Signaling Pathway of Histamine H1 Receptor-Mediated Histamine H1 Receptor Gene Upregulation Induced by Histamine in U-373 MG Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Animal Experiments
2.3. Real-Time Quantitative RT-PCR
2.4. Determination of Luciferase mRNA Using Promoter Assay System
2.5. RT-PCR
2.6. Statistical Analysis
3. Results and Discussion
3.1. Histamine-Induced Upregulation of H1R Gene Expression Is Mediated by H1R Activation, and PKCα Is Involved in Its Signaling Pathway in U-373 MG Cells
3.2. Stimulation with Histamine Caused a Rapid and Transient Increase in H1R mRNA Levels in U-373 MG Cells
3.3. Transcriptional Regulation of H1R Gene Expression in U-373 MG Cells
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hill, S.J.; Ganellin, C.R.; Timmerman, H.; Schwartz, J.C.; Shankley, N.P.; Young, J.M.; Schunack, W.; Levi, R.; Haas, H.L. Classification of histamine receptors. Pharmacol. Rev. 1997, 49, 253–278. [Google Scholar]
- Seifert, R.; Strasser, A.; Schneider, E.H.; Neumann, D.; Dove, S.; Buschauer, A. Molecular and cellular analysis of human histamine receptor subtypes. Trends Pharmacol. Sci. 2013, 34, 33–58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bousquet, J.; Khaltaev, N.; Cruz, A.A.; Denburg, J.; Fokkens, W.J.; Togias, A.; Zuberbier, T.; Baena-Cagnani, C.E.; Canonica, G.W.; van Weel, C.; et al. Allergic rhinitis and its impact on asthma (ARIA) 2008 update (in collaboration with the World Health Organization, GA(2)LEN and AllerGen). Allergy 2008, 63 (Suppl. 86), 8–160. [Google Scholar] [CrossRef]
- Hamano, N.; Terada, N.; Maesako, K.; Ikeda, T.; Fukuda, S.; Wakita, J.; Yamashita, T.; Konnno, A. Expression of histamine receptors in nasal epithelial cells and endothelial cells: The effects of sex hormones. Int. Arch. Allergy Immunol. 1998, 115, 220–227. [Google Scholar] [CrossRef]
- Nakasaki, T.; Masuyama, K.; Fukui, H.; Ogino, S.; Eura, M.; Samejima, Y.; Ishikawa, T.; Yumoto, E. Effect of PAF on histamine H1 receptor mRNA expression in rat trigeminal ganglia. Prostaglandins Other Lipid Mediat. 1999, 58, 29–41. [Google Scholar] [CrossRef]
- Shimada, H. The factor of hypersensitivity of the human nasal mucosa: Receptor binding assay of histamine H1 receptors. J. Jpn. Rhinol. Soc. 1990, 29, 225–233. [Google Scholar] [CrossRef] [Green Version]
- Iriyoshi, N.; Takeuchi, K.; Yuta, A.; Ukai, K.; Sakakura, Y. Increased expression of H1R mRNA in allergic rhinitis. Clin. Exp. Allergy 1996, 26, 379–385. [Google Scholar] [CrossRef] [PubMed]
- Dinh, Q.T.; Cryer, A.; Dinh, S.; Peiser, C.; Wu, S.; Springer, J.; Hamelmann, E.; Klapp, B.F.; Heppt, W.; Fischer, A. Transcriptional up-regulation of histamine receptor-1 in epithelial, mucus and inflammatory cells in perennial allergic rhinitis. Clin. Exp. Allergy 2005, 35, 1443–1448. [Google Scholar] [CrossRef] [PubMed]
- Mizuguchi, H.; Kitamura, Y.; Kondo, Y.; Kuroda, W.; Yoshida, H.; Miyamoto, Y.; Hattori, M.; Fukui, H.; Takeda, N. Preseasonal prophylactic treatment with antihistamines suppresses nasal symptoms and expression of histamine H1 receptor mRNA in the nasal mucosa of patients with pollinosis. Methods Find. Exp. Clin. Pharmacol. 2010, 32, 745–748. [Google Scholar] [CrossRef] [PubMed]
- Kitamura, Y.; Nakagawa, H.; Fujii, T.; Sakoda, T.; Enomoto, T.; Mizuguchi, H.; Fukui, H.; Takeda, N. Effects of antihistamine on up-regulation of histamine H1 receptor mRNA in the nasal mucosa of patients with pollinosis induced by controlled cedar pollen challenge in an environmental exposure unit. J. Pharmacol. Sci. 2015, 129, 183–187. [Google Scholar] [CrossRef] [Green Version]
