Molecular Application of Aptamers in the Diagnosis and Treatment of Cancer and Communicable Diseases
Abstract
:1. Introduction
2. The Synthesis of Aptamers
3. Application of Aptamers in Cancer
3.1. Diagnosis
3.2. Therapy
4. Aptamer Application in the Diagnosis of Infectious Diseases
4.1. EBOLA
4.2. Human Immunodeficiency Virus
4.3. Tuberculosis
4.4. Zika Virus
4.5. Hepatitis Virus
4.6. Rubella Virus
4.7. Human Schistosomiasis
5. Applications of Aptamers for Viral Therapy
5.1. Ebola and Zika
5.2. Aptamers in HIV Therapy
5.2.1. Aptamers Targeting gp120
5.2.2. Aptamers Targeting Reverse Transcriptase, RNase H and Integrase
5.2.3. Aptamers Targeting Nucleocapsid Protein (NC)
5.3. Aptamers in Hepatitis Virus
5.4. Aptamers in Rubella and Schistosomiasis
6. Conclusions and Future Perspectives
Funding
Acknowledgments
Conflicts of Interest
References
- Hoenen, T.; Groseth, A.; Falzarano, D.; Feldmann, H. Ebola virus: Unravelling pathogenesis to combat a deadly disease. Trends Mol. Med. 2006, 12, 206–215. [Google Scholar] [CrossRef] [PubMed]
- Price, J.C.; Thio, C.L. Liver disease in the HIV–infected individual. Clin. Gastroenterol. Hepatol. 2010, 8, 1002–1012. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2016. CA Cancer J. Clin. 2016, 66, 7–30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koyama, S.; Ishii, K.J.; Coban, C.; Akira, S. Innate immune response to viral infection. Cytokine 2008, 43, 336–341. [Google Scholar] [CrossRef] [PubMed]
- Pierson, T.C.; Diamond, M.S. Flaviviruses. Fields Virol. 2013, 6, 747–794. [Google Scholar]
- Wang, D.; Hicks, C.B.; Goswami, N.D.; Tafoya, E.; Ribeiro, R.M.; Cai, F.; Perelson, A.S.; Gao, F. Evolution of drug-resistant viral populations during interruption of antiretroviral therapy. J. Virol. 2011, 85, 6403–6415. [Google Scholar] [CrossRef] [PubMed]
- Germer, K.; Leonard, M.; Zhang, X. RNA aptamers and their therapeutic and diagnostic applications. Int. J. Biochem. Mol. Biol. 2013, 4, 27–40. [Google Scholar] [PubMed]
- Lakhin, A.V.; Tarantul, V.Z.; Gening, L.V. Aptamers: Problems, solutions and prospects. Acta Nat. 2013, 5, 34–43. [Google Scholar]
- Tombelli, S.; Minunni, M.; Mascini, M. Analytical applications of aptamers. Biosens. Bioelectron. 2015, 20, 2424–2434. [Google Scholar] [CrossRef] [PubMed]
- Darmostuk, M.; Rimpelova, S.; Gbelcova, H.; Ruml, T. Current approaches in SELEX: An updates to aptamer selection technology. Biotechnol. Adv. 2015, 33, 1141–1161. [Google Scholar] [CrossRef] [PubMed]
- Stoltenburg, R.; Reinemann, C.; Strehlitz, B. SELEX—A (r) evolutionary method to generate high-affinity nucleic acid ligands. Biomol. Eng. 2007, 24, 381–403. [Google Scholar] [CrossRef] [PubMed]
- Zimbres, F.M.; Tárnok, A.; Ulrich, H.; Wrenger, C. Aptamers: Novel molecules as diagnostic markers in bacterial and viral infections? BioMed Res. Int. 2013, 2013, 731516. [Google Scholar] [CrossRef] [PubMed]
- Morita, Y.; Leslie, M.; Kameyama, H.; Volk, D.E.; Tanaka, T. Aptamer Therapeutics in Cancer: Current and Future. Cancers 2018, 10, 80. [Google Scholar] [CrossRef] [PubMed]
- Platella, C.; Riccardi, C.; Montesarchio, D.; Roviello, G.N.; Musumeci, D. G-quadruplex-based aptamers against protein targets in therapy and diagnostics. Biochim. Biophys. Acta 2017, 1861, 1429–1447. [Google Scholar] [CrossRef] [PubMed]
- Ospina-Villa, J.D.; Zamorano-Carrillo, A.; Castañón-Sánchez, C.A.; Ramírez-Moreno, E.; Marchat, L.A. Aptamers as a promising approach for the control of parasitic diseases. Braz. J. Infect. Dis. 2016, 20, 610–618. [Google Scholar] [CrossRef] [PubMed]
- Sun, H.; Zu, Y. A highlight of recent advances in aptamer technology and its application. Molecules 2015, 20, 11959–11980. [Google Scholar] [CrossRef] [PubMed]
- Bruno, J.G. Predicting the uncertain future of aptamer-based diagnostics and therapeutics. Molecules 2015, 20, 6866–6887. [Google Scholar] [CrossRef] [PubMed]
- Brody, E.N.; Gold, L. Aptamers as therapeutic and diagnostic agents. Rev. Mol. Biotechnol. 2000, 74, 5–13. [Google Scholar] [CrossRef]
- Cheng, C.; Chen, Y.H.; Lennox, K.A.; Behlke, M.A.; Davidson, B.L. In vivo SELEX for Identification of Brain-penetrating Aptamers. Mol. Ther. Nucleic Acids 2013, 2, e67. [Google Scholar] [CrossRef] [PubMed]
- Shum, K.T.; Zhou, J.; Rossi, J.J. Aptamer-based therapeutics: New approaches to combat human viral diseases. Pharmaceuticals 2013, 6, 1507–1542. [Google Scholar] [CrossRef] [PubMed]
- Kulbachinskiy, A.V. Methods for selection of aptamers to protein targets. Biochem. Mosc. 2007, 72, 1505–1518. [Google Scholar] [CrossRef]
- Lee, J.Y.; Bowden, D.S. Rubella virus replication and links to teratogenicity. Clin. Microbiol. Rev. 2000, 13, 571–587. [Google Scholar] [CrossRef] [PubMed]
- Song, K.M.; Lee, S.; Ban, C. Aptamers and their biological applications. Sensors 2012, 12, 612–631. [Google Scholar] [CrossRef] [PubMed]
