Next Article in Journal
Potential Mechanism of Tibetan Medicine Liuwei Muxiang Pills against Colorectal Cancer: Network Pharmacology and Bioinformatics Analyses
Previous Article in Journal
Identification of Ureidocoumarin-Based Selective Discoidin Domain Receptor 1 (DDR1) Inhibitors via Drug Repurposing Approach, Biological Evaluation, and In Silico Studies
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pharmaceuticals
Volume 17
Issue 4
10.3390/ph17040428
pharmaceuticals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Significance of Cytomegalovirus gB Genotypes in Adult Patients Undergoing Hematopoietic Stem Cell Transplantation: Insights from a Single-Centre Investigation

by
Tamara Vasiljevic
1,
Marko Jankovic
1,2,*,
Ana Tomic
1,
Ida Bakrac
1,
Stefan Radenovic
1,
Danijela Miljanovic
1,2,
Aleksandra Knezevic
1,2,
Tanja Jovanovic
3,
Irena Djunic
1,4 and
Milena Todorovic-Balint
1,4
1
Faculty of Medicine, University of Belgrade, 8 Dr Subotica Street, 11000 Belgrade, Serbia
2
Department of Virology, Institute of Microbiology and Immunology, 1 Dr Subotica Street, 11000 Belgrade, Serbia
3
Institute for Biocides and Medical Ecology, 16 Trebevicka Street, 11000 Belgrade, Serbia
4
Clinic of Haematology, University Clinical Centre of Serbia, University of Belgrade, 2 Dr Koste Todorovica Street, 11000 Belgrade, Serbia
*
Author to whom correspondence should be addressed.
Pharmaceuticals 2024, 17(4), 428; https://doi.org/10.3390/ph17040428
Submission received: 19 January 2024 / Revised: 26 February 2024 / Accepted: 19 March 2024 / Published: 27 March 2024
(This article belongs to the Section Biopharmaceuticals)
Browse Figures
Versions Notes

Abstract

:
Introduction: Cytomegalovirus (CMV) infection is a major clinical issue after allogeneic hematopoietic stem cell transplantation (HSCT). The CMV envelope glycoproteins are key in viral pathogenesis; the glycoprotein B (gB) encoded by the UL55 gene might be an important determinant of viral virulence and disease severity marker in patients treated with allogeneic HSCT. Our aim was to investigate the molecular diversity of CMV gB and inquire into the associations between UL55 gene variations and clinical manifestations in adult patients treated with allogeneic HSCT. Results: The most prevalent genotypes were gB1 and gB4 (11/27, 40.7%). Patients with genotype gB1 infection had earlier platelet engraftment (p < 0.033) and less frequent minimal/measurable residual disease post HSCT than those without this genotype. Patients with gB4 glycoprotein infection had a significantly lower CD4+/CD8+ ratio at D90 (p < 0.026). Interestingly, patients with gB5 glycoprotein infection had shorter overall survival from base condition diagnosis (p < 0.042), as well as shorter overall survival after HSCT (p < 0.036). Acute GvHD was noted more frequently in those with mixed-genotype infection (p = 0.047). Material and Methods: The study included fifty-nine adult patients treated with allogeneic HSCT. Peripheral venous blood was sampled typically per week, with detection of CMV performed by quantitative real-time PCR. Multiplex nested PCR was used to determine specific gB genotypes, which were then statistically compared vis-à-vis specific clinical variables. Conclusions: Our study points to variations in the viral UL55 locus imparting both beneficial (earlier platelet engraftment, less frequent MRD post HSCT) and adverse effects (shorter overall survival, more frequent acute GvHD, less frequent 100% chimerism at day 90) to the transplanted host. Comprehensive molecular investigations are necessary to validate this apparent duality, as the potential benefits of CMV could perhaps be utilized for the benefit of the patient in the future.

1. Introduction

Cytomegalovirus (CMV), also known as human betaherpesvirus 5, is a DNA pathogen that falls under the Orthoherpesviridae family [1]. This versatile virus possesses a large genome of approximately 236 kb, housing over 200 protein-coding open reading frames. It exhibits significant genetic diversity with polymorphisms distributed across its genome [2]. CMV has the capability to replicate in various cell types, including hematopoietic, epithelial, and endothelial cells, as well as fibroblasts and smooth muscle cells [3].
Primary CMV infection typically occurs in early childhood and is often asymptomatic or may manifest occasionally as a mononucleosis-like syndrome [4]. However, in immunocompromised individuals, CMV can lead to severe diseases such as encephalitis, pneumonitis, hepatitis, uveitis, retinitis, and gastrointestinal issues. Notably, CMV is a frequent cause of congenital infections and a common contributor to central nervous system complications in newborns, such as mental retardation, cerebral palsy, and seizures [5]. In the context of immunocompromised patients, CMV infection poses a significant challenge, particularly after allogeneic hematopoietic stem cell transplantation (HSCT), resulting in considerable morbidity and mortality [6].
Similar to all herpesviruses, CMV establishes a lifelong latent infection after primary infection, which may sporadically reactivate. The virus’s genetic diversity allows for reinfection by different viral strains within the same host [3,4]. The genes encoding CMV envelope glycoproteins and play a crucial role in this diverse genetic assortment. These glycoproteins are involved in viral entry and cell fusion, serving as important targets for virus-neutralizing antibodies [3]. Surface glycoprotein B (gB), encoded by the UL55 gene, is classified into four major genotypes (gB1, gB2, gB3, and gB4) and three non-prototypic ones (gB5, gB6, and gB7) [3,7,8,9,10,11,12,13]. Previous studies have emphasized gB’s essential role in virus ingress, cell-to-cell spread, and its potential significance as a virulence determinant [3,14].
Allogeneic HSCT is associated with severe treatment-related complications, including infections, high transfusion requirements, and graft-versus-host disease (GvHD) [15]. CMV stands out as a prominent pathogen affecting immunocompromised patients. Given that both the immune response and clinical outcomes of CMV infection may hinge on the viral strain [6], our objective was to explore the molecular diversity of CMV glycoprotein B and investigate associations between UL55 gene variations and clinical manifestations in adult patients undergoing allogeneic HSCT.

2. Results

We investigated the molecular diversity of CMV glycoprotein B and its relation to clinical manifestations in adult patients treated with allogeneic HSCT. The study included fifty-nine patients (29 female, 30 male).
The incidence of CMV DNAemia was 44/59 (74.6%). Five gB genotypes (gB1, gB2, gB3, gB4, and gB5) were identified in the patient cohort. Out of 44 CMV positive samples, 40 were available for further genotypization (23 female, 17 male). Twenty-seven samples were successfully identified as gB1–gB5 genotypes. The remaining samples did not show the presence of these genotypes, suggesting the possibility that they might be positive for gB6 and/or gB7 genotypes, undetectable by the employed primers. Alternatively, it could indicate an unsuccessful genotyping process.
In total, in all CMV-positive patient samples combined, there were 46 genotype occurrences. The gB4 and gB1 genotypes predominated, being detected in samples of 11/27 (40.7%) patients each. Mixed genotype infection, when more than one gB variant was observed, was confirmed in 15/27 patients (55.5%).
Concerning the distribution of mixed gB variants, they appeared in the following combinations: five patients (gB3 + gB4), three patients (gB1 + gB2), two patients (gB1 + gB3), two patients (gB1 + gB2 + gB4), one patient (gB4 + gB5), one patient (gB1 + gB3 + gB5), and 1 patient (gB2 + gB4). The two-genotype combination predominated (12/15, 80%), while three genotypes appeared in 3/15 (20%) patients. The most prevalent variant in the mixed genotype complement was gB4 (9 instances out of 34; 26.5%), followed by gB1 and gB3 (8/34; 23.5%), and gB2 (6/34; 17.7%) and gB5 (3/34; 8.8%). Please note that the percentage of gB variants is compared to the complete number of genotypes observed (34 instances), rather than the total number of patients (15 patients with mixed genotypes), in order to visualize the frequency of genotypes vis-à-vis one another.
All genotype frequencies can be observed in Figure 1 and Figure 2.
In patients with confirmed CMV infection, chronic GvHD occurred less often, albeit not significantly (p = 0.106). Conversely, poor graft function (PGF) was noted significantly more frequently in patients with CMV infection (p < 0.025) (Table 1).
Patients with genotype gB1 infection had platelet engraftment earlier than those without this genotype (p < 0.033). Minimal/measurable residual disease (MRD) post HSCT occurred less frequently in these patients (p < 0.011). Patients presenting with gB3 genotype infection achieved 100% chimerism less at D90 (p < 0.015). Patients with gB4 glycoprotein infection had a significantly lower CD4+/CD8+ ratio at D90 (p < 0.026).
Notably, patients with gB5 glycoprotein infection had shorter overall survival from base condition diagnosis (p < 0.042), as well as shorter overall survival after HSCT (p < 0.036). The same correlation was observed as regards mixed genotype infection, wherein patients with more than one gB genotype also had shorter overall survival from diagnosis (p < 0.036) and shorter overall survival after HSCT (p < 0.042); moreover, acute graft versus host disease was noted more frequently in this population (p < 0.047).
As presented in Table 2, an analysis of ULR was conducted, showing mixed genotype as a significant, independent variable for both OS from diagnosis, as well as OS from HSCT. After adjusting for age, type of transplant, relapses after alloHSCT, and previous acute GvDH in MLR, mixed genotype remained as a significant predictor for shorter OS from diagnosis and HSCT.
Statistically significant correlations as regards CMV infection, respective genotypes, and clinical parameters are presented in Table 1, Table 3, Table 4, Table 5, Table 6, Table 7, Table 8 and Table 9.