- Matsushita, C.; Mizuguchi, H.; Niino, H.; Sagesaka, Y.; Masuyama, K.; Fukui, H. Identification of epigallocatechin-3-O-gallate as an active constituent in tea extract that suppresses transcriptional up- regulations of the histamine H1 receptor and interleukin-4 genes. J. Trad. Med. 2008, 25, 133–142. [Google Scholar]
- Hattori, M.; Mizuguchi, H.; Baba, Y.; Ono, S.; Nakano, T.; Zhang, Q.; Sasaki, Y.; Kobayashi, M.; Kitamura, Y.; Takeda, N.; et al. Quercetin inhibits transcriptional up-regulation of histamine H1 receptor via suppressing protein kinase C-δ/extracellular signal-regulated kinase/poly(ADP-ribose) polymerase-1 signaling pathway in HeLa cells. Int. Immunopharmacol. 2013, 15, 232–239. [Google Scholar] [CrossRef]
- Mizuguchi, H.; Nariai, Y.; Kato, S.; Nakano, T.; Kanayama, T.; Kashiwada, Y.; Nemoto, H.; Kawazoe, K.; Takaishi, Y.; Kitamura, Y.; et al. Maackiain is a novel antiallergic compound that suppresses transcriptional upregulation of the histamine H1 receptor and interleukin-4 genes. Pharmacol. Res. Perspect. 2015, 3, e00166. [Google Scholar] [CrossRef]
- Shill, M.C.; Das, A.K.; Itou, T.; Karmakar, S.; Mukherjee, P.K.; Mizuguchi, H.; Kashiwada, Y.; Fukui, H.; Nemoto, H. The isolation and synthesis of a novel benzofuran compound from Tephrosia purpurea, and the synthesis of several related derivatives, which suppress histamine H1 receptor gene expression. Bioorg. Med. Chem. 2015, 23, 6869–6874. [Google Scholar] [CrossRef] [PubMed]
- Das, A.K.; Yoshimura, S.; Mishima, R.; Fujimoto, K.; Mizuguchi, H.; Dev, S.; Wakayama, Y.; Kitamura, Y.; Horio, S.; Takeda, N.; et al. Stimulation of histamine H1 receptor up-regulates histamine receptor itself through activation of receptor gene transcription. J. Pharmacol. Sci. 2007, 103, 374–382. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mizuguchi, H.; Terao, T.; Kitai, M.; Ikeda, M.; Yoshimura, Y.; Das, A.K.; Kitamura, Y.; Takeda, N.; Fukui, H. Involvement of PKCδ/Extracellular signal-regulated kinase/ Poly(ADP-ribose) polymerase-1 (PARP-1) signaling pathway in histamine- induced up-regulation of histamine H1 receptor gene expression in HeLa cells. J. Biol. Chem. 2011, 286, 30542–30551. [Google Scholar] [CrossRef] [Green Version]
- Nariai, Y.; Mizuguchi, H.; Ogasawara, T.; Nagai, H.; Sasaki, Y.; Okamoto, Y.; Yoshimura, Y.; Kitamura, Y.; Nemoto, H.; Takeda, N.; et al. Disruption of Heat Shock Protein 90 (Hsp90)-Protein Kinase Cδ (PKCδ) Interaction by (-)-Maackiain Suppresses Histamine H1 Receptor Gene Transcription in HeLa Cells. J. Biol. Chem. 2015, 290, 27393–27402. [Google Scholar] [PubMed] [Green Version]
- Xu, J.; Zhang, X.; Qian, Q.; Wang, Y.; Dong, H.; Li, N.; Qian, Y.; Jin, W. Histamine upregulates the expression of histamine receptors and increases the neuroprotective effect of astrocytes. Neuroinflammation 2018, 15, 41. [Google Scholar] [CrossRef] [Green Version]
- Hishinuma, S.; Young, J.M. Characteristics of the binding of [3H]-mepyramine to intact human U373 MG astrocytoma cells: Evidence for histamine-induced H1-receptor internalisation. Br. J. Pharmacol. 1995, 116, 2715–2723. [Google Scholar] [CrossRef] [Green Version]
- Miyoshi, K.; Kawakami, N.; Das, A.K.; Fujimoto, K.; Horio, S.; Fukui, H. Heterologous up-regulation of the histamine H1 receptor by M3 muscarinic receptor-mediated activation of H1-receptor gene transcription. J. Pharm. Pharmacol. 2007, 59, 843–848. [Google Scholar]