- Pan, Q.; Luo, F.; Liu, M.; Zhang, X.L. Oligonucleotide aptamers: Promising and powerful diagnostic and therapeutic tools for infectious diseases. J. Infect. 2018, 77, 83–98. [Google Scholar] [CrossRef] [PubMed]
- Kong, H.Y.; Byun, J. Nucleic Acid aptamers: New methods for selection, stabilization, and application in biomedical science. Biomol. Ther. 2013, 21, 423–434. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Yu, X.; Chen, Z.; Yang, T.; Yang, D.; Liu, Q.; Du, K.; Li, B.; Wang, Z.; Li, S.; et al. Aptamer selection and applications for breast cancer diagnostics and therapy. J. Nanobiotechnol. 2017, 15, 81. [Google Scholar] [CrossRef] [PubMed]
- Gopinath, S.C.B. Methods developed for SELEX. Anal. Bioanal. Chem. 2007, 387, 171–182. [Google Scholar] [CrossRef] [PubMed]
- Mencin, N.; Šmuc, T.; Vraničar, M.; Mavri, J.; Hren, M.; Galeša, K.; Krkoč, P.; Ulrich, H.; Šolar, B. Optimization of SELEX: Comparison of different methods for monitoring the progress of in vitro selection of aptamers. J. Pharm. Biomed. Anal. 2014, 91, 151–159. [Google Scholar] [CrossRef] [PubMed]
- Szeto, K.; Latulippe, D.R.; Ozer, A.; Pagano, J.M.; White, B.S.; Shalloway, D.; Lis, J.T.; Craighead, H.G. Rapid-SELEX for RNA aptamers. PLoS ONE 2013, 8, 82667. [Google Scholar] [CrossRef] [PubMed]
- Pereira, R.L.; Nascimento, I.C.; Santos, A.P.; Ogusuku, I.E.; Lameu, C.; Mayer, G.; Ulrich, H. Aptamers: Novelty tools for cancer biology. Oncotarget 2018, 9, 26934. [Google Scholar] [CrossRef] [PubMed]
- Prakash, J.S.; Rajamanickam, K. Aptamers and their significant role in cancer therapy and diagnosis. Biomedicines 2015, 3, 248–269. [Google Scholar] [CrossRef] [PubMed]
- Cerchia, L. Aptamers: Promising Tools for Cancer Diagnosis and Therapy. Cancers 2018, 10, 132. [Google Scholar] [CrossRef] [PubMed]
- Peruski, A.H.; Peruski, L.F. Immunological methods for detection and identification of infectious disease and biological warfare agents. Clin. Diagn. Lab. Immunol. 2003, 10, 506–513. [Google Scholar] [CrossRef] [PubMed]
- Cho, M.; Oh, S.S.; Nie, J.; Stewart, R.; Eisenstein, M.; Chambers, J.; Marth, J.D.; Walker, F.; Thomson, J.A.; Soh, H.T. Quantitative selection and parallel characterization of aptamers. Proc. Natl. Acad. Sci. USA 2013, 110, 18460–18465. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, H.; Liu, J.; Ali, M.M.; Mahmood, M.A.I.; Labanieh, L.; Lu, M.; Iqbal, S.M.; Zhang, Q.; Zhao, W.; Wan, Y. Nucleic acid aptamers in cancer research, diagnosis and therapy. Chem. Soc. Rev. 2015, 44, 1240–1256. [Google Scholar] [CrossRef] [PubMed]
- Cao, B.; Hu, Y.; Duan, J.; Ma, J.; Xu, D.; Yang, X.D. Selection of a novel DNA aptamer for assay of intracellular interferon-gamma. PLoS ONE 2014, 9, e98214. [Google Scholar] [CrossRef] [PubMed]
- Ng, E.W.; Shima, D.T.; Calias, P.; Cunningham, E.T.; Guyer, D.R.; Adamis, A.P. Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease. Nat. Rev. Drug Discov. 2006, 5, 123–132. [Google Scholar] [CrossRef] [PubMed]
- Hori, S.I.; Herrera, A.; Rossi, J.J.; Zhou, J. Current advances in aptamers for cancer diagnosis and therapy. Cancers 2018, 10, 9. [Google Scholar] [CrossRef] [PubMed]
- Ni, S.; Yao, H.; Wang, L.; Lu, J.; Jiang, F.; Lu, A.; Zhang, G. Chemical modifications of nucleic acid aptamers for therapeutic purposes. Int. J. Mol. Sci. 2017, 18, 1683. [Google Scholar] [CrossRef] [PubMed]
- Pi, F.; Zhang, H.; Li, H.; Thiviyanathan, V.; Gorenstein, D.G.; Sood, A.K.; Guo, P. RNA nanoparticles harboring annexin A2 aptamer can target ovarian cancer for tumor-specific doxorubicin delivery. Nanomed. Nanotechnol. Biol. Med. 2017, 13, 1183–1193. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Virgilio, A.; Amato, T.; Petraccone, L.; Esposito, F.; Grandi, N.; Tramontano, E.; Romero, R.; Haider, S.; Gomez-Monterrey, I.; Novellino, E.; et al. Improvement of the activity of the anti-HIV-1 integrase aptamer T30175 by introducing a modified thymidine into the loops. Sci. Rep. 2018, 8, 7447. [Google Scholar] [CrossRef] [PubMed]
- Bukhtoyarov, O.V.; Samarin, D.M. Pathogenesis of cancer: Cancer reparative trap. J. Cancer Ther. 2015, 6, 399–412. [Google Scholar] [CrossRef]
- Wong, R.S.Y. Apoptosis in Cancer: From Pathogenesis to Treatment. J. Exp. Clin. Cancer Res. 2011, 30, 87. [Google Scholar] [CrossRef] [PubMed]
- Deisboeck, T.S.; Couzin, I.D. Collective behavior in cancer cell populations. Bioessays 2009, 31, 190–197. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Krahn, J.M.; Flake, G.P.; Umbach, D.M.; Li, L. Toward predicting metastatic progression of melanoma based on gene expression data. Pigment Cell Melanoma Res. 2015, 28, 453–463. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Available online: www.cancer.gov/types/metastatic-cancer (accessed on 6 June 2017).