3. Discussion

To the best of our knowledge, this is the first study in Serbia that investigated the clinical significance of cytomegalovirus gB genotypes in adult patients treated with HSCT.
Human cytomegalovirus glycoprotein B is the best-characterized CMV glycoprotein to date. It is a prerequisite for HCMV entry into target cells and infection via cell-to-cell spread; moreover, it is a highly genetically variable protein [16] and a prime target for neutralizing antibodies.
To date, seven variants (four major: gB1, gB2, gB3, and gB4, and three non-prototypic: gB5, gB6, and gB7) were discovered. The first five genotypes have been detected in Asia, Europe, and North America. However, their geographic distribution differs: gB1 is the most prevalent genotype in Asia and Egypt [6,14,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38]; gB1 and gB2 are frequently detected in North America [39,40,41,42,43,44,45]; in South America, the most frequent genotypes were gB1 and gB2 [9,10,46,47,48,49,50,51,52,53,54] whereas gB1, gB2, and gB3 are commonly observed across Europe (with the exception of Serbia where gB4 is the most prevalent genotype) [55,56,57,58,59,60,61,62,63,64,65,66]. In the present study, the most prevalent genotypes were gB1 and gB4, followed by gB3, gB2, and gB5 (Figure 1). This is in accordance with our previous results obtained from pediatric patients that underwent HSCT, wherein the gB1 and gB4 variants were the most predominant as well [67].
Cytomegalovirus (CMV) is a highly pervasive and ubiquitous herpesvirus. The pathogen’s prevalence rises to up about 100% in both Africa and Asia, and 80% in Europe and North America [68]. In the Republic of Serbia, the occurrence of CMV infection in patients with hematological B cell malignancies was found to be 90.4% [55]. Interestingly, in the same study, the age/gender matched non-tumor controls were significantly more pervaded by CMV (98.7%). The work by Zuhair et al. shows a significant swathe of CMV prevalences across Europe, ranging anywhere from 39% (Ireland) to 84% (Hungary) [69]. In the current study from a cohort of allo-HSCT-ed patients, the incidence of CMV infection was 74.6% (44/59). In Portugal, the overall prevalence of CMV infection in allogeneic hematopoietic stem cell transplantation (aHSCT) patients was 60.3% [70]. In a study by Kumar and colleagues, it was shown that the CMV reactivation rate was 43.8% amongst patients with aHSCT [71]. In Europe, the overall CMV seroprevalence in the adult population-based sample of Germany was 56.7% with a higher rate of seroprevalence in women (62.3%) than in men (51.0%) [72]. In solid-organ transplants, the incidence of CMV infection is 50% to 75% in patients undergoing heart–lung or lung transplantation and 50% in patients undergoing pancreas or kidney–pancreas transplantation. The incidence of CMV infection is 9% to 23% after heart transplantation and 22% to 29% after liver transplantation [73]. Yeh et al. demonstrated a high CMV seroprevalence rate in their study (92.2%) [74].
It is worthwhile noting that in our cohort, patients with CMV infection had a longer overall survival compared to those without (p = 0.037). Moreover, these patients developed chronic GvHD significantly less often (p = 0.049). Similar observations have been reported elsewhere; namely, in individuals who have undergone allogeneic HSCT, the reactivation of CMV has been linked to a marked decrease in the risk of leukemia relapse [75]. This finding is supported by the observation that rapid CMV replication may reduce the risk of relapse in non-Hodgkin lymphomas [76], acute myeloid leukemia [77,78,79], and pediatric acute leukemia following HSCT [80]. In a cohort of patients with myeloproliferative disorders, the reactivation of CMV after HSCT was associated with a slight reduction in the risk of early relapse [81]. These associations speak in favor of a potential CMV-vs.-malignancy effect, which was described in a number of studies.
When a gB genotype has been identified as a disease severity marker, it was often simply the most prevalent genotype in the study population [16]. A great number of studies have attempted to find a correlation between gB genotype and the occurrence of CMV-associated disease in immunocompromised patients [46,82,83]. Cytomegalovirus gB genotype may be an important determinant of viral virulence because gB has been implicated in several essential steps in CMV pathogenesis, such as virus entry, cell fusion, and cell-to-cell spread. The virulence of different CMV strains may be an important factor in the occurrence of CMV disease because of the genetic variation in genes that are involved in host cell penetration, tissue tropism, or replication, and polymorphism in the viral genome may play an important role [57,60,82]. Herein, we have observed several correlations between gB variants and clinical parameters of patients undergoing HSCT.
Compared to a single gB genotype infection, mixed gB genotype infections are frequently reported in organ/bone marrow transplant recipients and AIDS patients. Patients with mixed gB genotype infections have been reported to have faster disease progression or higher viral loads [11]. This study showed that acute GvHD more often presents in patients with mixed gB genotype infections, and these patients also show a shorter survival time from moment of diagnosis and/or transplantation.
CMV reactivation is the major infectious complication between 30 and 100 days after transplantation [84]. Reactivation of CMV appears in 60% of seropositive allo-HSCT recipients [84], which is somewhat less often than in our study where CMV incidence was found to be 74.6%. In this study, patients with CMV reactivation had acute GvHD more often, but not significantly so. Cytomegalovirus is associated with an increased incidence of opportunistic infections and GvHD in allo-HSCT recipients [76,85,86].
CMV infection is closely related to poor graft function (PGF) [87], which was also the conclusion in our study (p = 0.025). We also noted that CMV infection was not associated with chronic GvHD. The association between different CMV genotypes and different clinical characteristics of the transplant recipients has also been identified in other studies [6]. Madi et al. demonstrated that the gB1 genotype is significantly associated with development of fever, leukopenia, and severe CMV disease compared with other gB genotypes [82]. In a study by Rosen and colleagues on 53 CMV-infected liver transplant recipients, it was shown that gB1 genotype is significantly associated with a higher number of acute rejection episodes but not with the rejection severity [83]. In contrast, in a study on 58 liver transplant recipients with CMV infection, Sarcinella and colleagues showed that gB genotype does not correlate with peak CMV viral load, development of CMV disease, and acute rejection [39]. Within the scope of this investigation, we demonstrate that patients with the gB1 genotype manifest earlier platelet engraftment (p = 0.033) and less frequent minimal/measurable residual disease post HSCT (p = 0.011). This indicates that the gB1 variant may bestow some beneficial effects to the patient.
Viral gB3 and gB4 were reported to be associated with a lethal outcome because of myelosuppression in HSCT patients [40], and gB2 was associated with retinitis in AIDS patients [14]. In a report by Torok-Storb B et al., 21.3% of patients with gB types 3 and 4 died of infection associated with neutropenia compared with only 2.2% of patients with types 1 and 2. One could interpret this to mean either that gB types 3 and 4 are more likely to infect the marrow, or that types 3 and 4 are capable of escaping immune recognition in the marrow. Also, gB3 and gB4 were negatively associated with acute GvHD [40]. On the other hand, Dieamant et al. in their study found all gB3 genotypes were involved with acute GvHD, highlighting a possible association of that genotype with acute GvHD. The results of their study also showed that overall survival was 0% for gB3 and 57% for gB4 [46]. In our study, patients with the gB3 variant achieved 100% chimerism at day 90 post HSCT less often than those without (p = 0.015).
Finally, shorter OS from diagnosis and after HSCT was confirmed in patients with gB5 genotype infection. Notably, this association was not observed with other specific genotypes, hinting at a specific impinging effect of the gB5 genotype (or converse effect of multiple genotypes in concert) on patient survival. Although this genotype was not investigated in the study of Dieamant and coworkers [46], they reported on gB3 as the CMV variant with the least stratified overall survival (0%). To our knowledge, this study is the first to link the reduced lifespan post HSCT to the gB5 viral genotype.