- Kitamura, Y.; Miyoshi, A.; Murata, Y.; Kalubi, B.; Fukui, H.; Takeda, N. Effect of glucocorticoid on upregulation of histamine H1 receptor mRNA in nasal mucosa of rats sensitized by exposure to toluene diisocyanate. Acta Otolaryngol. 2004, 124, 1053–1058. [Google Scholar] [CrossRef]
- Horio, S.; Fujimoto, K.; Mizuguchi, H.; Fukui, H. Interleukin-4 up-regulates histamine H1 receptors by activation of H1 receptor gene transcription. Naunyn-Schmied Arch. Pharmacol. 2010, 381, 305–313. [Google Scholar] [CrossRef]
- Bakker, R.A.; Wieland, K.; Timmerman, H.; Leurs, R. Constitutive activity of the histamine H1 receptor reveals inverse agonism of histamine H1 receptor antagonists. Eur. J. Pharmacol. 2000, 387, R5–R7. [Google Scholar] [CrossRef]
- Leurs, R.; Church, M.K.; Taglialatela, M. H1-antihistamines: Inverse agonism, anti-inflammatory actions and cardiac effects. Clin. Exp. Allergy 2002, 32, 489–498. [Google Scholar] [CrossRef]
- Shih, S.-C.; Mullen, A.; Abrams, K.; Mukhopadhysy, D.; Claffey, K.P. Role of protein kinase C isozymes in phorbol ester-induced vascular endothelial growth factor expression in human glioblastoma cells. J. Biol. Chem. 1999, 254, 15407–15414. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dempsey, E.C.; Newton, A.C.; Mochly-Rosen, D.; Fields, A.P.; Reyland, M.E.; Insel, P.A.; Messing, R.O. Protein kinase C isozymes and the regulation of diverse cell responses. Am. J. Physiol. Lung Cell. Mol. Physiol. 2000, 279, L429–L438. [Google Scholar] [CrossRef]
- Hayashi, A.; Seki, N.; Hattori, A.; Kozuma, S.; Saito, T. PKCν, a new member of the protein kinase C family, composes a fourth subfamily with PKCμ. Biochim. Biophys. Acta 1999, 1450, 99–106. [Google Scholar] [CrossRef] [Green Version]
- Swan, C.; Richards, S.A.; Duroudier, N.P.; Sayers, I.; Hall, I.P. Alternative promoter use and splice variation in the human histamine H1 receptor gene. Am. J. Respir. Cell Mol. Biol. 2006, 35, 118–126. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Backer, M.D.; Loonen, I.; Verhasselt, P.; Neefs, J.M.; Luyten, W.H. Structure of the human histamine H1 receptor gene. Biochem. J. 1998, 335 Pt 3, 663–670. [Google Scholar] [CrossRef] [Green Version]
- Mizuguchi, H.; Miyagi, K.; Terao, T.; Sakamoto, N.; Yamawaki, Y.; Adachi, T.; Ono, S.; Sasaki, Y.; Yoshimura, Y.; Kitamura, Y.; et al. PMA-induced dissociation of Ku86 from the promoter causes transcriptional up-regulation of histamine H(1) receptor. Sci. Rep. 2012, 2, 916. [Google Scholar] [CrossRef] [Green Version]
- Ishihara, H.; Tanaka, I.; Ishihara, F.; Suzuki, K.; Yoshino, C.; Cheeramakara, C.; Wan, H.; Akashi, S. Transient reporter RNA assay: Quantification of reporter gene mRNA during immediate early response in mammalian cells based on real-time reverse transcription polymerase chain reaction. Anal. Biochem. 2005, 341, 369–371. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Haws, P.; Qiang, W. Multiple Variable First Exons: A Mechanism for Cell- and Tissue-Specific Gene Regulation. Genome Res. 2004, 14, 79–89. [Google Scholar] [CrossRef] [Green Version]
- Turner, J.D.; Schote, A.B.; Maced, J.A.; Pelascini, L.P.L.; Muller, C.P. Tissue specific glucocorticoid receptor expression, a role for alternative first exon usage? Biochem. Pharmacol. 2006, 72, 1529–1537. [Google Scholar] [CrossRef]
