The Effect of Lactobacillus plantarum Extracellular Vesicles from Korean Women in Their 20s on Skin Aging
Abstract
:1. Introduction
2. Materials and Methods
2.1. Isolation of Microorganisms
2.2. 16S rRNA Gene Sequence and Phylogenetic Analysis
2.3. Microorganism Preparation
2.4. Extracellular Vesicle Isolation
2.5. Nanoparticle Tracking Analysis (NTA)
2.6. Cell Culture
2.7. Cell Viability Assay
2.8. LpEV Treatment Induces Elastase Inhibitory Activity
2.9. mRNA Expression Analysis with Reverse Transcript PCR (RT-PCR)
2.10. Protein Expression Analysis with Western Blot
2.11. Preparation of Skin Application Solutions
2.12. Volunteer Recruitment and Selection
2.13. Skin Contour Measurement
2.14. Skin Image Measurement
2.15. Skin Wrinkles, Elasticity, and Dermal Density Measurements
2.16. Statistical Analysis
3. Results
3.1. S rRNA and Phylogenetic Analysis of Lactobacillus plantarum
3.2. Lactobacillus plantarum Actively Secretes EVs
3.3. LpEV Treatment Induces Cell Proliferation and Regulates ECM Degradation-Associated Gene Expression
3.4. LpEV Treatment Induces ECM Production-Associated Gene Expression
3.5. LpEV Treatment Suppresses Wrinkle Formation in Clinical Trials
3.6. LpEV Treatment Moisturizes Skin and Enhances Skin Density
3.7. LpEV Treatment Suppresses Skin Pigmentation Caused by Aging
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
Abbreviations
EV | extracellular vesicle |
ECM | extracellular matrix |
LpEVs | EVs that were secreted from L. plantarum of women in their 20s |
MMP-1 | matrix metalloproteinase-1 |
COL1A1 | pro-collagen type I |
FLG | filaggrin |
References
- Kim, D.; Kang, B.; Kim, O.Y.; Choi, D.; Lee, J.; Kim, S.R.; Go, G.; Yoon, Y.J.; Kim, J.H.; Jang, S.C. EVpedia: An Integrated Database of High-Throughput Data for Systemic Analyses of Extracellular Vesicles. J. Extracell. Vesicles 2013, 2, 20384. [Google Scholar] [CrossRef] [PubMed]
- Woith, E.; Fuhrmann, G.; Melzig, M.F. Extracellular Vesicles—Connecting Kingdoms. Int. J. Mol. Sci. 2019, 20, 5695. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tkach, M.; Théry, C. Communication by Extracellular Vesicles: Where we are and Where we Need to Go. Cell 2016, 164, 1226–1232. [Google Scholar] [CrossRef] [Green Version]
- Stahl, P.D.; Raposo, G. Extracellular Vesicles: Exosomes and Microvesicles, Integrators of Homeostasis. Physiology 2019, 34, 169–177. [Google Scholar] [CrossRef]
- Yu, L.; Zhu, J.; Liu, J.; Jiang, F.; Ni, W.; Qu, L.; Ni, R.; Lu, C.; Xiao, M. A Comparison of Traditional and Novel Methods for the Separation of Exosomes from Human Samples. BioMed Res. Int. 2018, 2018, 3634563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bano, R.; Ahmad, F.; Mohsin, M. A Perspective on the Isolation and Characterization of Extracellular Vesicles from Different Biofluids. RSC Adv. 2021, 11, 19598–19615. [Google Scholar] [CrossRef]
- Lee, Y.; El Andaloussi, S.; Wood, M.J. Exosomes and Microvesicles: Extracellular Vesicles for Genetic Information Transfer and Gene Therapy. Hum. Mol. Genet. 2012, 21, R125–R134. [Google Scholar] [CrossRef] [Green Version]
- Tulkens, J.; Vergauwen, G.; Van Deun, J.; Geeurickx, E.; Dhondt, B.; Lippens, L.; De Scheerder, M.; Miinalainen, I.; Rappu, P.; De Geest, B.G. Increased Levels of Systemic LPS-Positive Bacterial Extracellular Vesicles in Patients with Intestinal Barrier Dysfunction. Gut 2020, 69, 191–193. [Google Scholar] [CrossRef] [Green Version]
- Matsuguchi, T.; Takagi, A.; Matsuzaki, T.; Nagaoka, M.; Ishikawa, K.; Yokokura, T.; Yoshikai, Y. Lipoteichoic Acids from Lactobacillus Strains Elicit Strong Tumor Necrosis Factor Alpha-Inducing Activities in Macrophages through Toll-Like Receptor 2. Clin. Vaccine Immunol. 2003, 10, 259–266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schaar, V.; Uddbäck, I.; Nordström, T.; Riesbeck, K. Group A Streptococci are Protected from Amoxicillin-Mediated Killing by Vesicles Containing Β-Lactamase Derived from Haemophilus influenzae. J. Antimicrob. Chemother. 2014, 69, 117–120. [Google Scholar] [CrossRef]
- Buchon, N.; Broderick, N.A.; Lemaitre, B. Gut Homeostasis in a Microbial World: Insights from Drosophila melanogaster. Nat. Rev. Microbiol. 2013, 11, 615–626. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Defourny, K.A.; Smid, E.J.; Abee, T. Gram-Positive Bacterial Extracellular Vesicles and their Impact on Health and Disease. Front. Microbiol. 2018, 9, 1502. [Google Scholar] [CrossRef] [Green Version]
- Hong, S.; Choi, E.; Min, T.; Kim, J.; Kim, M.; Jeon, S.G.; Lee, B.; Gho, Y.S.; Jee, Y.; Pyun, B. An Important Role of A-Hemolysin in Extracellular Vesicles on the Development of Atopic Dermatitis Induced by Staphylococcus aureus. PLoS ONE 2014, 9, e100499. [Google Scholar]
- Walker, S.; Busatto, S.; Pham, A.; Tian, M.; Suh, A.; Carson, K.; Quintero, A.; Lafrence, M.; Malik, H.; Santana, M.X. Extracellular Vesicle-Based Drug Delivery Systems for Cancer Treatment. Theranostics 2019, 9, 8001. [Google Scholar] [CrossRef]
- de Jong, B.; Barros, E.R.; Hoenderop, J.G.; Rigalli, J.P. Recent Advances in Extracellular Vesicles as Drug Delivery Systems and their Potential in Precision Medicine. Pharmaceutics 2020, 12, 1006. [Google Scholar] [CrossRef]
- Surman, M.; Drożdż, A.; Stępień, E.; Przybyło, M. Extracellular Vesicles as Drug Delivery Systems-Methods of Production and Potential Therapeutic Applications. Curr. Pharm. Des. 2019, 25, 132–154. [Google Scholar] [CrossRef]
- Saint-Pol, J.; Gosselet, F.; Duban-Deweer, S.; Pottiez, G.; Karamanos, Y. Targeting and Crossing the Blood-Brain Barrier with Extracellular Vesicles. Cells 2020, 9, 851. [Google Scholar] [CrossRef] [Green Version]
- Agarwal, S.; Agarwal, V.; Agarwal, M.; Singh, M. Exosomes: Structure, Biogenesis, Types and Application in Diagnosis and Gene and Drug Delivery. Curr. Gene Ther. 2020, 20, 195–206. [Google Scholar] [CrossRef] [PubMed]
- Edem, E.E.; Nathaniel, B.U.; Nebo, K.E.; Obisesan, A.O.; Olabiyi, A.A.; Akinluyi, E.T.; Ishola, A.O. Lactobacillus plantarum Mitigates Sexual-Reproductive Deficits by Modulating Insulin Receptor Expression in the Hypothalamic-Pituitary-Testicular Axis of Hyperinsulinemic Mice. Drug Metab. Pers. Ther. 2021. [Google Scholar] [CrossRef] [PubMed]
- Passos, F.V.; Fleming, H.P.; Ollis, D.F.; Felder, R.M.; McFeeters, R.F. Kinetics and Modeling of Lactic Acid Production by Lactobacillus plantarum. Appl. Environ. Microbiol. 1994, 60, 2627–2636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nguyen, T.; Kang, J.H.; Lee, M.S. Characterization of Lactobacillus plantarum PH04, a Potential Probiotic Bacterium with Cholesterol-Lowering Effects. Int. J. Food Microbiol. 2007, 113, 358–361. [Google Scholar] [CrossRef]
- Zheng, Z.; Cao, F.; Wang, W.; Yu, J.; Chen, C.; Chen, B.; Liu, J.; Firrman, J.; Renye, J.; Ren, D. Probiotic Characteristics of Lactobacillus plantarum E680 and its Effect on Hypercholesterolemic Mice. BMC Microbiol. 2020, 20, 1–9. [Google Scholar] [CrossRef]
- Prakoeswa, C.; Herwanto, N.; Prameswari, R.; Astari, L.; Sawitri, S.; Hidayati, A.N.; Indramaya, D.M.; Kusumowidagdo, E.R.; Surono, I.S. Lactobacillus plantarum IS-10506 Supplementation Reduced SCORAD in Children with Atopic Dermatitis. Benef. Microbes 2017, 8, 833–840. [Google Scholar] [CrossRef]
- Nagata, Y.; Yoshida, M.; Kitazawa, H.; Araki, E.; Gomyo, T. Improvements in Seasonal Allergic Disease with Lactobacillus plantarum no. 14. Biosci. Biotechnol. Biochem. 2010, 74, 1869–1877. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Zeng, Y.; Wang, S.; Liu, H.; Zhang, D.; Zhang, W.; Wang, Y.; Ji, H. Swine-Derived Probiotic Lactobacillus plantarum Inhibits Growth and Adhesion of Enterotoxigenic Escherichia coli and Mediates Host Defense. Front. Microbiol. 2018, 9, 1364. [Google Scholar] [CrossRef]
- Dinev, T.; Beev, G.; Tzanova, M.; Denev, S.; Dermendzhieva, D.; Stoyanova, A. Antimicrobial Activity of Lactobacillus plantarum against Pathogenic and Food Spoilage Microorganisms: A Review. Bulg. J. Vet. Med. 2018, 21, 253–268. [Google Scholar] [CrossRef]
- Valdez, J.C.; Peral, M.C.; Rachid, M.; Santana, M.; Perdigon, G. Interference of Lactobacillus plantarum with Pseudomonas aeruginosa in Vitro and in Infected Burns: The Potential use of Probiotics in Wound Treatment. Clin. Microbiol. Infect. 2005, 11, 472–479. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.E.; Fischbach, M.A.; Belkaid, Y. Skin Microbiota–host Interactions. Nature 2018, 553, 427–436. [Google Scholar] [CrossRef] [PubMed]
- Tsai, W.; Chou, C.; Chiang, Y.; Lin, C.; Lee, C. Regulatory Effects of Lactobacillus plantarum-GMNL6 on Human Skin Health by Improving Skin Microbiome. Int. J. Med. Sci. 2021, 18, 1114. [Google Scholar] [CrossRef] [PubMed]
- Nam, B.; Kim, S.A.; Park, S.D.; Kim, H.J.; Kim, J.S.; Bae, C.H.; Kim, J.Y.; Nam, W.; Lee, J.L.; Sim, J.H. Regulatory Effects of Lactobacillus plantarum HY7714 on Skin Health by Improving Intestinal Condition. PLoS ONE 2020, 15, e0231268. [Google Scholar] [CrossRef] [PubMed]
- Kolarsick, P.A.; Kolarsick, M.A.; Goodwin, C. Anatomy and Physiology of the Skin. J. Dermatol. Nurses Assoc. 2011, 3, 203–213. [Google Scholar] [CrossRef] [Green Version]
- Kammeyer, A.; Luiten, R.M. Oxidation Events and Skin Aging. Ageing Res. Rev. 2015, 21, 16–29. [Google Scholar] [CrossRef]
- Scharffetter–Kochanek, K.; Brenneisen, P.; Wenk, J.; Herrmann, G.; Ma, W.; Kuhr, L.; Meewes, C.; Wlaschek, M. Photoaging of the Skin from Phenotype to Mechanisms. Exp. Gerontol. 2000, 35, 307–316. [Google Scholar] [CrossRef]
- Cole, M.A.; Quan, T.; Voorhees, J.J.; Fisher, G.J. Extracellular Matrix Regulation of Fibroblast Function: Redefining our Perspective on Skin Aging. J. Cell Commun. Signal. 2018, 12, 35–43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pittayapruek, P.; Meephansan, J.; Prapapan, O.; Komine, M.; Ohtsuki, M. Role of Matrix Metalloproteinases in Photoaging and Photocarcinogenesis. Int. J. Mol. Sci. 2016, 17, 868. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Verdier-Sévrain, S.; Bonté, F. Skin Hydration: A Review on its Molecular Mechanisms. J. Cosmet. Dermatol. 2007, 6, 75–82. [Google Scholar] [CrossRef]
- Sender, R.; Fuchs, S.; Milo, R. Revised Estimates for the Number of Human and Bacteria Cells in the Body. PLoS Biol. 2016, 14, e1002533. [Google Scholar] [CrossRef] [Green Version]
- Grice, E.A.; Segre, J.A. The Skin Microbiome. Nat. Rev. Microbiol. 2011, 9, 244–253. [Google Scholar] [CrossRef]
- Orland, C.; Emilson, E.J.; Basiliko, N.; Mykytczuk, N.C.; Gunn, J.M.; Tanentzap, A.J. Microbiome Functioning Depends on Individual and Interactive Effects of the Environment and Community Structure. ISME J. 2019, 13, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Findley, K.; Grice, E.A. The Skin Microbiome: A Focus on Pathogens and their Association with Skin Disease. PLoS Pathog. 2014, 10, e1004436. [Google Scholar] [CrossRef]
- Byrd, A.L.; Belkaid, Y.; Segre, J.A. The Human Skin Microbiome. Nat. Rev. Microbiol. 2018, 16, 143–155. [Google Scholar] [CrossRef] [PubMed]
- Macia, L.; Nanan, R.; Hosseini-Beheshti, E.; Grau, G.E. Host-and Microbiota-Derived Extracellular Vesicles, Immune Function, and Disease Development. Int. J. Mol. Sci. 2020, 21, 107. [Google Scholar] [CrossRef] [Green Version]
- Wang, A.S.; Dreesen, O. Biomarkers of Cellular Senescence and Skin Aging. Front. Genet. 2018, 9, 247. [Google Scholar] [CrossRef] [PubMed]
- McGrath, J.A.; Uitto, J. The Filaggrin Story: Novel Insights into Skin-Barrier Function and Disease. Trends Mol. Med. 2008, 14, 20–27. [Google Scholar] [CrossRef]
- Papakonstantinou, E.; Roth, M.; Karakiulakis, G. Hyaluronic Acid: A Key Molecule in Skin Aging. Derm.-Endocrinol. 2012, 4, 253–258. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baumann, L. Skin Ageing and its Treatment. J. Pathol. A J. Pathol. Soc. Great Br. Irel. 2007, 211, 241–251. [Google Scholar] [CrossRef]
- Fujimura, T.; Haketa, K.; Hotta, M.; Kitahara, T. Loss of Skin Elasticity Precedes to Rapid Increase of Wrinkle Levels. J. Dermatol. Sci. 2007, 47, 233–239. [Google Scholar] [CrossRef]
- Leyden, J.J. Clinical Features of Ageing Skin. Br. J. Dermatol. 1990, 122, 1–3. [Google Scholar] [CrossRef]
- Rawlings, A.V.; Harding, C.R. Moisturization and Skin Barrier Function. Dermatol. Ther. 2004, 17, 43–48. [Google Scholar] [CrossRef] [PubMed]
- Helfrich, Y.R.; Sachs, D.L.; Voorhees, J.J. Overview of Skin Aging and Photoaging. Dermatol. Nurs. 2008, 20, 177–183. [Google Scholar]
- Kosmadaki, M.G.; Gilchrest, B.A. The Role of Telomeres in Skin Aging/Photoaging. Micron 2004, 35, 155–159. [Google Scholar] [CrossRef]
- Blasco, M.A. Telomere Length, Stem Cells and Aging. Nat. Chem. Biol. 2007, 3, 640–649. [Google Scholar] [CrossRef]