- Levy-Nissenbaum, E.; Radovic-Moreno, A.F.; Wang, A.Z.; Langer, R.; Farokhzad, O.C. Nanotechnology and aptamers: Applications in drug delivery. Trends Biotechnol. 2008, 26, 442–449. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Chen, Y.; Han, D.; Ocsoy, I.; Tan, W. Aptamers selected by cell-SELEX for application in cancer studies. Bioanalysis 2010, 2, 907–918. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, N.Y.; Cheng, H.C.; Ko, J.S.; Cheng, Y.C.; Lin, P.W.; Lin, W.C.; Chang, C.Y.; Liou, D.M. Magnetic resonance imaging for lung cancer detection: Experience in a population of more than 10,000 healthy individuals. BMC Cancer 2011, 11, 242. [Google Scholar] [CrossRef] [PubMed]
- Mudiyanselage, A.P.K.; Yu, Q.; Leon-Duque, M.A.; Zhao, B.; Wu, R.; You, M. Genetically Encoded Catalytic Hairpin Assembly for Sensitive RNA Imaging in Live Cells. J. Am. Chem. Soc. 2018, 140, 8739–8745. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Chen, J.; Wu, M.; Zhao, J.X. Aptamers: Active targeting ligands for cancer diagnosis and therapy. Theranostics 2015, 5, 322–344. [Google Scholar] [CrossRef] [PubMed]
- Shigdar, S.; Lin, J.; Yu, Y.; Pastuovic, M.; Wei, M.; Duan, W. RNA aptamer against a cancer stem cell marker epithelial cell adhesion molecule. Cancer Sci. 2011, 102, 991–998. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Musumeci, D.; Platella, C.; Riccardi, C.; Moccia, F.; Montesarchio, D. Fluorescence sensing using DNA aptamers in cancer research and clinical diagnostics. Cancers 2017, 9, 174. [Google Scholar] [CrossRef] [PubMed]
- Boogerd, W.; Groenveld, F.; Linn, S.; Baars, J.W.; Brandsma, D.; van Tinteren, H. Chemotherapy as primary treatment for brain metastases from breast cancer: Analysis of 115 one-year survivors. J. Cancer Res. Clin. Oncol. 2012, 138, 1395–1403. [Google Scholar] [CrossRef] [PubMed]
- Janknegt, R.A.; Boon, T.A.; van De Beek, C.; Grob, P.; Dutch Estracyt Study Group. Combined hormono/chemotherapy as primary treatment for metastatic prostate cancer: A randomized, multicenter study of orchiectomy alone versus orchiectomy plus estramustine phosphate. Urology 2007, 49, 411–420. [Google Scholar] [CrossRef]
- Available online: https://www.cancer.gov/about-cancer/treatment (accessed on 1 October 2017).
- Gijs, M.; Penner, G.; Blackler, G.B.; Impens, N.R.; Baatout, S.; Luxen, A.; Aerts, A.M. Improved aptamers for the diagnosis and potential treatment of her2-positive cancer. Pharmaceuticals 2016, 9, 29. [Google Scholar] [CrossRef] [PubMed]
- Hudis, C.A. Trastuzumab—Mechanism of action and use in clinical practice. N. Engl. J. Med. 2007, 357, 39–51. [Google Scholar] [CrossRef] [PubMed]
- Tai, W.; Mahato, R.; Cheng, K. The role of HER2 in cancer therapy and targeted drug delivery. J. Control. Release 2010, 146, 264–275. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, H.; Zha, Z.; Liu, Y.; Zhang, H.; Zhu, J.; Hu, S.; Shen, G.; Cheng, L.; Niu, L.; Greene, M.I.; et al. Structural insights into the down-regulation of overexpressed p185her2/neu protein of transformed cells by the antibody chA21. J. Biol. Chem. 2011, 286, 31676–31683. [Google Scholar] [CrossRef] [PubMed]
- Gajria, D.; Chandarlapaty, S. HER2-amplified breast cancer: Mechanisms of trastuzumab resistance and novel targeted therapies. Expert Rev. Anticancer Ther. 2011, 11, 263–275. [Google Scholar] [CrossRef] [PubMed]
- Nahta, R.; Hung, M.C.; Esteva, F.J. The HER-2-targeting antibodies trastuzumab and pertuzumab synergistically inhibit the survival of breast cancer cells. Cancer Res. 2004, 64, 2343–2346. [Google Scholar] [CrossRef] [PubMed]
- Bang, Y.J.; Van Cutsem, E.; Feyereislova, A.; Chung, H.C.; Shen, L.; Sawaki, A.; Lordick, F.; Ohtsu, A.; Omuro, Y.; Satoh, T.; et al. Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of HER2-positive advanced gastric or gastro-oesophageal junction cancer (ToGA): A phase 3, open-label, randomised controlled trial. Lancet 2010, 376, 687–697. [Google Scholar] [CrossRef]
- Valabrega, G.; Montemurro, F.; Aglietta, M. Trastuzumab: Mechanism of action, resistance and future perspectives in HER2-overexpressing breast cancer. Ann. Oncol. 2007, 18, 977–984. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Hoinka, J.; Liang, Y.; Adamus, T.; Swiderski, P.; Przytycka, T.M. AptaBlocks: Designing RNA complexes and accelerating RNA-based drug delivery systems. Nucleic Acids Res. 2018. [Google Scholar] [CrossRef] [PubMed]
- Reyes-Reyes, E.; Salipur, F.R.; Shams, M.; Forsthoefel, M.K.; Bates, P.J. Mechanistic studies of anticancer aptamer AS1411 reveal a novel role for nucleolin in regulating Rac1 activation. Mol. Oncol. 2015, 9, 1392–1405. [Google Scholar] [CrossRef] [PubMed]