- Sobczak, K.; Krzyzosiak, W.J. Structural determinants of BRCA1 translational regulation. J. Biol. Chem. 2002, 277, 17349–17358. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Newton, D.C.; Robb, G.B.; Kau, C.L.; Miller, T.L.; Cheung, A.H.; Hall, A.V.; VanDamme, S.; Wilcox, J.N.; Marsden, P.A. RNA diversity has profound effects on the translation of neuronal nitric oxide synthase. Proc. Natl. Acad. Sci. USA 1999, 96, 12150–12155. [Google Scholar] [CrossRef] [Green Version]
- Matsubara, M.; Tamura, T.; Ohmori, K.; Hasegawa, K. Histamine H1 receptor antagonist blocks histamine-induced proinflammatory cytokine production through inhibition of Ca2+-dependent protein kinase C, Raf/MEK/ERK and IKK/IkB/NF-kB signal cascades. Biochem. Pharmacol. 2005, 69, 433–449. [Google Scholar] [CrossRef] [PubMed]
- Ohuchi, Y.; Yanai, K.; Sakurai, E.; Fukui, H.; Yanagisawa, T.; Watanabe, T. Histamine-induced calcium mobilization in single cultured cells expressing histamine H1 receptors: A relationship between its sensitivity and the density of H1 receptors. Int. J. Mol. Med. 1998, 1, 355–360. [Google Scholar] [CrossRef]
Sequence |
---|
H1R mRNA Forward primer: 5’-CAGAGGATCAGATGTTAGGTGATAGC-3’ Reverse primer: 5’-AGCGGAGCCTCTTCCAAGTAA-3’ Probe: 5’-FAM-CTTCTCTCGAACGGACTCAGATACCACC-TAMRA-3’ |
A/K variant mRNA Forward primer: 5’- AGCCCTGAGGTCTGGAGACAG -3’ Reverse primer: 5’- TTGCCCTCACAACATCTTGTCTTC -3’ Probe: 5’- FAM-TGAAACCAGCCAGGGAGTGAGCCATAC -TAMRA-3’ |
B/K variant mRNA Forward primer: 5’-CAAACTTTCCCCGGAGCCG-3’ Reverse primer: 5’-TGTTGCCCTCACACATCTTTGTCTTC-3’ 1 Probe: 5’-FAM-CTCCTGCCT-3’ |
F/K variant mRNA Forward primer: 5’-TTGCCAGGGTAAGAGGATGAG-3’ Reverse primer: 5’-AGGAATTGGGGAGGCTCATTG-3’ Probe: 5’-FAM-CAGGAGAGCAGCATTTGTAAAGGGAG-TAMRA-3’ |
Photinus pyralis luciferase (Pluc) mRNA Forward primer: 5’-TGAGTACTTCGAAATGTCCGTTC-3’’ Reverse primer: 5’-GTATTCAGCCCATATCGTTTCAT-3’ 2 Probe: 5’-FAM-GGCAGAAG-3’ |
Renilla reniformis luciferase (Rluc) mRNA Forward primer: 5’-GGAGAATAACTTCTTCGTGGAAAC-3’ Reverse primer: 5’-GCTGCAAATTCTTCTGGTTCTAA-3’ 3 Probe: 5’-FAM-TGTTGCCA-3’ |
Sequence | |
---|---|
A/K variant | |
Forward primer | 5’-CAAGACTGCTAGCTTAGCCAAGCAAGTTGG-3’ |
Reverse primer | 5’-AGCAGTTAAGCTTCCAATCAGCCACCTCAGTC-3’ |
B/K variant | |
Forward primer | 5’- ACTAGTCTGCTTACCAGGGGCTTGAAATCATG -3’ |
Reverse primer | 5’- AAGCTTAGGTGTCTGCGCGTCGAGTGCTG -3’ |
F/K variant | |
Forward primer | 5’-TGGTGGCTCGAGAATCCTTGCCCTGAAGACTG-3’ |
Reverse primer | 5’-GTTGTTATAAGCAAACAGGTCTACTCC-3’ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mizuguchi, H.; Miyamoto, Y.; Terao, T.; Yoshida, H.; Kuroda, W.; Kitamura, Y.; Takeda, N.; Fukui, H. Signaling Pathway of Histamine H1 Receptor-Mediated Histamine H1 Receptor Gene Upregulation Induced by Histamine in U-373 MG Cells. Curr. Issues Mol. Biol. 2021, 43, 1243-1254. https://doi.org/10.3390/cimb43030088
Mizuguchi H, Miyamoto Y, Terao T, Yoshida H, Kuroda W, Kitamura Y, Takeda N, Fukui H. Signaling Pathway of Histamine H1 Receptor-Mediated Histamine H1 Receptor Gene Upregulation Induced by Histamine in U-373 MG Cells. Current Issues in Molecular Biology. 2021; 43(3):1243-1254. https://doi.org/10.3390/cimb43030088
Chicago/Turabian StyleMizuguchi, Hiroyuki, Yuko Miyamoto, Takuma Terao, Haruka Yoshida, Wakana Kuroda, Yoshiaki Kitamura, Noriaki Takeda, and Hiroyuki Fukui. 2021. "Signaling Pathway of Histamine H1 Receptor-Mediated Histamine H1 Receptor Gene Upregulation Induced by Histamine in U-373 MG Cells" Current Issues in Molecular Biology 43, no. 3: 1243-1254. https://doi.org/10.3390/cimb43030088