4. Material and Methods

The study included 59 patients hospitalized in the Clinic for Hematology of the University Clinical Center of Serbia. The cohort comprised 29 (49.1%) female and 30 (50.9%) male patients treated with allogeneic HSCT for various hematological malignancies (Table 10). Informed consent was secured from all study participants. Ethical approval was obtained from the Ethical Committee of the Faculty of Medicine, University of Belgrade, Belgrade, Republic of Serbia.
The patients’ peripheral venous blood was sampled approximately once per week for the purposes of routine viral screening, with samples gathered from 2019 to 2021. Serially collected clinical samples were hence transported and analyzed at the virology laboratory of the Institute of Microbiology and Immunology, Faculty of Medicine, University of Belgrade, where they were tested via nucleic acid amplification techniques for the presence of CMV, Epstein–Barr virus (EBV), herpes simplex virus (HSV), human herpesvirus 6 (HHV-6), and BKV. Detection and quantitation of CMV was performed by quantitative real-time PCR on an ABI 7500 Real-Time PCR System (Applied Biosystems™, Thermo Fisher Scientific, Waltham, MA, USA).
After centrifugation, the buffy coat fraction underwent screening for CMV DNA, with subsequent genotyping of CMV-positive samples. Viral DNA was extracted from 200 μL of plasma utilizing the QIAamp® Blood Mini Kit (Qiagen, Hilden, Germany) as per the manufacturer’s instructions. The preliminary detection and measurement of CMV DNA were executed through a TaqMan Real-Time PCR method. Specifically, primers were devised for amplifying a segment from the CMV immediate-early (IE) region gene, with the sequences 5′-CGC TCA CAT GCA AGA GTT AAT CTT C-3′ and 5′-AAC TCG GTA AGT CTG TTG ACA TGT ATG-3′. Additionally, the TaqMan probe was labelled with fluorescence at the 5′ and 3′ ends using 6-carboxyfluorescein (FAM; a reporter dye) and 6-carboxytetramethyl-rhodamine (TAMRA) dye, respectively, and had the sequence 5′-FAM CTC TAT CTG ACA TAC ACA AGT AAA TCC ACG TCC CA TAMRA-3′ [88]. The quantification standards employed in the real-time PCR procedure comprised plasmids containing viral amplicons for the CMV immediate-early antigen (IEA) region (Clonit, Italy). The range of the standards varied from 103 to 106 copies per µL. Determination of quantities was accomplished through the utilization of a standard curve calculation based on the Ct (threshold cycle) value standards. Values extrapolated from this curve were represented in copies/µL. To convert these values to copies/mL in the sample material and to adjust for sample dilution, multiplication by 150 was necessary.
For the detection of specific gB genotypes, we employed a multiplex nested PCR technique following a previously described methodology [11]. In essence, primers were designed to amplify specific sections of the UL55 gene. Following the initial PCR round, the resulting amplicons underwent a subsequent multiplex step to determine the genotype. As a control, a PCR mixture containing RNAase-free water was used in place of the sample. Details of the primer sequences and conditions for the multiplex nested PCR reactions can be found in Table 11.
Each of the gB genotypes were readily identifiable on gel electrophoresis, as the exact genotype depended on fragment length. The DNA fragments were separated via electrophoresis in a 3% agarose gel, which was stained with SYBR™ Safe (Invitrogen™, Thermo Fisher Scientific, Waltham, MA, USA) and observed using an ultraviolet transilluminator. To facilitate the identification of amplicons, a size marker of 100 base pairs was included.
The clinical data were obtained from patient records gathered during hospitalization and outpatient visits to the Clinic for Hematology of the University Clinical Center of Serbia.
For data analysis, IBM® SPSS® Statistics v20 software was utilized. Univariate (ULR) and multivariate linear regression (MLR) analysis were performed in order to determine if mixed genotype was a significant predictor for shorter overall survival (OS) from time of diagnosis and HSCT. Variables deemed significant by previous tests were considered for inclusion in the model, along with expert opinion that helped define the number and order in which the explanatory variables were entered into the model. Wilcoxon–Mann–Whitney, Fisher’s exact test, and the Phi method were employed. A significance threshold of p-value <0.05 was established.

5. Limitations

We must concede to several limitations of our study. Firstly, our patient cohort consisted of a relatively limited number of individuals, and undoubtedly, a larger group would produce more accurate findings. The CMV reactivation incidence further reduced the number of CMV positives even more, which could have influenced the conclusions of the study. It is important to acknowledge that the genotype frequencies are also somewhat low, which has the potential to obfuscate genuine findings. Lastly, although the study length in itself is not a limiting factor, a longer follow up for each of the patients might have generated more precise results.

6. Conclusions

The association between CMV genotypes and specific clinical manifestations in patients treated with HSCT is still not fully elucidated, and a definitive link between a specific viral variant and clinical parameter remains to be established. Our study points to CMV genotypes imparting both beneficial (earlier platelet engraftment, less frequent MRD post HSCT) and adverse effects (shorter overall survival, more frequent acute GvHD, less frequent 100% chimerism at day 90) to the transplanted host. Variations in the viral UL55 locus significantly associate with MRD post HSCT, earlier platelet engraftment, incomplete chimerism at day 90, and shorter survival from time of transplantation and time of diagnosis. Mixed gB infections emerge again as detrimental to the patient, being associated with shorter survival and acute GvHD. Furthermore, identification of gB genotypes that may be detrimental to the patient could perhaps signal an early therapy modification and close follow-up of said patients. Ultimately, the genotype(s) posing the highest risk to the patient may be evaluated for genotype-specific antibody therapy or the development of vaccines. Conversely, variants that appear to confer advantageous effects on the patient, particularly in terms of virus-vs.-cancer outcomes, may be investigated for potential targeted anti-tumor therapies. The association between gB genotypes and clinical outcomes implies potential usefulness of the gB protein as a prognostic marker—however, more detailed studies on larger cohorts are warranted and might yield more precise results.

Author Contributions

Conceptualization: T.V., M.J. and M.T.-B.; funding acquisition: T.J., A.K. and M.T.-B.; writing—original draft preparation: T.V., M.J., I.B., S.R., D.M. and I.D.; writing—review and editing: M.J., A.K., A.T., T.J. and M.T.-B.; investigation and methodology: T.V., M.J., A.T. and I.D.; project administration, supervision, resources: T.J., A.K. and M.T.-B. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Ministry of Science, Technological Development, and Innovation (MSTDI) of the Republic of Serbia, grant number 200110. Any opinions, findings, conclusions, or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of MSTDI.

Institutional Review Board Statement

This work was performed in accordance with principles of 1964 Helsinki Declaration and its later amendments. Approval was granted by the University Clinical Center of Serbia, University of Belgrade Ethical Review Board and Faculty of Medicine. Guidelines of Good Clinical Practice were observed. The security and privacy of patients’ health was not violated in this study.

Informed Consent Statement

A document of informed consent was obtained from all consenting participants included in the study. All patients signed an informed consent statement upon hospitalization to the Clinic for Hematology of the University Clinical Center of Serbia.

Data Availability Statement

All data are either publicly accessible or available from the corresponding author upon reasonable request.

Acknowledgments

Conducting this study would have been unfeasible without the indispensable and dedicated work of the attending clinical, laboratory, and other hospital staff. Furthermore, we would like to express our gratitude to the patients taking part in this study. Finally, we are also deeply thankful to the anonymous Reviewers for their constructive comments and critique, which we have diligently endeavored to incorporate and address in our work—their time and effort are truly valued.

