Detection of Mutations in pncA in Mycobacterium tuberculosis Clinical Isolates from Nepal in Association with Pyrazinamide Resistance
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and Study Sample
2.2. Drug Susceptibility Testing (DST)
2.3. DNA Extraction
2.4. Spoligotyping
2.5. PCR Amplification and DNA Sequencing
2.6. SUSPECT-PZA
2.7. Statistical Analysis
3. Results
3.1. MTB Genotypes and Drug Resistance Patterns
3.2. pncA Mutation Profile
3.3. Association of pncA Mutations with rpoB, katG, inhA, gyrA, gyrB, and rrs Mutations
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization. Global Tuberculosis Report 2020. Available online: https://apps.who.int/iris/bitstream/handle/10665/336069/9789240013131-eng.pdf (accessed on 10 December 2020).
- National Tuberculosis Center, Nepal. National Tuberculosis Program Nepal Annual Report 2074/75. 2018. Available online: https://nepalntp.gov.np/wp-content/uploads/2019/03/NTP-Annual-Report-2074-75-Up.pdf (accessed on 10 August 2020).
- Whitfield, M.G.; Soeters, H.M.; Warren, R.M.; York, T.; Sampson, S.L.; Streicher, E.M.; van Helden, P.D.; van Rie, A. A global perspective on pyrazinamide resistance: Systematic review and meta-analysis. PLoS ONE 2015, 10, e0133869. [Google Scholar] [CrossRef]
- Chedore, P.; Bertucci, L.; Wolfe, J.; Sharma, M.; Jamieson, F. Potential for erroneous results indicating resistance when using the Bactec MGIT 960 system for testing susceptibility of Mycobacterium tuberculosis to pyrazinamide. J. Clin. Microbiol. 2010, 48, 300–301. [Google Scholar] [CrossRef] [PubMed]
- Simons, S.O.; van Ingen, J.; van der Laan, T.; Mulder, A.; Dekhuijzen, P.N.R.; Boeree, M.J.; van Soolingen, D. Validation of pncA gene sequencing in combination with the Mycobacterial Growth Indicator Tube method to test susceptibility of Mycobacterium tuberculosis to pyrazinamide. J. Clin. Microbiol. 2012, 50, 428–434. [Google Scholar] [CrossRef] [PubMed]
- Sreevatsan, S.; Pan, X.I.; Zhang, Y.; Kreiswirth, B.N.; Musser, J.M. Mutations associated with pyrazinamide resistance in pncA of Mycobacterium tuberculosis complex organisms. Antimicrob. Agents Chemother. 1997, 41, 636–640. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, V.D.F.S.; Telles, M.A.; Ribeiro, M.O.; Cafrune, P.I.; Rossetti, M.L.R.; Zaha, A. Characterization of pncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis in Brazil. Antimicrob. Agents Chemother. 2005, 49, 444–446. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Mitchison, D. The curious characteristics of pyrazinamide: A review. Int. J. Tuberc. Lung Dis. 2003, 7, 6–21. [Google Scholar]
- Jonmalung, J.; Prammananan, T.; Leechawengwongs, M.; Chaiprasert, A. Surveillance of pyrazinamide susceptibility among multidrug-resistant Mycobacterium tuberculosis isolates from Siriraj Hospital, Thailand. BMC Microbiol. 2010, 10, 223. [Google Scholar] [CrossRef]
- Ramirez-Busby, S.M.; Valafar, F. Systematic review of mutations in pyrazinamidase associated with pyrazinamide resistance in Mycobacterium tuberculosis clinical isolates. Antimicrob. Agents Chemother. 2015, 59, 5267–5277. [Google Scholar] [CrossRef]
- Hameed, H.A.; Tan, Y.; Islam, M.; Lu, Z.; Chhotaray, C.; Wang, S.; Liu, Z.; Fang, C.; Tan, S.; Yew, W.W.; et al. Detection of novel gene mutations associated with pyrazinamide resistance in multidrug-resistant Mycobacterium tuberculosis clinical isolates in Southern China. Infect. Drug Resist. 2020, 13, 217–227. [Google Scholar] [CrossRef]
- World Health Organization. Guidelines for surveillance of drug resistance in tuberculosis. Int. J. Tuberc. Lung. Dis. 1998, 2, 72–89. [Google Scholar]
- Kamerbeek, J.; Schouls, L.; Kolk, A.; van Agterveld, M.; van Soolingen, D.; Kuijper, S.; Bunschoten, A.; Molhuizen, H.; Shaw, R.; Goyal, M.; et al. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J. Clin. Microbiol. 1997, 35, 907–914. [Google Scholar] [CrossRef] [PubMed]
- Poudel, A.; Nakajima, C.; Fukushima, Y.; Suzuki, H.; Pandey, B.D.; Maharjan, B.; Suzuki, Y. Molecular characterization of multidrug-resistant Mycobacterium tuberculosis Isolated in Nepal. Antimicrob. Agents Chemother. 2012, 56, 2831–2836. [Google Scholar] [CrossRef] [Green Version]
- Bwalya, P.; Yamaguchi, T.; Mulundu, G.; Nakajima, C.; Mbulo, G.; Solo, E.S.; Fukushima, Y.; Kasakwa, K.; Suzuki, Y. Genotypic characterization of pyrazinamide resistance in Mycobacterium tuberculosis isolated from Lusaka, Zambia. Tuberculosis 2018, 109, 117–122. [Google Scholar] [CrossRef] [PubMed]
- Shrestha, D.; Maharjan, B.; Oo, N.A.T.; Isoda, N.; Nakajima, C.; Suzuki, Y. Molecular analysis of streptomycin-resistance associating genes in Mycobacterium tuberculosis isolates from Nepal. Tuberculosis 2020, 125, 101985. [Google Scholar] [CrossRef]
- Karmakar, M.; Rodrigues, C.H.M.; Horan, K.; Denholm, J.T.; Ascher, D.B. Structure guided prediction of pyrazinamide resistance mutations in pncA. Sci. Rep. 2020, 10, 1875. [Google Scholar] [CrossRef]
- Lemaitre, N.; Sougakoff, W.; Truffot-Pernot, C.; Jarlier, V. Characterization of new mutations in pyrazinamide-resistant strains of Mycobacterium tuberculosis and identification of conserved regions important for the catalytic activity of the pyrazinamidase PncA. Antimicrob. Agents Chemother. 1999, 43, 1761–1763. [Google Scholar] [CrossRef]
- Rahman, A.; Ferdous, S.S.; Ahmed, S.; Rahman, S.M.M.; Uddin, M.K.M.; Pholwat, S.; Gratz, J.; Houpt, E.; Banu, S. Pyrazinamide susceptibility and pncA mutation profiles of Mycobacterium tuberculosis among multidrug-resistant tuberculosis patients in Bangladesh. Antimicrob. Agents Chemother. 2017, 61, e00511-17. [Google Scholar] [CrossRef] [PubMed]
- Shenai, S.; Rodrigues, C.; Sadani, M.; Sukhadia, N.; Mehta, A. Comparison of phenotypic and genotypic methods for pyrazinamide susceptibility testing. Indian J. Tuberc. 2009, 56, 82–90. [Google Scholar] [PubMed]
- Aono, A.; Chikamatsu, K.; Yamada, H.; Kato, T.; Mitarai, S. Association between pncA gene mutations, pyrazinamidase activity, and pyrazinamide susceptibility testing in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 2014, 58, 4928–4930. [Google Scholar] [CrossRef]
- Shine, J.; Dalgarno, L. Terminal-sequence analysis of bacterial ribosomal RNA. Correlation between the 3′-terminal-polypyrimidine sequence of 16-S RNA and translational specificity of the ribosome. Eur. J. Biochem. 1975, 57, 221–230. [Google Scholar] [CrossRef]
- Sheen, P.; Lozano, K.; Gilman, R.H.; Valencia, H.J.; Loli, S.; Fuentes, P.; Grandjean, L.; Zimic, M. pncA gene expression and prediction factors on pyrazinamide resistance in Mycobacterium tuberculosis. Tuberculosis 2013, 93, 515–522. [Google Scholar] [CrossRef] [PubMed]
- Ando, H.; Mitarai, S.; Kondo, Y.; Suetake, T.; Sekiguchi, J.-I.; Kato, S.; Mori, T.; Kirikae, T. Pyrazinamide resistance in multidrug-resistant Mycobacterium tuberculosis isolates in Japan. Clin. Microbiol. Infect. 2010, 16, 1164–1168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Suzuki, Y.; Suzuki, A.; Tamaru, A.; Katsukawa, C.; Oda, H. Rapid detection of pyrazinamide-resistant Mycobacterium tuberculosis by a PCR-based in vitro system. J. Clin. Microbiol. 2002, 40, 501–507. [Google Scholar] [CrossRef] [PubMed]
- Xia, Q.; Zhao, L.-L.; Li, F.; Fan, Y.-M.; Chen, Y.-Y.; Wu, B.-B.; Liu, Z.-W.; Pan, A.-Z.; Zhu, M. Phenotypic and genotypic characterization of pyrazinamide resistance among multidrug-resistant Mycobacterium tuberculosis isolates in Zhejiang, China. Antimicrob. Agents Chemother. 2015, 59, 1690–1695. [Google Scholar] [CrossRef] [PubMed]
- Pang, Y.; Zhu, D.; Zheng, H.; Shen, J.; Hu, Y.; Liu, J.; Zhao, Y. Prevalence and molecular characterization of pyrazinamide resistance among multidrug-resistant Mycobacterium tuberculosis isolates from Southern China. BMC Infect. Dis. 2017, 17, 711. [Google Scholar] [CrossRef] [PubMed]
- Yadon, A.N.; Maharaj, K.; Adamson, J.H.; Lai, Y.-P.; Sacchettini, J.C.; Ioerger, T.R.; Rubin, E.J.; Pym, A.S. A comprehensive characterization of PncA polymorphisms that confer resistance to pyrazinamide. Nat. Commun. 2017, 8, 588. [Google Scholar] [CrossRef]
- Hirano, K.; Takahashi, M.; Kazumi, Y.; Fukasawa, Y.; Abe, C. Mutation in pncA is a major mechanism of pyrazinamide resistance in Mycobacterium tuberculosis. Tuber. Lung Dis. 1997, 78, 117–122. [Google Scholar] [CrossRef]
- Denkin, S.; Volokhov, D.; Chizhikov, V.; Zhang, Y. Microarray-based pncA genotyping of pyrazinamide-resistant strains of Mycobacterium tuberculosis. J. Med. Microbiol. 2005, 54, 1127–1131. [Google Scholar] [CrossRef]
- Allana, S.; Shashkina, E.; Mathema, B.; Bablishvili, N.; Tukvadze, N.; Shah, N.S.; Kempker, R.R.; Blumberg, H.M.; Moodley, P.; Mlisana, K.; et al. pncA gene mutations associated with pyrazinamide resistance in drug-resistant tuberculosis, South Africa and georgia. Emerg. Infect. Dis. 2017, 23, 491–495. [Google Scholar] [CrossRef]
- Miotto, P.; Cabibbe, A.M.; Feuerriegel, S.; Casali, N.; Drobniewski, F.; Rodionova, Y.; Bakonyte, D.; Stakenas, P.; Pimkina, E.; Augustynowicz-Kopeć, E.; et al. Mycobacterium tuberculosis pyrazinamide resistance determinants: A multicenter study. mBio 2014, 5, e01819-14. [Google Scholar] [CrossRef]
- Sheen, P.; Requena, D.; Gushiken, E.; Gilman, R.H.; Antiparra, R.; Lucero, B.; Lizárraga, P.; Cieza, B.; Roncal, E.; Grandjean, L.; et al. A multiple genome analysis of Mycobacterium tuberculosis reveals specific novel genes and mutations associated with pyrazinamide resistance. BMC Genom. 2017, 18, 769. [Google Scholar] [CrossRef] [PubMed]
- Tan, Y.; Hu, Z.; Zhang, T.; Cai, X.; Kuang, H.; Liu, Y.; Chen, J.; Yang, F.; Zhang, K.; Tan, S.; et al. Role of pncA and rpsA gene sequencing in detection of pyrazinamide resistance in Mycobacterium tuberculosis Isolates from Southern China. J. Clin. Microbiol. 2014, 52, 291–297. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Locus | Primers | Nucleotide Sequence (5′-3′) | Product Size (bp) |