- Gilchrest, B.A.; Eller, M.S.; Yaar, M. Telomere-Mediated Effects on Melanogenesis and Skin Aging. J. Investig. Dermatol. Symp. Proc. 2009, 14, 25–31. [Google Scholar] [CrossRef] [Green Version]
- Li, Z.; Bai, X.; Peng, T.; Yi, X.; Luo, L.; Yang, J.; Liu, J.; Wang, Y.; He, T.; Wang, X. New Insights into the Skin Microbial Communities and Skin Aging. Front. Microbiol. 2020, 11, 2603. [Google Scholar] [CrossRef] [PubMed]
- Zapata, H.J.; Quagliarello, V.J. The Microbiota and Microbiome in Aging: Potential Implications in Health and Age-related Diseases. J. Am. Geriatr. Soc. 2015, 63, 776–781. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shibagaki, N.; Suda, W.; Clavaud, C.; Bastien, P.; Takayasu, L.; Iioka, E.; Kurokawa, R.; Yamashita, N.; Hattori, Y.; Shindo, C. Aging-Related Changes in the Diversity of Women’s Skin Microbiomes Associated with Oral Bacteria. Sci. Rep. 2017, 7, 10567. [Google Scholar] [CrossRef]
- Glady, A.; Vandebroek, A.; Yasui, M. Human Keratinocyte-Derived Extracellular Vesicles Activate the MAPKinase Pathway and Promote Cell Migration and Proliferation in Vitro. Inflamm. Regen. 2021, 41, 4. [Google Scholar] [CrossRef] [PubMed]
Primer | Primer Sequence | Tm (°C) | |
---|---|---|---|
Actin | Forward | 5′—CATGAAGTGTGACGTGGACA—3′ | 58 °C |
Reverse | 5′—CAGGGCAGTGATCTCCTTCT—3′ | ||
COL1A1 | Forward | 5′—GACCTCAAGATGTGCCACTC—3′ | 58 °C |
Reverse | 5′—CCAGTCTCCATGTTGCAGAA—3′ | ||
MMP-1 | Forward | 5′—CCCAGCGACTCTAGAAACAC—3′ | 58 °C |
Reverse | 5′—GCCTCCCATCATTCTTCAGG—3′ | ||
Filaggrin | Forward | 5′—GCTGAAGGAACTTCTGGAAAAG—3′ | 62 °C |
Reverse | 5′—GCCAACTTGAATACCATCAGAAG—3 |
Subjects of Clinical Trials (IRB Number: KDRI-IRB-20936) * | |||
---|---|---|---|
Gender | Age | Average Age | |
Female | 40’s | 50’s | Age 50 |
n = 6 | n = 10 | ||
Total n = 16 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jo, C.S.; Myung, C.H.; Yoon, Y.C.; Ahn, B.H.; Min, J.W.; Seo, W.S.; Lee, D.H.; Kang, H.C.; Heo, Y.H.; Choi, H.; et al. The Effect of Lactobacillus plantarum Extracellular Vesicles from Korean Women in Their 20s on Skin Aging. Curr. Issues Mol. Biol. 2022, 44, 526-540. https://doi.org/10.3390/cimb44020036
Jo CS, Myung CH, Yoon YC, Ahn BH, Min JW, Seo WS, Lee DH, Kang HC, Heo YH, Choi H, et al. The Effect of Lactobacillus plantarum Extracellular Vesicles from Korean Women in Their 20s on Skin Aging. Current Issues in Molecular Biology. 2022; 44(2):526-540. https://doi.org/10.3390/cimb44020036
Chicago/Turabian StyleJo, Chan Song, Cheol Hwan Myung, Yeo Cho Yoon, Beom Hee Ahn, Jin Woo Min, Won Sang Seo, Dong Hwan Lee, Hee Cheol Kang, Yun Hoe Heo, Hyeong Choi, and et al. 2022. "The Effect of Lactobacillus plantarum Extracellular Vesicles from Korean Women in Their 20s on Skin Aging" Current Issues in Molecular Biology 44, no. 2: 526-540. https://doi.org/10.3390/cimb44020036
APA StyleJo, C. S., Myung, C. H., Yoon, Y. C., Ahn, B. H., Min, J. W., Seo, W. S., Lee, D. H., Kang, H. C., Heo, Y. H., Choi, H., Hong, I. K., & Hwang, J. S. (2022). The Effect of Lactobacillus plantarum Extracellular Vesicles from Korean Women in Their 20s on Skin Aging. Current Issues in Molecular Biology, 44(2), 526-540. https://doi.org/10.3390/cimb44020036