Conflicts of Interest

The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Genus: Cytomegalovirus [Internet]. Ictv.global. Available online: https://ictv.global/report/chapter/orthoherpesviridae/orthoherpesviridae/cytomegalovirus (accessed on 27 January 2024).
  2. Ross, S.A.; Pati, P.; Jensen, T.L.; Goll, J.B.; Gelber, C.E.; Singh, A.; McNeal, M.; Boppana, S.B.; Bernstein, D.I. Cytomegalovirus Genetic Diversity Following Primary Infection. J. Infect. Dis. 2020, 221, 715–720. [Google Scholar] [CrossRef] [PubMed]
  3. Dong, N.; Cao, L.; Zheng, D.; Su, L.; Lu, L.; Dong, Z.; Xu, M.; Xu, J. Distribution of CMV envelope glycoprotein B, H and N genotypes in infants with congenital cytomegalovirus symptomatic infection. Front. Pediatr. 2023, 11, 1112645. [Google Scholar] [CrossRef] [PubMed]
  4. Griffiths, P.; Reeves, M. Pathogenesis of human cytomegalovirus in the immunocompromised host. Nat. Rev. Microbiol. 2021, 19, 759–773. [Google Scholar] [CrossRef] [PubMed]
  5. Kawase, T.; Tanaka, H.; Kojima, H.; Uchida, N.; Ohashi, K.; Fukuda, T.; Ozawa, Y.; Ikegame, K.; Eto, T.; Mori, T.; et al. Impact of High-Frequency HLA Haplotypes on Clinical Cytomegalovirus Reactivation in Allogeneic Hematopoietic Stem Cell Transplantation. Biol. Blood Marrow Transplant. 2019, 25, 2482–2489. [Google Scholar] [CrossRef] [PubMed]
  6. Soleimani, A.R.; Jafari, M.; Piroozmand, A.; Nikoueinejad, H.; Akbari, H.; Einollahi, B. The Incidence of Cytomegalovirus Glycoprotein B Genotypes in Kidney Transplant Recipients in Iran. Int. J. Organ Transplant. Med. 2018, 9, 173–177. [Google Scholar] [PubMed]
  7. Arcangeletti, M.C.; Vasile Simone, R.; Rodighiero, I.; De Conto, F.; Medici, M.C.; Martorana, D.; Chezzi, C.; Calderaro, A. Combined genetic variants of human cytomegalovirus envelope glycoproteins as congenital infection markers. Virol. J. 2015, 12, 202. [Google Scholar] [CrossRef] [PubMed]
  8. Chern, K.C.; Chandler, D.B.; Martin, D.F.; Kuppermann, B.D.; Wolitz, R.A.; Margolis, T.P. Glycoprotein B subtyping of cytomegalovirus (CMV) in the vitreous of patients with AIDS and CMV retinitis. J. Infect. Dis. 1998, 178, 1149–1153. [Google Scholar] [CrossRef] [PubMed]
  9. Correa, C.; Kouri, V.; Perez, L.; Soto, Y.; Limia, C. Diagnosis, gB genotype distribution and viral load of symptomatic congenitally infected CMV patients in Cuba. J. Perinatol. 2016, 36, 837–842. [Google Scholar] [CrossRef]
  10. Cunha, A.A.; Aquino, V.H.; Mariguela, V.; Nogueira, M.L.; Figueiredo, L.T. Evaluation of glycoprotein B genotypes and load of CMV infecting blood leukocytes on prognosis of AIDS patients. Rev. Inst. Med. Trop. Sao Paulo 2011, 53, 82–88. [Google Scholar] [CrossRef]
  11. Jiang, X.J.; Zhang, J.; Xiong, Y.; Jahn, G.; Xiong, H.R.; Yang, Z.Q.; Liu, Y.Y. Human cytomegalovirus glycoprotein polymorphisms and increasing viral load in AIDS patients. PLoS ONE 2017, 12, e0176160. [Google Scholar] [CrossRef]
  12. Trincado, D.E.; Scott, G.M.; White, P.A.; Hunt, C.; Rasmussen, L.; Rawlinson, W.D. Human cytomegalovirus strains associated with congenital and perinatal infections. J. Med. Virol. 2000, 61, 481–487. [Google Scholar] [CrossRef]
  13. Shepp, D.H.; Match, M.E.; Lipson, S.M.; Pergolizzi, R.G. A fifth human cytomegalovirus glycoprotein B genotype. Res. Virol. 1998, 149, 109–114. [Google Scholar] [CrossRef]
  14. Wu, X.; Wang, Y.; Xu, Y.; Wu, D.; Sun, A.; Zhu, Z.; Han, Y.; Qiu, H.; Tang, X.; Fu, Z.; et al. Cytomegalovirus glycoprotein B genotype in hematopoietic stem cell transplant patients from China. Biol. Blood Marrow Transplant. 2010, 16, 647–652. [Google Scholar] [CrossRef] [PubMed]
  15. Pereira, M.R.; Pouch, S.M.; Scully, B. Infections in Allogeneic Stem Cell Transplantation. In Principles and Practice of Transplant Infectious Diseases; Springer: Berlin/Heidelberg, Germany, 2018; pp. 209–226. [Google Scholar]
  16. Wang, H.Y.; Valencia, S.M.; Pfeifer, S.P.; Jensen, J.D.; Kowalik, T.F.; Permar, S.R. Common Polymorphisms in the Glycoproteins of Human Cytomegalovirus and Associated Strain-Specific Immunity. Viruses 2021, 13, 1106. [Google Scholar] [CrossRef] [PubMed]
  17. Al Mana, H.; Yassine, H.M.; Younes, N.N.; Al-Mohannadi, A.; Al-Sadeq, D.W.; Alhababi, D.; Nasser, E.A.; Nasrallah, G.K. The Current Status of Cytomegalovirus (CMV) Prevalence in the MENA Region: A Systematic Review. Pathogens 2019, 8, 213. [Google Scholar] [CrossRef] [PubMed]
  18. Pacsa, A.S.; Essa, S.; Voevodin, A.; El-Shazly, A.; Kazak, H.; Nampoory, M.R.N.; Johny, K.; Said, T.; Al-Nakib, W. Correlation between CMV genotypes, multiple infections with herpesviruses (HHV-6, 7) and development of CMV disease in kidney recipients in Kuwait. FEMS Immunol. Med. Microbiol. 2003, 35, 125–130. [Google Scholar] [CrossRef] [PubMed]
  19. Jin, H.; Wang, X.; Li, S. Human cytomegalovirus glycoprotein B genotype correlates with different symptoms of infected infants. Intervirology 2007, 50, 219–223. [Google Scholar] [CrossRef] [PubMed]
  20. Qian, H.L.; Cai, T.; Jin, H.M. Human cytomegalovirus glycoprotein genotypes in the genital tract tissue of tubal pregnancy patients. J. Int. Med. Res. 2009, 37, 385–391. [Google Scholar] [CrossRef] [PubMed]
  21. Mewara, A.; Mishra, B.; Ratho, R.K.; Kumar, P. Cytomegalovirus glycoprotein b gene polymorphism and its association with clinical presentations in infants. Southeast Asian J. Trop. Med. Public Health 2009, 40, 759–764. [Google Scholar] [PubMed]
  22. Shen, Z.; Shang, S.Q.; Zou, C.C.; Zheng, J.Y.; Yu, Z.S. The detection and clinical features of human cytomegalovirus infection in infants. Fetal Pediatr. Pathol. 2010, 29, 393–400. [Google Scholar] [CrossRef]
  23. Paca-Uccaralertkun, S.; Hiatt, R.; Leecharoen, R.; Tan-Ariya, P.; Mungthin, M.; Pongphong, S. Human cytomegalovirus gB1 genotypes among children who live at the Phayathai Babies’ home in Nonthaburi, Thailand. Southeast Asian J. Trop. Med. Public Health 2013, 44, 636–640. [Google Scholar]
  24. Mujtaba, G.; Khurshid, A.; Sharif, S.; Alam, M.M.; Aamir, U.B.; Shaukat, S.; Angez, M.; Rana, M.S.; Umair, M.; Shah, A.A.; et al. Distribution of cytomegalovirus genotypes among neonates born to infected mothers in Islamabad, Pakistan. PLoS ONE 2016, 11, e156049. [Google Scholar] [CrossRef]
  25. Chen, J.Y.; Zheng, T.L.; Zhou, T.; Hu, P.W.; Huang, M.J.; Xu, X.; Pei, X.F. Human cytomegalovirus prevalence and distribution of glycoprotein B, O genotypes among hospitalized children with respiratory infections in West China, 2009–2014. Trop. Med. Int. Health 2016, 21, 1428–1434. [Google Scholar] [CrossRef] [PubMed]
  26. Sarkar, A.; Das, D.; Ansari, S.; Chatterjee, R.P.; Mishra, L.; Basu, B.; Ghosh, S.K.; Bhattacharyay, M.; Chakraborty, N. Genotypes of glycoprotein B gene among the Indian symptomatic neonates with congenital CMV infection. BMC Pediatr. 2019, 19, 291. [Google Scholar] [CrossRef] [PubMed]