- Bates, P.J.; Reyes-Reyes, E.M.; Malik, M.T.; Murphy, E.M.; O’toole, M.G.; Trent, J.O. G-quadruplex oligonucleotide AS1411 as a cancer-targeting agent: Uses and mechanisms. Biochim. Biophys. Acta 2017, 1861, 1414–1428. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.; Lee, Y.B.; Lee, J.H.; Lee, D.H.; Cho, E.J.; Yu, S.J.; Kim, Y.J.; Kim, J.I.; Im, J.H.; Lee, J.H.; et al. Modified AS1411 aptamer suppresses hepatocellular carcinoma by up-regulating galectin-14. PLoS ONE 2016, 11, e0160822. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.N.; Tian, X.; Li, W.; Sun, J.; Wei, F.; Feng, W.; Huang, Z.C.; Tian, X.H. Highly Efficient Glioma Targeting of Tat Peptide-TTA1 Aptamer-Polyephylene Glycol-Modified Gelatin-Siloxane Nanoparticles. J. Nanosci. Nanotechnol. 2018, 18, 2325–2329. [Google Scholar] [CrossRef] [PubMed]
- de Almeida, C.E.; Alves, L.N.; Rocha, H.F.; Cabral-Neto, J.B.; Missailidis, S. Aptamer delivery of siRNA, radiopharmaceutics and chemotherapy agents in cancer. Int. J. Pharm. 2017, 525, 334–342. [Google Scholar] [CrossRef] [PubMed]
- Meng, L.; Yang, L.; Zhao, X.; Zhang, L.; Zhu, H.; Liu, C.; Tan, W. Targeted delivery of chemotherapy agents using a liver cancer-specific aptamer. PLoS ONE 2012, 7, e33434. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.; Liu, M.; Jiang, J. The potential of aptamers for cancer research. Anal. Biochem. 2018, 549, 91–95. [Google Scholar] [CrossRef] [PubMed]
- Binzel, D.W.; Shu, Y.; Li, H.; Sun, M.; Zhang, Q.; Shu, D.; Guo, B.; Guo, P. Specific delivery of miRNA for high efficient inhibition of prostate cancer by RNA nanotechnology. Mol. Ther. 2016, 24, 1267–1277. [Google Scholar] [CrossRef] [PubMed]
- Pi, F.; Binzel, D.W.; Lee, T.J.; Li, Z.; Sun, M.; Rychahou, P.; Li, H.; Haque, F.; Wang, S.; Croce, C.M.; et al. Nanoparticle orientation to control RNA loading and ligand display on extracellular vesicles for cancer regression. Nat. Nanotechnol. 2018, 13, 82–89. [Google Scholar] [CrossRef] [PubMed]
- Sanna, V.; Pala, N.; Sechi, M. Targeted therapy using nanotechnology: Focus on cancer. Int. J. Nanomed. 2014, 9, 467–483. [Google Scholar]
- Hrkach, J.; Von Hoff, D.; Ali, M.M.; Andrianova, E.; Auer, J.; Campbell, T.; De Witt, D.; Figa, M.; Figueiredo, M.; Horhota, A.; et al. Preclinical development and clinical translation of a PSMA-targeted docetaxel nanoparticle with a differentiated pharmacological profile. Sci. Transl. Med. 2012, 4, 128ra39. [Google Scholar] [CrossRef] [PubMed]
- Shu, D.; Li, H.; Shu, Y.; Xiong, G.; Carson, W.E., III; Haque, F.; Xu, R.; Guo, P. Systemic delivery of anti-miRNA for suppression of triple negative breast cancer utilizing RNA nanotechnology. ACS Nano 2015, 9, 9731–9740. [Google Scholar] [CrossRef] [PubMed]
- Gormally, M.V.; Dexheimer, T.S.; Marsico, G.; Sanders, D.A.; Lowe, C.; Matak-Vinković, D.; Michael, S.; Jadhav, A.; Rai, G.; Maloney, D.J.; et al. Suppression of the FOXM1 transcriptional programme via novel small molecule inhibition. Nat. Commun. 2014, 5, 5165. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jing, N.; Zhu, Q.; Yuan, P.; Li, Y.; Mao, L.; Tweardy, D.J. Targeting signal transducer and activator of transcription 3 with G-quartet oligonucleotides: A potential novel therapy for head and neck cancer. Mol. Cancer Ther. 2006, 5, 279–286. [Google Scholar] [CrossRef] [PubMed]
- Furqan, M.; Akinleye, A.; Mukhi, N.; Mittal, V.; Chen, Y.; Liu, D. STAT inhibitors for cancer therapy. J. Hematol. Oncol. 2013, 6, 90. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, J.E.; Saphire, E.O. Ebolavirus glycoprotein structure and mechanism of entry. Future Virol. 2009, 4, 621–635. [Google Scholar] [CrossRef] [PubMed]
- Mühlberger, E. Filovirus replication and transcription. Future Virol. 2007, 2, 205–215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Binning, J.M.; Wang, T.; Luthra, P.; Shabman, R.S.; Borek, D.M.; Liu, G.; Xu, W.; Leung, D.W.; Basler, C.F.; Amarasinghe, G.K. Development of RNA aptamers targeting Ebola virus VP35. Biochemistry 2013, 52, 8406–8419. [Google Scholar] [CrossRef] [PubMed]
- Basler, C.F.; Mikulasova, A.; Martinez-Sobrido, L.; Paragas, J.; Mühlberger, E.; Bray, M.; Klenk, H.D.; Palese, P.; García-Sastre, A. The Ebola virus VP35 protein inhibits activation of interferon regulatory factor 3. J. Virol. 2003, 77, 7945–7956. [Google Scholar] [CrossRef] [PubMed]
- Cárdenas, W.B.; Loo, Y.M.; Gale, M.; Hartman, A.L.; Kimberlin, C.R.; Martínez-Sobrido, L.; Saphire, E.O.; Basler, C.F. Ebola virus VP35 protein binds double-stranded RNA and inhibits alpha/beta interferon production induced by RIG-I signaling. J. Virol. 2006, 80, 5168–5178. [Google Scholar] [CrossRef] [PubMed]
- Leung, D.W.; Prins, K.C.; Borek, D.M.; Farahbakhsh, M.; Tufariello, J.M.; Ramanan, P.; Nix, J.C.; Helgeson, L.A.; Otwinowski, Z.; Honzatko, R.B.; et al. Structural basis for dsRNA recognition and interferon antagonism by Ebola VP35. Nat. Struct. Mol. Biol. 2010, 17, 165–172. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feng, Z.; Cerveny, M.; Yan, Z.; He, B. The VP35 protein of Ebola virus inhibits the antiviral effect mediated by double-stranded RNA-dependent protein kinase PKR. J. Virol. 2007, 81, 182–192. [Google Scholar] [CrossRef] [PubMed]
