google Scholar] [PubMed]
- Simmering, J.E.; Tang, F.; Cavanaugh, J.E.; Polgreen, L.A.; Polgreen, P.M. The Increase in Hospitalizations for Urinary Tract Infections and the Associated Costs in the United States, 1998–2011. Open Forum Infect. Dis. 2017, 4, ofw281. [Google Scholar] [CrossRef] [PubMed]
- von Baum, H.; Marre, R. Antimicrobial resistance of Escherichia coli and therapeutic implications. Int. J. Med. Microbiol. 2005, 295, 503–511. [Google Scholar] [CrossRef]
- Land, K.J.; Boeras, D.I.; Chen, X.S.; Ramsay, A.R.; Peeling, R.W. REASSURED diagnostics to inform disease control strategies, strengthen health systems and improve patient outcomes. Nat Microbiol. 2019, 4, 46–54. [Google Scholar] [CrossRef] [PubMed]
- Smith, S.; Korvink, J.G.; Mager, D.; Land, K. The potential of paper-based diagnostics to meet the ASSURED criteria. RSC Adv. 2018, 8, 34012–34034. [Google Scholar] [CrossRef] [Green Version]
- Cho, I.-H.; Ku, S. Current Technical Approaches for the Early Detection of Foodborne Pathogens: Challenges and Opportunities. Int. J. Mol. Sci. 2017, 18, 2078. [Google Scholar] [CrossRef]
- Urdea, M.; Penny, L.A.; Olmsted, S.S.; Giovanni, M.Y.; Kaspar, P.; Shepherd, A.; Wilson, P.; Dahl, C.A.; Buchsbaum, S.; Moeller, G.; et al. Requirements for high impact diagnostics in the developing world. Nature 2006, 444 (Suppl. 1), 73–79. [Google Scholar] [CrossRef] [PubMed]
- Marx, V. PCR heads into the field. Nat. Methods 2015, 12, 393–397. [Google Scholar] [CrossRef]
- Kühnemund, M.; Wei, Q.; Darai, E.; Wang, Y.; Hernández-Neuta, I.; Yang, Z.; Tseng, D.; Ahlford, A.; Mathot, L.; Sjöblom, T.; et al. Targeted DNA sequencing and in situ mutation analysis using mobile phone microscopy. Nat. Commun. 2017, 8, 13913. [Google Scholar] [CrossRef] [PubMed]
- Hernández-Neuta, I.; Neumann, F.; Brightmeyer, J. Smartphone-based clinical diagnostics: Towards democratization of evidence-based health care. J. Int. Med. 2019, 285, 19–39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Niemz, A.; Ferguson, T.M.; Boyle, D.S. Point-of-care nucleic acid testing for infectious diseases. Trends Biotechnol. 2011, 5, 240–250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carinelli, S.; Kühnemund, M.; Nilsson, M.; Pividori, M.I. Yoctomole electrochemical genosensing of Ebola virus cDNA by rolling circle and circle to circle amplification. Biosens Bioelectron. 2017, 93, 65–71. [Google Scholar] [CrossRef] [PubMed]
- Ciftci, S.; Cánovas, R.; Neumann, F.; Paulraj, T.; Nilsson, M.; Crespo, G.A.; Madaboosi, N. The sweet detection of rolling circle amplification: Glucose-based electrochemical genosensor for the detection of viral nucleic acid. Biosens Bioelectron. 2020, 151, 112002. [Google Scholar] [CrossRef]
- Nilsson, M.; Malmgren, H.; Samiotaki, M.; Kwiatkowski, M.; Chowdhary, B.P.; Landegren, U. Padlock probes: Circularizing oligonucleotides for localized DNA detection. Science 1994, 265, 2085–2088. [Google Scholar] [CrossRef]
- Zhao, Y.; Chen, F.; Li, Q.; Wang, L.; Fan, C. Isothermal Amplification of Nucleic Acids. Chem. Rev. 2015, 115, 12491–12545. [Google Scholar] [CrossRef]
- Carinelli, S.; Xufré, C.; Martí, M.; Pividori, M.I. Interferon gamma transcript detection on T cells based on magnetic actuation and multiplex double-tagging electrochemical genosensing. Biosens Bioelectron. 2018, 117, 183–190. [Google Scholar] [CrossRef]
- Brandão, D.; Liébana, S.; Pividori, M.I. Multiplexed detection of foodborne pathogens based on magnetic particles. New Biotechnol. 2015, 32, 511–520. [Google Scholar] [CrossRef]
- Carinelli, S.; Marti, M.; Alegret, S.; Pividori, M.I. Biomarker detection of global infectious diseases based on magnetic particles. New Biotechnol. 2015, 32, 521–532. [Google Scholar] [CrossRef]
- Janda, J.M.; Abbott, S.L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. J. Clin. Microbiol. 2007, 45, 2761–2764. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Johnson, J.S.; Spakowicz, D.J.; Hong, B.Y. Evaluation of 16S rRNA gene sequencing for species and strain-level microbiome analysis. Nat. Commun. 2019, 10, 5029. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Melin, J.; Jarvius, J.; Göransson, J.; Nilsson, M. Homogeneous amplified single-molecule detection: Characterization of key parameters. Anal. Biochem. 2007, 368, 230–238. [Google Scholar] [CrossRef] [PubMed]
- Russell, C.; Welch, K.; Jarvius, J.; Cai, Y.; Brucas, R.; Nikolajeff, F. Gold Nanowire Based Electrical DNA Detection Using Rolling Circle Amplification. ACS Nano 2014, 8, 1147–1153. [Google Scholar] [CrossRef] [PubMed]
Description | Sequence | Label |
---|---|---|
Padlock probe | [Phos]GTTACCCGCAGAAGAAGAGTGTACCGACCTCAGTATCTTGCGACGTCAGTGGATAGTGTCTTACACGATTTATACCTTTGCTCATTGAC | none |
16s ribosomal E.coli synthetic target | TAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCC | none |
Capture probe | CTCTCTCTCTCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTA | 5′ Biotin (magnetic separation) |
Readout probe 1 | CTTGCGACGTCAGTGGATAGTGTCTTACACGATTT | 5′ HRP (direct electrochemical readout) |
Readout probe 2 | CTTGCGACGTCAGTGGATAGTGTCTTACACGATTT | 5′ DIG (indirect readout) |
Readout probe 3 | CTTGCGACGTCAGTGGATAGTGTCTTACACGATTT | 5′ Cy3 (direct fluorescence readout) |
Readout probe 4 | AGAGTGTACCGACCTC | 5′ Cy3 (direct fluorescence readout) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ben Aissa, A.; Madaboosi, N.; Nilsson, M.; Pividori, M.I. Electrochemical Genosensing of E. coli Based on Padlock Probes and Rolling Circle Amplification. Sensors 2021, 21, 1749. https://doi.org/10.3390/s21051749
Ben Aissa A, Madaboosi N, Nilsson M, Pividori MI. Electrochemical Genosensing of E. coli Based on Padlock Probes and Rolling Circle Amplification. Sensors. 2021; 21(5):1749. https://doi.org/10.3390/s21051749
Chicago/Turabian StyleBen Aissa, Alejandra, Narayanan Madaboosi, Mats Nilsson, and Maria Isabel Pividori. 2021. "Electrochemical Genosensing of E. coli Based on Padlock Probes and Rolling Circle Amplification" Sensors 21, no. 5: 1749. https://doi.org/10.3390/s21051749