  27. Min, X.; Wang, L.; Cui, A.; Zhang, C.; Wang, D.; Liu, Y.; Li, Z.; Xu, W. The nucleic acid positive rate and genotype distribution of human cytomegalovirus in human milk banks in China. Arch. Virol. 2020, 165, 1099–1107. [Google Scholar] [CrossRef]
  28. Dong, N.; Cao, L.; Su, L.; Lu, L.; Dong, Z.; Xu, M.; Xu, J. Human cytomegalovirus envelope glycoprotein B, H, and N polymorphisms among infants of Shanghai area in China. J. Med. Virol. 2020, 92, 3674–3681. [Google Scholar] [CrossRef]
  29. Bhattarakosol, P.; Chantaraarphonkun, S. Prevalence of human cytomegalovirus (HCMV) gB genotypes in Thai patients. Southeast Asian J. Trop. Med. Public Health 2007, 38, 835–840. [Google Scholar]
  30. Pang, X.; Humar, A.; Preiksaitis, J.K. Concurrent genotyping and quantitation of cytomegalovirus gB genotypes in solid-organtransplant recipients by use of a real-time PCR Assay. J. Clin. Microbiol. 2008, 46, 4004–4010. [Google Scholar] [CrossRef]
  31. Yu, Z.S.; Tang, L.F.; Zou, C.C.; Zheng, J.Y.; Zhao, Z.Y. Cytomegalovirus-associated idiopathic thrombocytopenic purpura in Chinese children. Scand. J. Infect. Dis. 2008, 40, 922–927. [Google Scholar]
  32. Wu, K.G.; Hung, M.C.; Chang, Y.T.; Chen, C.J.; Yang, S.P.; Liu, C.Y.; Ho, D.M.-T.; Chan, Y.-J. Occurrence of human cytomegalovirus glycoprotein B genotypes in immunocompetent and immunosuppressed Taiwanese patients. Intervirology 2011, 54, 196–201. [Google Scholar] [CrossRef]
  33. Taherkhani, R.; Farshadpour, F.; Makvandi, M.; Hamidifard, M.; Esmailizadeh, M.; Ahmadi, B.; Heidari, H. Determination of cytomegalovirus prevalence and glycoprotein B genotypes among ulcerative colitis patients in Ahvaz, Iran. Jundishapur J. Microbiol. 2015, 8, e17458. [Google Scholar] [CrossRef]
  34. Oka, N.; Suzuki, T.; Inoue, T.; Kobayashi, T.; Ohashi, Y. Polymorphisms in cytomegalovirus genotype in immunocompetent patients with corneal endotheliitis or iridocyclitis. J. Med. Virol. 2015, 87, 1441–1445. [Google Scholar] [CrossRef]
  35. Eran Daglar, D.; Öngüt, G.; Çolak, D.; Özkul, A.; Mutlu, D.; Zeytenoglu, A.; Mïdïllï, K.; Gökahmetoğlu, S.; Günseren, F.; Öğünç, D.; et al. Determination of cytomegalovirus glycoprotein B genotypes in different geographical regions and different patient groups in Turkey. Mikrobiyol. Bul. 2016, 50, 53–62. [Google Scholar] [CrossRef]
  36. Hu, H.; Cheng, Y.; Peng, Q.; Chen, K. Clinical features, treatment courses, and distribution of cytomegalovirus genotypes among thrombocytopenia patients aged younger than 12 months. Am. J. Perinatol. 2021, 38, 1403–1411. [Google Scholar] [CrossRef] [PubMed]
  37. Nahar, S.; Hokama, A.; Iraha, A.; Ohira, T.; Kinjo, T.; Hirata, T.; Kinjo, T.; Parrott, G.L.; Fujita, J. Distribution of cytomegalovirus genotypes among ulcerative colitis patients in Okinawa, Japan. Intest. Res. 2018, 16, 90–98. [Google Scholar] [CrossRef]
  38. Xia, C.S.; Zhao, X.T.; Sun, Y.Y.; Zhang, Z. Human cytomegalovirus glycoprotein B genotypes in Chinese hematopoietic stem cell transplant recipients. Intervirology 2012, 55, 342–348. [Google Scholar] [CrossRef]
  39. Sarcinella, L.; Mazzulli, T.; Willey, B.; Humar, A. Cytomegalovirus glycoprotein B genotype does not correlate with outcomes in liver transplant patients. J. Clin. Virol. 2002, 24, 99–105. [Google Scholar] [CrossRef]
  40. Torok-Storb, B.; Boeckh, M.; Hoy, C.; Leisenring, W.; Myerson, D.; Gooley, T. Association of specific cytomegalovirus genotypes with death from myelosuppression after marrow transplantation. Blood 1997, 90, 2097–2102. [Google Scholar] [CrossRef] [PubMed]
  41. White, J.L.; Patel, E.U.; Abraham, A.G.; Grabowski, M.K.; Arav-Boger, R.; Avery, R.K.; Quinn, T.C.; Tobian, A.A.R. Prevalence, magnitude, and genotype distribution of urinary cytomegalovirus (CMV) shedding among CMV-seropositive children and adolescents in the United States. Open Forum Infect. Dis. 2019, 6, ofz272. [Google Scholar] [CrossRef] [PubMed]
  42. Humar, A.; Kumar, D.; Gilbert, C.; Boivin, G. Cytomegalovirus (CMV) glycoprotein B genotypes and response to antiviral therapy, in solid-organ-transplant recipients with CMV disease. J. Infect. Dis. 2003, 188, 581–584. [Google Scholar] [CrossRef] [PubMed]
  43. Manuel, O.; Pang, X.L.; Humar, A.; Kumar, D.; Doucette, K.; Preiksaitis, J.K. An assessment of donor-to-recipient transmission patterns of human cytomegalovirus by analysis of viral genomic variants. J. Infect. Dis. 2009, 199, 1621–1628. [Google Scholar] [CrossRef]
  44. Manuel, O.; Åsberg, A.; Pang, X.; Rollag, H.; Emery, V.C.; Preiksaitis, J.K.; Kumar, D.; Pescovitz, M.D.; Bignamini, A.A.; Hartmann, A.; et al. Impact of genetic polymorphisms in cytomegalovirus glycoprotein b on outcomes in solid-organ transplant recipients with cytomegalovirus disease. Clin. Infect. Dis. 2009, 49, 1160–1166. [Google Scholar] [CrossRef]
  45. Drew, W.L.; Chou, S.; Miner, R.C.; Mohr, B.A.; Busch, M.P.; van der Horst, C.M.; Asmuth, D.M.; Kalish, L.A. Cytomegalovirus glycoprotein B groups in human immunodeficiency virus-infected patients with incident retinitis. J. Infect. Dis. 2002, 186, 114–117. [Google Scholar] [CrossRef] [PubMed]
  46. Dieamant, D.C.; Bonon, S.H.A.; Peres, R.M.B.; Costa, C.R.C.; Albuquerque, D.M.; Miranda, E.C.M.; Aranha, F.J.P.; Oliveira-Duarte, G.; Fernandes, V.C.A.; De Souza, C.A.; et al. Cytomegalovirus (CMV) genotype in allogeneic hematopoietic stem cell transplantation. BMC Infect. Dis. 2013, 13, 310. [Google Scholar] [CrossRef]
  47. Bale, J.F.; Murph, J.R.; Demmler, G.J.; Dawson, J.; Miller, J.E.; Petheram, S.J. Intrauterine cytomegalovirus infection and glycoprotein B genotypes. J. Infect. Dis. 2000, 182, 933–936. [Google Scholar] [CrossRef] [PubMed]
  48. Carraro, E.; Granato, C.F.H. Single human cytomegalovirus gB genotype shed in multiple sites at the time of diagnosis in renal transplant recipients. J. Med. Virol. 2003, 70, 240–243. [Google Scholar] [CrossRef]
  49. Ahumada-Ruiz, S.; Taylor-Castillo, L.; Visoná, K.; Luftig, R.B.; Herrero-Uribe, L. Determination of human cytomegalovirus genetic diversity in different patient populations in Costa Rica. Rev. Inst. Med. Trop. Sao Paulo 2004, 46, 87–92. [Google Scholar] [CrossRef]
  50. Kourí, V.; González, E.; Martínez, P.; Capó, V.; González, R.; Pérez, L.; Viera, J.; Cardellá, L.; Hengge, U.R. Distinct genotypic distribution of cytomegalovirus (CMV) envelope glycoprotein B (gB) in a Cuban cohort of patients with different CMV diseases. Scand. J. Infect. Dis. 2007, 39, 1038–1044. [Google Scholar] [CrossRef] [PubMed]
  51. Slavov, S.N.; Kashima, S.; Wagatsuma, V.M.D.; Silva-Pinto, A.C.; Martinez, E.Z.; Favarin, M.D.C.; Covas, D.T. Glycoprotein B genotyping of human cytomegalovirus strains isolated from Brazilian patients with sickle cell disease and beta-thalassemia major. Viral Immunol. 2015, 28, 123–129. [Google Scholar] [CrossRef]