- Haasnoot, J.; De Vries, W.; Geutjes, E.J.; Prins, M.; De Haan, P.; Berkhout, B. The Ebola virus VP35 protein is a suppressor of RNA silencing. PLoS Pathog. 2007, 3, e86. [Google Scholar] [CrossRef] [PubMed]
- Nelson, E.V.; Schmidt, K.M.; Deflubé, L.R.; Doğanay, S.; Banadyga, L.; Olejnik, J.; Hume, A.J.; Ryabchikova, E.; Ebihara, H.; Kedersha, N.; et al. Ebola virus does not induce stress granule formation during infection and sequesters stress granule proteins within viral inclusions. J. Virol. 2016, 90, 7268–7284. [Google Scholar] [CrossRef] [PubMed]
- Wahl-Jensen, V.M.; Afanasieva, T.A.; Seebach, J.; Ströher, U.; Feldmann, H.; Schnittler, H.J. Effects of Ebola virus glycoproteins on endothelial cell activation and barrier function. J. Virol. 2005, 79, 10442–10450. [Google Scholar] [CrossRef] [PubMed]
- Alexander, K.A.; Sanderson, C.E.; Marathe, M.; Lewis, B.L.; Rivers, C.M.; Shaman, J.; Drake, J.M.; Lofgren, E.; Dato, V.M.; Eisenberg, M.C.; et al. What factors might have led to the emergence of Ebola in West Africa? PLoS Negl. Trop. Dis. 2015, 9, 0003652. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moghadam, S.R.J.; Omidi, N.; Bayrami, S.; Moghadam, S.J.; SeyedAlinaghi, S. Ebola viral disease: A review literature. Asian Pac. J. Trop. Biomed. 2015, 5, 260–267. [Google Scholar] [CrossRef]
- Broadhurst, M.J.; Brooks, T.J.; Pollock, N.R. Diagnosis of Ebola virus disease: Past, present, and future. Clin. Microbiol. Rev. 2016, 29, 773–793. [Google Scholar] [CrossRef] [PubMed]
- Wandtke, T.; Woźniak, J.; Kopiński, P. Aptamers in diagnostics and treatment of viral infections. Viruses 2015, 7, 751–780. [Google Scholar] [CrossRef] [PubMed]
- González, V.M.; Martín, M.E.; Fernández, G.; García-Sacristán, A. Use of aptamers as diagnostics tools and antiviral agents for human viruses. Pharmaceuticals 2016, 9, 78. [Google Scholar] [CrossRef] [PubMed]
- Gonçalves, L.S.; Silva, A.; Ferreira, S.M.S.; Sousa, C.O.; Fontes, T.V.; Vettore, M.V.; Torres, S.R. Factors associated with specific clinical forms of oral candidiasis in HIV-infected Brazilian adults. Arch. Oral Biol. 2013, 58, 657–663. [Google Scholar] [CrossRef] [PubMed]
- Deeks, S.G. Treatment of antiretroviral-drug-resistant HIV-1 infection. Lancet 2003, 362, 2002–2011. [Google Scholar] [CrossRef]
- Available online: www.who.int/mediacentre/factsheets/fs104/en/ (accessed on 10 June 2017).
- Aaron, L.; Saadoun, D.; Calatroni, I.; Launay, O.; Memain, N.; Vincent, V.; Marchal, G.; Dupont, B.; Bouchaud, O.; Valeyre, D.; et al. Tuberculosis in HIV-infected patients: A comprehensive review. Clin. Microbiol. Infect. 2004, 10, 388–398. [Google Scholar] [CrossRef] [PubMed]
- Sasindran, S.J.; Torrelles, J.B. Mycobacterium tuberculosis infection and inflammation: What is beneficial for the host and for the bacterium? Front. Microbiol. 2011, 2, 2. [Google Scholar] [CrossRef] [PubMed]
- Feng, X.; Xiu, B.; Chen, K.; Yang, X.; Zhang, H.; Yue, J.; Tan, Y.; Li, H.; Nicholson, R.A.; Tam, A.W.; et al. Enhanced serodiagnostic utility of novel Mycobacterium tuberculosis polyproteins. J. Infect. 2013, 66, 366–375. [Google Scholar] [CrossRef] [PubMed]
- Sypabekova, M.; Bekmurzayeva, A.; Wang, R.; Li, Y.; Nogues, C.; Kanayeva, D. Selection, characterization, and application of DNA aptamers for detection of Mycobacterium tuberculosis secreted protein MPT64. Tuberculosis 2017, 104, 70–78. [Google Scholar] [CrossRef] [PubMed]
- Calvet, G.; Aguiar, R.S.; Melo, A.S.; Sampaio, S.A.; de Filippis, I.; Fabri, A.; Araujo, E.S.; de Sequeira, P.C.; de Mendonça, M.C.; de Oliveira, L.; et al. Detection and sequencing of Zika virus from amniotic fluid of fetuses with microcephaly in Brazil: A case study. Lancet Infect. Dis. 2016, 16, 653–660. [Google Scholar] [CrossRef]
- Faye, O.; Freire, C.C.; Iamarino, A.; Faye, O.; de Oliveira, J.V.C.; Diallo, M.; Zanotto, P.M. Molecular evolution of Zika virus during its emergence in the 20th century. PLoS Negl. Trop. Dis. 2014, 8, e2636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Plourde, A.R.; Bloch, E.M. A literature review of Zika virus. Emerg. Infect. Dis. 2016, 22, 1185. [Google Scholar] [CrossRef] [PubMed]
- Saiz, J.C.; Vázquez-Calvo, Á.; Blázquez, A.B.; Merino-Ramos, T.; Escribano-Romero, E.; Martín-Acebes, M.A. Zika virus: The latest newcomer. Front. Microbiol. 2016, 7, 496. [Google Scholar] [CrossRef] [PubMed]
- Fauci, A.S.; Morens, D.M. Zika virus in the Americas—Yet another arbovirus threat. N. Engl. J. Med. 2016, 374, 601–604. [Google Scholar] [CrossRef] [PubMed]
- Ali, A.; Wahid, B.; Rafique, S.; Idrees, M. Advances in research on Zika virus. Asian Pac. J. Trop. Med. 2017, 10, 321–331. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.K. Monitoring intact viruses using aptamers. Biosensors 2016, 6, 40. [Google Scholar] [CrossRef] [PubMed]
- Heiat, M.; Ranjbar, R.; Alavian, S.M. Classical and modern approaches used for viral hepatitis diagnosis. Hepat. Mon. 2014, 14, e17632. [Google Scholar] [CrossRef] [PubMed]
- Available online: www.who.int/features/qa/76/en/ (accessed on 25 June 2017).
- Yadav, R.; Dwivedi, S.; Kumar, S.; Chaudhury, A. Trends and perspectives of biosensors for food and environmental virology. Food Environ. Virol. 2010, 2, 53–63. [Google Scholar] [CrossRef]
- Available online: www.who.int/hepatitis/publications/global-hepatitis-report2017/en/ (accessed on 25 June 2017).
- Adjei, C.A.; Asamoah, R.; Atibila, F.; Ti-enkawol, G.N.; Ansah-Nyarko, M. Mother-to-child transmission of hepatitis B: Extent of knowledge of physicians and midwives in Eastern region of Ghana. BMC Public Health 2016, 16, 537. [Google Scholar] [CrossRef] [PubMed]
- Feng, H.; Beck, J.; Nassal, M.; Hu, K.H. A SELEX-screened aptamer of human hepatitis B virus RNA encapsidation signal suppresses viral replication. PLoS ONE 2011, 6, e27862. [Google Scholar] [CrossRef] [PubMed]
- Lee, C.H.; Lee, Y.J.; Kim, J.H.; Lim, J.H.; Kim, J.H.; Han, W.; Lee, S.H.; Noh, G.J.; Lee, S.W. Inhibition of hepatitis C virus (HCV) replication by specific RNA aptamers against HCV NS5B RNA replicase. J. Virol. 2013, 87, 7064–7074. [Google Scholar] [CrossRef] [PubMed]
- Mirian, M.; Khanahmad, H.; Darzi, L.; Salehi, M.; Sadeghi-Aliabadi, H. Oligonucleotide aptamers: Potential novel molecules against viral hepatitis. Res. Pharm. Sci. 2017, 12, 88–98. [Google Scholar] [CrossRef] [PubMed]
- Prasad, V.M.; Willows, S.D.; Fokine, A.; Battisti, A.J.; Sun, S.; Plevka, P.; Hobman, T.C.; Rossmann, M.G. Rubella virus capsid protein structure and its role in virus assembly and infection. Proc. Natl. Acad. Sci. 2013, 110, 20105–20110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- White, S.J.; Boldt, K.L.; Holditch, S.J.; Poland, G.A.; Jacobson, R.M. Measles, mumps, and rubella. Clin. Obstet. Gynecol. 2012, 55, 550. [Google Scholar] [CrossRef] [PubMed]
- Van Nguyen, T.; Abe, K. Pathogenesis of congenital rubella virus infection in human fetuses: Viral infection in the ciliary body could play an important role in cataractogenesis. EBioMedicine 2015, 2, 59–63. [Google Scholar] [CrossRef] [PubMed]
- Revello, M.G.; Baldanti, F.; Sarasini, A.; Zavattoni, M.; Torsellini, M.; Gerna, G. Prenatal diagnosis of rubella virus infection by direct detection and semiquantitation of viral RNA in clinical samples by reverse transcription-PCR. J. Clin. Microbiol. 1997, 35, 708–713. [Google Scholar] [PubMed]
- Mori, N.; Motegi, Y.; Shimamura, Y.; Ezaki, T.; Natsumeda, T.; Yonekawa, T.; Ota, Y.; Notomi, T.; Nakayama, T. Development of a new method for diagnosis of rubella virus infection by reverse transcription-loop-mediated isothermal amplification. J. Clin. Microbiol. 2006, 44, 3268–3273. [Google Scholar] [CrossRef] [PubMed]
- Long, Y.; Qin, Z.; Duan, M.; Li, S.; Wu, X.; Lin, W.; Li, J.; Zhao, Z.; Liu, J.; Xiong, D.; et al. Screening and identification of DNA aptamers toward Schistosoma japonicum eggs via SELEX. Sci. Rep. 2016, 6, 24986. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nour, N.M. Schistosomiasis: Health effects on women. Rev. Obstet. Gynecol. 2010, 3, 28–32. [Google Scholar] [PubMed]
- He, P.; Song, L.G.; Xie, H.; Liang, J.Y.; Yuan, D.Y.; Wu, Z.D.; Lv, Z.Y. Nucleic acid detection in the diagnosis and prevention of schistosomiasis. Infect. Dis. Poverty 2016, 5, 25. [Google Scholar] [CrossRef] [PubMed]
- Zaghloul, M.S. Bladder cancer and schistosomiasis. J. Egypt. Natl. Cancer Inst. 2012, 24, 151–159. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Soto, P.; Arahuetes, J.G.; Hernández, A.S.; Abán, J.L.; Santiago, B.V.; Muro, A. A loop-mediated isothermal amplification (LAMP) assay for early detection of Schistosoma mansoni in stool samples: A diagnostic approach in a murine model. PLoS Negl. Trop. Dis. 2014, 8, e3126. [Google Scholar] [CrossRef] [PubMed]
- Vinores, S.A. Pegaptanib in the treatment of wet, age-related macular degeneration. Int. J. Nanomed. 2006, 1, 263–268. [Google Scholar]
- Doggrell, S.A. Pegaptanib: The first antiangiogenic agent approved for neovascular macular degeneration. Expert Opin. Pharmacother. 2005, 6, 1421–1423. [Google Scholar] [CrossRef] [PubMed]
- Schwarz-Schilling, M.; Dupin, A.; Chizzolini, F.; Krishnan, S.; Mansy, S.S.; Simmel, F.C. Optimized Assembly of a Multifunctional RNA-Protein Nanostructure in a Cell-Free Gene Expression System. Nano Lett. 2018, 18, 2650–2657. [Google Scholar] [CrossRef] [PubMed]
- Jasinski, D.; Haque, F.; Binzel, D.W.; Guo, P. Advancement of the emerging field of RNA nanotechnology. ACS Nano 2017, 11, 1142–1164. [Google Scholar] [CrossRef] [PubMed]
- Imaz, A.; Falcó, V.; Ribera, E. Antiretroviral salvage therapy for multiclass drug-resistant HIV-1-infected patients: From clinical trials to daily clinical practice. AIDS Rev. 2011, 13, 180–193. [Google Scholar] [PubMed]
- Zhou, J.; Swiderski, P.; Li, H.; Zhang, J.; Neff, C.P.; Akkina, R.; Rossi, J.J. Selection, characterization and application of new RNA HIV gp 120 aptamers for facile delivery of Dicer substrate siRNAs into HIV infected cells. Nucleic Acids Res. 2009, 37, 3094–3109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dey, A.K.; Griffiths, C.; Lea, S.M.; James, W. Structural characterization of an anti-gp120 RNA aptamer that neutralizes R5 strains of HIV-1. RNA 2005, 11, 873–884. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mescalchin, A.; Restle, T. Oligomeric nucleic acids as antivirals. Molecules 2011, 16, 1271–1296. [Google Scholar] [CrossRef] [PubMed]
- Valeria, R.; Marchand, A.; Mendoza, O.; D’Alonzo, D.; Zarrelli, A.; Gabelica, V.; di Fabio, G. Kinetic ESI-MS studies of potent anti-HIV aptamers based on the G-quadruplex forming sequence d (TGGGAG). ACS Med. Chem. Lett. 2016, 7, 256–260. [Google Scholar]
- Domenica, M.; Riccardi, C.; Montesarchio, D. G-quadruplex forming oligonucleotides as anti-HIV agents. Molecules 2015, 20, 17511–17532. [Google Scholar]
- de Soultrait, V.R.; Lozach, P.Y.; Altmeyer, R.; Tarrago-Litvak, L.; Litvak, S.; Andreola, M.L. DNA aptamers derived from HIV-1 RNase H inhibitors are strong anti-integrase agents. J. Mol. Biol. 2002, 324, 195–203. [Google Scholar] [CrossRef]
- Sarafianos, S.G.; Marchand, B.; Das, K.; Himmel, D.M.; Parniak, M.A.; Hughes, S.H.; Arnold, E. Structure and function of HIV-1 reverse transcriptase: Molecular mechanisms of polymerization and inhibition. J. Mol. Biol. 2009, 385, 693–713. [Google Scholar] [CrossRef] [PubMed]
- Somasunderam, A.; Ferguson, M.R.; Rojo, D.R.; Thiviyanathan, V.; Li, X.; O’Brien, W.A.; Gorenstein, D.G. Combinatorial selection, inhibition and antiviral activity of DNA thioaptamers targeting the RNase H domain of HIV-1 reverse transcriptase. Biochemistry 2005, 44, 10388–10395. [Google Scholar] [CrossRef] [PubMed]
- Faure-Perraud, A.; Métifiot, M.; Reigadas, S.; Recordon-Pinson, P.; Parissi, V.; Ventura, M.; Andréola, M.L. The guanine-quadruplex aptamer 93del inhibits HIV-1 replication ex vivo by interfering with viral entry, reverse transcription and integration. Antivir. Ther. 2011, 16, 383–394. [Google Scholar] [CrossRef] [PubMed]
- Mattia, M.; Kovalenko, L.; Lyonnais, S.; Antaki, D.; Torbett, B.E.; Botta, M.; Mirambeau, G.; Mély, Y. Nucleocapsid protein: A desirable target for future therapies against HIV-1. In The Future of HIV-1 Therapeutics; Springer: Cham, Switzerland, 2015; pp. 53–92. [Google Scholar]
- Jin, K.S.; Kim, M.Y.; Lee, J.H.; You, J.C.; Jeong, S. Selection and stabilization of the RNA aptamers against the human immunodeficiency virus type-1 nucleocapsid protein. Biochem. Biophys. Res. Commun. 2002, 291, 925–931. [Google Scholar]
- Locarnini, S.; Warner, N. Major causes of antiviral drug resistance and implications for treatment of hepatitis B virus monoinfection and coinfection with HIV. Antivir. Ther. 2007, 12, H15–H23. [Google Scholar] [PubMed]
- Feng, H.; Hu, K.H. Aptamers against viral hepatitis: From rational design to practical application. Virol. Sin. 2008, 23, 315–320. [Google Scholar] [CrossRef]
- Pawlotsky, J.M. Treatment failure and resistance with direct-acting antiviral drugs against hepatitis C virus. Hepatology 2011, 53, 1742–1751. [Google Scholar] [CrossRef] [PubMed]
- Donovan, M.J. Veraptus Therapeutic Aptamers for the Treatment of Viral Infectious Diseases. 2015. Available online: http://veraptus.com/assets/veraptus-therapeutic-aptamers-for-the-treatment-of-viral-infectious-diseases.pdf (accessed on 24 July 2017).
- Coeli, R.; Baba, E.H.; Araujo, N.; Coelho, P.M.; Oliveira, G. Praziquantel treatment decreases Schistosoma mansoni genetic diversity in experimental infections. PLoS Negl. Trop. Dis. 2013, 7, e2596. [Google Scholar] [CrossRef] [PubMed]
- Greenberg, R.M. New approaches for understanding mechanisms of drug resistance in schistosomes. Parasitology 2013, 140, 1534–1546. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Melman, S.D.; Steinauer, M.L.; Cunningham, C.; Kubatko, L.S.; Mwangi, I.N.; Wynn, N.B.; Mutuku, M.W.; Karanja, D.M.; Colley, D.G.; Black, C.L.; et al. Reduced susceptibility to praziquantel among naturally occurring Kenyan isolates of Schistosoma mansoni. PLoS Negl. Trop. Dis. 2009, 3, 504. [Google Scholar] [CrossRef] [PubMed]
- Ashrafuzzaman, M. Aptamers as both drugs and drug-carriers. BioMed Res. Int. 2014, 2014, 697923. [Google Scholar] [CrossRef] [PubMed]
- Jing, N.; Li, Y.; Xiong, W.; Sha, W.; Jing, L.; Tweardy, D.J. G-quartet oligonucleotides: A new class of signal transducer and activator of transcription 3 inhibitors that suppresses growth of prostate and breast tumors through induction of apoptosis. Cancer Res. 2004, 64, 6603–6609. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Zhang, J.; Pei, X.; Zhang, Q.; Lu, B.; Zhang, X.; Liu, J. An aptamer targets HBV core protein and suppresses HBV replication in HepG2. 2.15 cells. Int. J. Mol. Med. 2014, 34, 1423–1429. [Google Scholar] [CrossRef] [PubMed]
Strengths | Limitations |
---|---|
Aptamers’ entire selection process can be carried out in a test tube | Unmodified RNA aptamers are susceptible to nuclease degradation in in vivo applications [24] |
They have high binding affinities, selectivity and specificity to their targets making them important for diagnostics and targeted therapy | Unmodified oligonucleotides have a short half-life, i.e., they quickly undergo renal filtration [24] |
They are thermostable [39] | |
Can be structurally modified to enhance specificity and stability, therefore increasing aptamer half-life in in vivo applications [39,40,41] | |
They are non-toxic and elicit little or no immunogenic response [41] |
Aptamers | Sequence 5’ | Structure | Organism | Target | Function |
---|---|---|---|---|---|
AS1411 (DNA) | d(GGTGGTGGTGGTTGTGGTGGTGGTGG) | G-quadruplex | Cancer | Nucleolin | Specifically detects cancer cells [14,48] Promotes cell death, prevents cell proliferation via Rac 1 activation [66] Up-regulates Galectin-14 and suppresses hepatocellular carcinoma [68] |
T40214 (DNA) | d(GGGCGGGCGGGCGGGC) | G-quartet | Cancer | STAT3- protein | [14,79,152] |
HJ24 (DNA) | d(AGCGTCGAATACCACACGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT) | G-quadruplex | Cancer | Shp2 | In vitro studies (IC50 = 29 nM) [14] |
TTA1 (RNA) | - | - | Cancer | Domain of tenacin | Prevents angiogenesis, invasion and tumour growth [48] |
MUC 1 (DNA) | GCAGTTGATCCTTTGGATACCCTGG | - | Cancer | Mucin-1 | [26] |
AS1411 (DNA) | d(GGTGGTGGTGGTTGTGGTGGTGGTGG) | G-quadruplex | HIV | Nucleolin | Antiviral activity (in vitro) (EC50 = 15.4 nM) [14] |
37NT (DNA) | - | - | HIV (HXB strain) | HIV reverse transcriptase (RT) | Blocks RT active site, prevents viral replication [95] |
ISIS5320 | d(T*T*G*G*G*G*T*T) | G-quadruplex | HIV | HIV gp120 | Prevents viral adsorption, inhibits HIV infection (in vitro) IC50 = 0.30 μM) [14] |
Hotoda sequence | DBB-d(TGGGAG) and TBDPS-d(TGGGAG) | G-quadruplex | HIV | HIV gp120 | In vitro (IC50 = 0.37 μM and 0.88 μM, resp.) [14] |
Zintevir | d(G*TGGTGGGTGGGTGGG*T) | G-quadruplex | HIV | HIV Integrase | Completed phase 1 [137] |
ODN93 | d(GGGGGTGGGAGGAGGGTAGGCCTTAGGTTTCTGA) | HIV | HIV RNase H | Inhibits RNase H activity In vitro (IC50 = 0.50 μM) [14,95] | |
ODN 112 | d(CCAGTGGCGGGTGGGTGGGTGGTGGGGGGACTTGG) | HIV | HIV RNase H | Inhibits RNase H activity In vitro (IC50 = 0.50 μM) [14,95] | |
ZE2 (DNA) | - | - | HCV | HCV-E2 glycoprotein | Inhibits E2 binding on CD81 receptors [12] |
Apt.No.28 (DNA) | - | - | HBV | HBV nucleocapsid | Prevents nucleocapsid assembly and DNA synthesis [153] |
NK2 (DNA) | - | - | Mycobacterium tuberculosis H37Rv strain | Membrane Proteins | Acts as an antibacterial agent, promotes cytokine production [12] |
LC6 and LC15 (DNA) | - | - | Schistosomiasis | Schistosoma eggs | Binds specifically to Schistosoma eggs [121] |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Molefe, P.F.; Masamba, P.; Oyinloye, B.E.; Mbatha, L.S.; Meyer, M.; Kappo, A.P. Molecular Application of Aptamers in the Diagnosis and Treatment of Cancer and Communicable Diseases. Pharmaceuticals 2018, 11, 93. https://doi.org/10.3390/ph11040093
Molefe PF, Masamba P, Oyinloye BE, Mbatha LS, Meyer M, Kappo AP. Molecular Application of Aptamers in the Diagnosis and Treatment of Cancer and Communicable Diseases. Pharmaceuticals. 2018; 11(4):93. https://doi.org/10.3390/ph11040093
Chicago/Turabian StyleMolefe, Philisiwe Fortunate, Priscilla Masamba, Babatunji Emmanuel Oyinloye, Londiwe Simphiwe Mbatha, Mervin Meyer, and Abidemi Paul Kappo. 2018. "Molecular Application of Aptamers in the Diagnosis and Treatment of Cancer and Communicable Diseases" Pharmaceuticals 11, no. 4: 93. https://doi.org/10.3390/ph11040093