---|---|---|---|
rpoB | ON-513 (Forward) ON-914 (Reverse) | CAGGACGTGGAGGCGATCAC GAGCCGATCAGACCGATGTTGG | 278 bp |
katG | ON-114 (Forward) ON-103R (Reverse) | ATGGCCATGAACGACGTCGAAAC CGCAGCGAGAGGTCAGTGGCCAG | 392 bp |
inhA | ON-097 (Forward) ON-098 (Reverse) | TCACACCGACAAACGTCACGAGC AGCCAGCCGCTGTGCGATCGCCA | 231 bp |
gyrA | ON-747 (Forward) ON-748 (Reverse) | AGCGCAGCTACATCGACTATGCG CTTCGGTGTACCTCATCGCCGCC | 321 bp |
rrs | ON-1066 (Forward) ON-1067 (Reverse) | CGGATCGGGGTCTGCAACTCGAC CAAGAACCCCTCACGGCCTACG | 299 bp |
pncA | ON-1464 (Forward) ON-1465 (Reverse) | GCACCAAGGCCGCGATGACAC CGCGCGTCACCGGTGAACAACC | 561 bp |
direct repeat region | DRa (Forward) DR-R (Reverse) | GGTTTTGGGTCTGACGAC CCGAGAGGGGACGGAAAC | Varios |
Types of Mutations | No. of Mutation Types | No. of Isolates |
---|---|---|
Nucleotide substitution | 45 | 109 |
URR | 2 | 3 |
Amino acid substitution | 39 | 66 |
Termination | 2 | 2 |
Silent mutation | 2 | 38 |
Nucleotide deletion | 4 | 4 |
Nucleotide insertion | 6 | 6 |
URR | 1 | 1 |
Putative region | 5 | 5 |
Nucleotide substitution + deletion | 1 | 2 |
No amplification | 1 | 4 |
Total | 54 | 125 |
Lineages | Pan-Susceptible | Mono-Resistant | MDR | Pre-XDR | Total |
---|---|---|---|---|---|
1 | 3 | 0 | 8 | 2 | 13 |
2 | 12 | 3 | 62 | 36 | 113 |
3 | 19 | 2 | 23 | 12 | 56 |
4 | 7 | 0 | 15 | 7 | 29 |
Total | 41 | 5 | 108 | 57 | 211 |
Genotype | Pan-Susceptible/ Mono-Resistant | MDR | Pre-XDR | Total |
---|---|---|---|---|
Alteration in pncA and its URR | 1 | 48 | 38 | 87 |
WT | 45 | 60 | 19 | 124 |
Total | 46 | 108 | 57 | 211 |
Mutation Patterns | Lineages | Total | |||
---|---|---|---|---|---|
1 | 2 | 3 | 4 | ||
Mutations in pncA and its URR | 7 | 47 | 15 | 18 | 87 |
WT | 6 | 66 | 41 | 11 | 124 |
Total | 13 | 113 | 56 | 29 | 211 |
Mutation Patterns | No. of Isolates | Odds Ratio, 95% CI | p-Value | |
---|---|---|---|---|
With pncA Mutations | Without pncA Mutations | |||
rpoB or katG or inhA mutation | 45 | 48 | 3.75 (0.9 to 14.1) | 0.05 |
None in above | 3 | 12 | ||
gyrA or gyrB or rrs mutation | 34 | 10 | 7.65 (1.9 to 30.18) | 0.003 |
None in above | 4 | 9 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shrestha, D.; Maharjan, B.; Thapa, J.; Akapelwa, M.L.; Bwalya, P.; Chizimu, J.Y.; Nakajima, C.; Suzuki, Y. Detection of Mutations in pncA in Mycobacterium tuberculosis Clinical Isolates from Nepal in Association with Pyrazinamide Resistance. Curr. Issues Mol. Biol. 2022, 44, 4132-4141. https://doi.org/10.3390/cimb44090283
Shrestha D, Maharjan B, Thapa J, Akapelwa ML, Bwalya P, Chizimu JY, Nakajima C, Suzuki Y. Detection of Mutations in pncA in Mycobacterium tuberculosis Clinical Isolates from Nepal in Association with Pyrazinamide Resistance. Current Issues in Molecular Biology. 2022; 44(9):4132-4141. https://doi.org/10.3390/cimb44090283
Chicago/Turabian StyleShrestha, Dipti, Bhagwan Maharjan, Jeewan Thapa, Mwangala Lonah Akapelwa, Precious Bwalya, Joseph Yamweka Chizimu, Chie Nakajima, and Yasuhiko Suzuki. 2022. "Detection of Mutations in pncA in Mycobacterium tuberculosis Clinical Isolates from Nepal in Association with Pyrazinamide Resistance" Current Issues in Molecular Biology 44, no. 9: 4132-4141. https://doi.org/10.3390/cimb44090283