  52. Arellano-Galindo, J.; Villanueva-García, D.; Cruz-Ramírez, J.L.; Yalaupari-Mejía, J.P.; Uribe-Gutiérrez, G.; Velazquez-Guadarrama, N.; Nava-Frias, M.; Munoz-Hernández, O.; Mejía-Arangure, J.M. Detection and gB genotyping of CMV in Mexican preterm infants in the context of maternal seropositivity. J. Infect. Dev. Ctries 2014, 8, 758–767. [Google Scholar] [CrossRef]
  53. Barbi, M.; Binda, S.; Caroppo, S.; Primache, V.; Didò, P.; Guidotti, P.; Corbetta, C.; Melotti, D. CMV gB genotypes and outcome of vertical transmission: Study on dried blood spots of congenitally infected babies. J. Clin. Virol. 2001, 21, 75–79. [Google Scholar] [CrossRef]
  54. Barrado, L.; Prieto, C.; Hernando, S.; Folgueira, L. Detection of glycoproteins B and H genotypes to predict the development of Cytomegalovirus disease in solid organ transplant recipients. J. Clin. Virol. 2018, 109, 50–56. [Google Scholar] [CrossRef] [PubMed]
  55. Janković, M.; Knežević, A.; Todorović, M.; Đunić, I.; Mihaljević, B.; Soldatović, I.; Protić, J.; Miković, N.; Stoiljković, V.; Jovanović, T. Cytomegalovirus infection may be oncoprotective against neoplasms of B-lymphocyte lineage: Single-institution experience and survey of global evidence. Virol. J. 2022, 19, 155. [Google Scholar] [CrossRef] [PubMed]
  56. Ciotti, M.; Cella, E.; Rittà, M.; Ciccozzi, M.; Cavallo, R.; Perno, C.F.; Costa, C. Cytomegalovirus glycoprotein B genotype distribution in Italian transplant patients. Intervirology 2017, 60, 165–170. [Google Scholar] [CrossRef]
  57. Tarragó, D.; Quereda, C.; Tenorio, A. Different cytomegalovirus glycoprotein B genotype distribution in serum and cerebrospinal fluid specimens determined by a novel multiplex nested PCR. J. Clin. Microbiol. 2003, 41, 2872–2877. [Google Scholar] [CrossRef] [PubMed]
  58. Goossens, V.J.; Wolffs, P.F.; Van Loo, I.H.; Bruggeman, C.A.; Verbon, A. CMV DNA levels and CMV gB subtypes in ART-naïve HAART-treated patients: A 2-year follow-up study in the Netherlands. AIDS 2009, 23, 1425–1429. [Google Scholar] [CrossRef] [PubMed]
  59. Lukacsi, A.; Tarodi, B.; Endreffy, E.; Babinszki, A.; Pal, A.; Pusztai, R. Human cytomegalovirus gB genotype 1 is dominant in congenital infections in South Hungary. J. Med. Virol. 2001, 65, 537–542. [Google Scholar] [CrossRef] [PubMed]
  60. Zawilińska, B.; Szostek, S.; Kopeć, J.; Koprynia, M.; Kosz-Vnenchak, M. UL55 genotype diversity of cytomegalovirus strains isolated from newborns and infants hospitalized in southern Poland. Przegl. Epidemiol. 2011, 65, 409–413. [Google Scholar] [PubMed]
  61. Paradowska, E.; Studzińska, M.; Nowakowska, D.; Wilczyński, J.; Rycel, M.; Suski, P.; Gaj, Z.; Kaczmarek, B.; Zbróg, Z.; Leśnikowski, Z.J. Distribution of UL144, US28 and UL55 genotypes in Polish newborns with congenital cytomegalovirus infections. Eur. J. Clin. Microbiol. Infect. Dis. 2012, 31, 1335–1345. [Google Scholar] [CrossRef]
  62. Arista, S.; De Grazia, S.; Giammanco, G.M.; Di Carlo, P.; Iannitto, E. Human cytomegalovirus glycoprotein B genotypes in immunocompetent, immunocompromised, and congenitally infected Italian populations. Arch. Virol. 2003, 148, 547–554. [Google Scholar] [CrossRef]
  63. Coaquette, A.; Bourgeois, A.; Dirand, C.; Varin, A.; Chen, W.; Herbein, G. Mixed cytomegalovirus glycoprotein B genotypes in immunocompromised patients. Clin. Infect. Dis. 2004, 39, 155–161. [Google Scholar] [CrossRef]
  64. Jakovljevic, A.; Andric, M.; Knezevic, A.; Soldatovic, I.; Nikolic, N.; Karalic, D.; Milasin, J. Human cytomegalovirus and Epstein-Barr virus genotypes in apical periodontitis lesions. J. Endod. 2015, 41, 1847–1851. [Google Scholar] [CrossRef] [PubMed]
  65. Vogelberg, C.; Meyer-König, U.; Hufert, F.T.; Kirste, G.; Von Laer, D. Human cytomegalovirus glycoprotein B genotypes in renal transplant recipients. J. Med. Virol. 1996, 50, 31–34. [Google Scholar] [CrossRef]
  66. Zawilinska, B.; Szoste, S.; Kopec, J.; Piatkowska-Jakubas, B.; Kosz-Vnenchak, M. Multiplex real-time PCR to identify a possible reinfection with different strains of human cytomegalovirus in allogeneic hematopoietic stem cell transplant recipients. Acta Biochim. Pol. 2016, 63, 161–166. [Google Scholar] [CrossRef] [PubMed]
  67. Janković, M.; Ćupić, M.; Knežević, A.; Vujić, D.; Soldatović, I.; Zečević, Ž.; Gobeljić, B.; Jovanović, T. Cytomegalovirus glycoprotein B and N genotypes in pediatric recipients of the hematopoietic stem cell transplant. Virology 2020, 548, 168–173. [Google Scholar] [CrossRef] [PubMed]
  68. Cannon, M.J.; Schmid, D.S.; Hyde, T.B. Review of cytomegalovirus seroprevalence and demographic characteristics associated with infection. Rev. Med. Virol. 2010, 20, 202–213. [Google Scholar] [CrossRef]
  69. Zuhair, M.; Smit, G.S.A.; Wallis, G.; Jabbar, F.; Smith, C.; Devleesschauwer, B.; Griffiths, P. Estimation of the worldwide seroprevalence of cytomegalovirus: A systematic review and meta-analysis. Rev. Med. Virol. 2019, 29, e2034. [Google Scholar] [CrossRef] [PubMed]
  70. Sousa, H.; Boutolleau, D.; Ribeiro, J.; Teixeira, A.L.; Pinho Vaz, C.; Campilho, F.; Branca, R.; Campos, A., Jr.; Baldaque, I.; Medeiros, R. Cytomegalovirus infection in patients who underwent allogeneic hematopoietic stem cell transplantation in Portugal: A five-year retrospective review. Biol. Blood Marrow Transplant. 2014, 20, 1958–1967. [Google Scholar] [CrossRef]
  71. Kumar, M.; Roychowdhury, M.; Kumar, J.; Harishankar, A.; Sinha, S.; Bhave, S.J.; Chakrapani, A.; Radhakrishnan, V.; Nair, R.; Bhattacharya, S.; et al. Cytomegalovirus reactivation and disease amongst patients with allogeneic haematopoietic stem cell transplantation in Eastern India: Epidemiology, outcome and healthcare cost. Indian J. Med. Microbiol. 2018, 36, 49–53. [Google Scholar] [CrossRef]
  72. Lachmann, R.; Loenenbach, A.; Waterboer, T.; Brenner, N.; Pawlita, M.; Michel, A.; Thamm, M.; Poethko-Müller, C.; Wichmann, O.; Wiese-Posselt, M. Cytomegalovirus (CMV) seroprevalence in the adult population of Germany. PLoS ONE 2018, 13, e0200267. [Google Scholar] [CrossRef]
  73. Simon, D.M.; Levin, S. Infectious complications of solid organ transplantations. Infect. Dis. Clin. N. Am. 2001, 15, 521–549. [Google Scholar] [CrossRef] [PubMed]
  74. Yeh, T.J.; Yang, C.I.; Huang, C.T.; Wang, M.H.; Chuang, T.M.; Ke, Y.L.; Gau, Y.C.; Du, J.S.; Wang, H.C.; Cho, S.F.; et al. Revisit of the Association between Cytomegalovirus Infection and Invasive Fungal Infection after Allogeneic Hematopoietic Stem Cell Transplantation: A Real-World Analysis from a High CMV Seroprevalence Area. J. Fungi 2022, 8, 408. [Google Scholar] [CrossRef]
  75. Bigley, A.B.; Baker, F.L.; Simpson, R.J. Cytomegalovirus: An unlikely ally in the fight against blood cancers? Clin. Exp. Immunol. 2018, 193, 265–274. [Google Scholar] [CrossRef] [PubMed]
  76. Koldehoff, M.; Ross, S.R.; Dührsen, U.; Beelen, D.W.; Elmaagacli, A.H. Early CMV-replication after allogeneic stem cell transplantation is associated with a reduced relapse risk in lymphoma. Leuk. Lymphoma 2017, 58, 822–833. [Google Scholar] [CrossRef]
  77. Elmaagacli, A.H.; Steckel, N.K.; Koldehoff, M.; Hegerfeldt, Y.; Trenschel, R.; Ditschkowski, M.; Christoph, S.; Gromke, T.; Kordelas, L.; Ot-tinger, H.D.; et al. Early human cytomegalovirus replication after transplantation is associ-ated with a decreased relapse risk: Evidence for a putative virus-versus-leukemia effect in acute myeloid leukemia patients. Blood 2011, 118, 1402–1412. [Google Scholar] [CrossRef]
  78. Green, M.L.; Leisenring, W.M.; Xie, H.; Walter, R.B.; Mielcarek, M.; Sandmaier, B.M.; Riddell, S.R.; Boeckh, M. CMV reactivation after allogeneic HCT and relapse risk: Evidence for early protection in acute myeloid leukemia. Blood 2013, 122, 1316–1324. [Google Scholar] [CrossRef] [PubMed]
  79. Litjens, N.H.R.; van der Wagen, L.; Kuball, J.; Kwekkeboom, J. Potential Beneficial Effects of Cytomegalovirus Infection after Transplantation. Front. Immunol. 2018, 9, 389. [Google Scholar] [CrossRef]
  80. Inagaki, J.; Noguchi, M.; Kurauchi, K.; Tanioka, S.; Fukano, R.; Okamura, J. Effect of Cytomegalovirus Reactivation on Relapse after Allogeneic Hematopoietic Stem Cell Transplantation in Pediatric Acute Leukemia. Biol. Blood Marrow Transplant. 2016, 22, 300–306. [Google Scholar] [CrossRef]
  81. Peric, Z.; Wilson, J.; Durakovic, N.; Ostojic, A.; Desnica, L.; Vranjes, V.R.; Marekovic, I.; Serventi-Seiwerth, R.; Vrhovac, R. Early human cy-tomegalovirus reactivation is associated with lower incidence of relapse of myeloproliferative disorders after allogeneic hema-topoietic stem cell transplantation. Bone Marrow Transplant. 2018, 53, 1450–1456. [Google Scholar] [CrossRef]
  82. Madi, N.; Al-Nakib, W.; Pacsa, A.; Saeed, T. Cytomegalovirus genotypes gB1 and gH1 are the most predominant genotypes among renal transplant recipients in Kuwait. Transplant. Proc. 2011, 43, 1634–1637. [Google Scholar] [CrossRef]
  83. Rosen, H.R.; Corless, C.L.; Rabkin, J.; Chou, S. Association of cytomegalovirus genotype with graft rejection after liver transplantation. Transplantation 1998, 66, 1627–1631. [Google Scholar] [CrossRef] [PubMed]
  84. Lin, H.C.; Han, S.M.; Hwang, W.L.; Chou, C.W.; Chang, K.H.; Shi, Y.Z.; Teng, C.L.J. Cytomegalovirus Infection and Treatment in Allogeneic Hematopoietic Stem Cell Transplantation: A Retrospective Study from a Single Institution in an Endemic Area. Turk. J. Haematol. 2017, 34, 159–166. [Google Scholar] [CrossRef] [PubMed]
  85. Stern, A.; Papanicolaou, G.A. CMV Prevention and Treatment in Transplantation: What’s New in 2019. Curr. Infect. Dis. Rep. 2019, 21, 45. [Google Scholar] [CrossRef] [PubMed]
  86. Chan, S.T.; Logan, A.C. The clinical impact of cytomegalovirus infection following allogeneic hematopoietic cell transplantation: Why the quest for meaningful prophylaxis still matters. Blood Rev. 2017, 31, 173–183. [Google Scholar] [CrossRef] [PubMed]
  87. Zhao, Y.; Gao, F.; Shi, J.; Luo, Y.; Tan, Y.; Lai, X.; Yu, J.; Huang, H. Incidence, Risk Factors, and Outcomes of Primary Poor Graft Function after Allogeneic Hematopoietic Stem Cell Transplantation. Biol. Blood Marrow Transplant. 2019, 25, 1898–1907. [Google Scholar] [CrossRef]
  88. Jakovljevic, A.; Knezevic, A.; Nikolic, N.; Soldatovic, I.; Jovanovic, T.; Milasin, J.; Andric, M. Herpesviruses viral loads and levels of proinflammatory cytokines in apical periodontitis. Oral Dis. 2018, 24, 840–846. [Google Scholar] [CrossRef]
Pharmaceuticals 17 00428 g001
Figure 1. The histogram represents CMV glycoprotein B frequencies in allo-HSCTed patients.
Figure 1. The histogram represents CMV glycoprotein B frequencies in allo-HSCTed patients.
Pharmaceuticals 17 00428 g001
Pharmaceuticals 17 00428 g002
Figure 2. The chart represents the frequencies of CMV gB variants in patients with mixed infections.
Figure 2. The chart represents the frequencies of CMV gB variants in patients with mixed infections.
Pharmaceuticals 17 00428 g002
Table 1. Relevant associations between CMV reactivation and clinical parameters in allo-HSCT-ed patients.
Table 1. Relevant associations between CMV reactivation and clinical parameters in allo-HSCT-ed patients.
Patients with CMV Infection
p < 0.05p-Valuep > 0.05p-Value
Longer OS from Diagnosis 0.037Longer OS after HSCT 0.088
Higher CD4+ at D360 (rel. value)0.031Longer time from Dg to HSCT (months)0.093
Higher NK-Ly count at D180 (abs. value)0.042Higher Ly count at D360 (rel. value)0.086
Less often have 1st complete remission 0.049Higher NK-Ly at D180 (rel. value) 0.071
More often have PGF0.025More often have acute GvHD ‡>0.05
OS—overall survival; PGF—poor graft function; HSCT—hematopoietic stem cell transplant. ‡ Tested independently for skin, GI tract and liver aGVHD.
Table 2. Regression analysis for mixed genotype as an independent predictor for given dependent outcomes.
Table 2. Regression analysis for mixed genotype as an independent predictor for given dependent outcomes.
ParametersUnivariate (Enter Method)Multivariate (Forward Method) *
95% Confidence Intervalp-Value95% Confidence Intervalp-Value
Shorter OS from diagnosis −31.907; −1.426 0.034 −32.318;−0.635 0.042
Shorter OS after HSCT −26.526; −2.274 0.022 −26.408; −1.354 0.032
* Adjusted for age, type of transplant, relapses after alloHSCT and previous acute GvHD. OS—overall survival; GvHD—graft-vs-host disease; HSCT—hematopoietic stem cell transplant.
Table 3. Associations between CMV gB1 genotype and specific clinical parameters.
Table 3. Associations between CMV gB1 genotype and specific clinical parameters.
Patients with gB1 Genotype Infection
p < 0.05p-Valuep > 0.05p-Value
Earlier platelet engraftment0.033Lower CMV PCR max. copy/mL no. before D1000.061
Lower Le at D360 (abs. value) 0.037Lower OS from Diagnosis0.073
Lower Ly at D360 (abs. value)0.037Lower B CD19+ at D180 (rel. value) 0.062
Lower CD8+ at D180 (rel. value) 0.04Lower NK-Ly at D180 (rel. value) 0.089
Less often MRD post-HSCT0.011
Lower CD8+ at D360 (abs. value) 0.04
Lower B CD19+ at D360 (abs. value) 0.037
Lower NK-Ly at D30 (abs. value) 0.044
Higher NK T-Ly at D90 (rel. value) 0.009
Higher NK T-Ly at D90 (abs. value) 0.039
Lower NK T-Ly at D180 (abs. value) 0.034
Lower NK-Ly at D360 (abs. value) 0.037
MRD—minimal/measurable residual disease; OS—overall survival; HSCT—hematopoietic stem cell transplantation.
Table 4. Associations between CMV gB2 genotype and specific clinical parameters.
Table 4. Associations between CMV gB2 genotype and specific clinical parameters.
Patients with gB2 Genotype Infection
p < 0.05p-Valuep > 0.05p-Value
Lower CD4+ at D180 (abs. value)0.048Lower Ly at D180 (rel. value)0.09
Lower NK-Ly at D30 (abs. value)0.035Lower Ly at D180 (abs. value)0.066
Younger at time of HSCT0.026Lower CD4+ at D30 (abs. value)0.092
Lower CD8+ at D180 (abs. value)0.066
Lower NK T-Ly at D360 (rel. value)0.079
HSCT—hematopoietic stem cell transplant.
Table 5. Associations between CMV gB3 genotype and specific clinical parameters.
Table 5. Associations between CMV gB3 genotype and specific clinical parameters.
Patients with gB3 Genotype Infection
p < 0.05p-Valuep > 0.05p-Value
Lower B CD19+ at D30 (rel. value)0.039Lower Le at D30 (abs. value)0.076
Less achieve 100% chimerism at D900.015Lower Ly at D180 (abs. value)0.068
Lower CD4+/CD8+ at D900.069
Lower CD4+ at D360 (rel. value)0.088
Table 6. Associations between CMV gB4 genotype and specific clinical parameters.
Table 6. Associations between CMV gB4 genotype and specific clinical parameters.
Patients with gB4 Genotype Infection
p < 0.05p-Valuep > 0.05p-Value
Lower CD4+/CD8+ at D900.026Shorter OS from Diagnosis 0.09
Lower CD4+/CD8+ at D300.051
Lower CD4+ at D90 (rel. value)0.055
Lower CD4+ at D90 (abs. value)0.072
Lower B CD19+ at D360 (rel. value)0.083
Lower B CD19+ at D360 (abs. value)0.053
OS—overall survival.
Table 7. Associations between CMV gB5 genotype and specific clinical parameters.
Table 7. Associations between CMV gB5 genotype and specific clinical parameters.
Patients with gB5 Genotype Infection
p < 0.05p-Valuep > 0.05p-Value
Shorter OS from Diagnosis 0.042Lower CD34+ (abs. value)0.088
Shorter OS after HSCT 0.036Lower Le at D30 (abs. value)0.098
Lower CD4+/CD8+ at D300.081
OS—overall survival; HSCT—hematopoietic stem cell transplantation.
Table 8. Correlations between diverse CMV genotypes (more than one) and specific clinical factors.
Table 8. Correlations between diverse CMV genotypes (more than one) and specific clinical factors.
Patients with Mixed Genotype Infection
p < 0.05p-Valuep > 0.05p-Value
Shorter OS from Diagnosis 0.036Lower B CD19+ at D360 (abs. value)0.053
Shorter OS after HSCT 0.042Lower NK-Ly at D30 (rel. value)0.059
More often have acute GvHD0.047Lower NK-Ly at D30 (abs. value)0.065
Lower Ly at D90 (rel. value)0.027More often have an unfavourable outcome> 0.05
Lower CD4+ at D90 (rel. value)0.035
Lower CD4+ at D90 (abs. value)0.046
Lower CD4+/CD8+ at D900.024
Lower CD4+ at D180 (rel. value)0.031
OS—overall survival; HSCT—hematopoietic stem cell transplantation; GvHD—graft-vs-host disease.
Table 9. The relation between genotypes and variables related to post-transplant outcomes.
Table 9. The relation between genotypes and variables related to post-transplant outcomes.
GenotypesRelapse after Initial TherapyRelapse after Allo-HSCTNon-Relapse MortalityOutcome
(Alive/
Deceased)		Acute GvHDChronic GvHDOS from DiagnosisOS from HSCT
gB1p = 0.505p = 1.000p = 0.796p = 0.393p = 0.608p = 0.272p = 0.215p = 0.075
gB2p = 1.000p = 0.388p = 0.886p = 0.393p = 0.126p = 0.272p = 0.324p = 0.524
gB3p = 0.258p = 0.447p = 0.387p = 0.615p = 1.000p = 1.000p = 0.569p = 0.393
gB4p = 0.580p = 0.022 †p = 0.310p = 0.085p = 0.126p = 1.000p = 0.340p = 0.408
gB5p = 1.000p = 0.067p = 0.101p = 0.051p = 1.000p = 1.000p = 0.042 †p = 0.036 †
OS—overall survival; GvHD—graft-vs.-host disease; HSCT—hematopoietic stem cell transplant. † p-values marked with the dagger symbol are significant.
Table 10. Basic patient demographics as regards CMV DNA detection.
Table 10. Basic patient demographics as regards CMV DNA detection.
Patient CharacteristicsCMV DNA PositiveCMV DNA Negativep-Value
Cohort size (N)594415N/A
Avg. age at alloHSCT, range (year)
Male
Female		39.85 (19–64)
41.8 (20–58)
37.83 (19–64)		40.3638.33p = 0.554 *
Genderp = 0.824 †
     Male3022 (73.3%)8 (26.7%)
     Female2922 (75.9%)7 (24.1%)
Diagnosesp = 0.739 †
     Acute lymphoblastic leukemia1611 (68.8%)5 (31.2%)
     Acute myelogenous leukemia 2822 (78.6%)6 (21.4%)
     Hodgkin’s disease74 (57.1%)3 (42.9%)
     Myelodysplastic syndrome 54 (80%)1 (20%)
     Non-Hodgkin’s lymphoma22 (100%)0
     Chronic lymphocytic leukemia11 (100%)0
alloHSCT modalityp = 0.055 †
     MUD2320 (87%)3 (13%)
     MMUD1813 (72.2%)5 (27.8%)
     MRD62 (33.3%)4 (66.7%)
     HAPLO85 (62.5%)3 (37.5%)
     MMUD and MUD44 (100%)0
CMV prophylaxis (letermovir)p = 0.593 ‡
     Yes53 (60%)2 (40%)
     No5441 (76%)13 (24%)
Acute GvHDp = 0.260 †
     Yes 1714 (82.4%)3 (17.6%)
     No 3725 (67.6%)12 (32.4%)
     GvHD—skin129 (75%)3 (25%)p = 0.875 †
     GvHD—liver 22 (100%)0p > 0.05 ‡
     GvHD—gastrointestinal 76 (85.7%)1 (14.3%)p = 0.393 †
Chronic GvHDp = 0.106 †
     Yes148 (57.1%)6 (42.9%)
     No4334 (79.1%)9 (20.9%)
Abbreviations: N/A—not applicable; MUD—matched unrelated donor; MMUD—mismatched unrelated donor; MRD—matched related donor; HAPLO—haploidentical; GvHD—graft-vs-host disease. * Independent samples t-test value. † Pearson chi-square value. ‡ Fisher’s exact test value.
Table 11. Primer sequences and nested multiplex PCR conditions used in CMV gB genotyping.
Table 11. Primer sequences and nested multiplex PCR conditions used in CMV gB genotyping.
Gene UL55PrimerPrimer Sequence (5′–3′)PCR ConditionsAmplicon Size (bp)
IDDAEFECycles
1st roundUL55 upTTTGGAGAAAACGCCGAC95/5 min94/1 min50/1 min72/1 min72/10 min40751
UL55 lowCGCGCGGCAATCGGTTTGTTGTA
2nd roundgB 1ATGACCGCCACTTTCTTATC94/2 min94/30 s53/1 min72/1.5 min72/10 min35420
gB 2AATTCGGTCTTCCAAAGTCGGAG613
gB 3TAGCTCCGGTGTGAACTCC190
gB 4CGAGTCCTCGGCTTCGGAACGAATGGT465
gB 5GTTCTCCAGCGATAGGGTA139
gB lowGTTGATCCACACACCAGGC
ID—initial denaturation, D—denaturation, A—annealing, E—elongation, FE—final elongation. All temperature values are expressed in degrees centigrade.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Vasiljevic, T.; Jankovic, M.; Tomic, A.; Bakrac, I.; Radenovic, S.; Miljanovic, D.; Knezevic, A.; Jovanovic, T.; Djunic, I.; Todorovic-Balint, M. Significance of Cytomegalovirus gB Genotypes in Adult Patients Undergoing Hematopoietic Stem Cell Transplantation: Insights from a Single-Centre Investigation. Pharmaceuticals 2024, 17, 428. https://doi.org/10.3390/ph17040428

AMA Style

Vasiljevic T, Jankovic M, Tomic A, Bakrac I, Radenovic S, Miljanovic D, Knezevic A, Jovanovic T, Djunic I, Todorovic-Balint M. Significance of Cytomegalovirus gB Genotypes in Adult Patients Undergoing Hematopoietic Stem Cell Transplantation: Insights from a Single-Centre Investigation. Pharmaceuticals. 2024; 17(4):428. https://doi.org/10.3390/ph17040428

Chicago/Turabian Style

Vasiljevic, Tamara, Marko Jankovic, Ana Tomic, Ida Bakrac, Stefan Radenovic, Danijela Miljanovic, Aleksandra Knezevic, Tanja Jovanovic, Irena Djunic, and Milena Todorovic-Balint. 2024. "Significance of Cytomegalovirus gB Genotypes in Adult Patients Undergoing Hematopoietic Stem Cell Transplantation: Insights from a Single-Centre Investigation" Pharmaceuticals 17, no. 4: 428. https://doi.org/10.3390/ph17040428

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop