1. Introduction
Glycosylation, a complex co- and post-translational protein modification, is critical in the development and maintenance of an organism. There are three basic types of N-glycans—oligomannose, hybrid, and complex—each of which share a common pentasaccharide core and are processed sequentially [
1]. The various N-glycans result from the addition of different branch points via the action of N-acetylglucosaminyltransferases (GnTs, encoded by
MGAT genes). The conversion of oligomannose-type
N-glycans to the hybrid type is initiated via GnT-I (encoded by
MGAT1), and the hybrid type is further processed to the complex type via GnT-II (encoded by
MGAT2) [
1]. The consequences of aberrant N-glycosylation processing are well noted in the congenital disorders of glycosylation (CDG), an ever-growing disease family that encompasses almost every organ system and often results in neurological complications [
2,
3].
The magnitude of N-glycan processing in organismal survival and development is well noted in past studies which show that the conditional inactivation of
Mgat1 in neuronal tissue of mice causes severe neurological defects and early post-natal death at about embryonic day E13 [
4], while global
Mgat1 knockout mice did not survive beyond E10.5 due to maldevelopment of their neural tubes [
5]. Interestingly, although complex N-glycans were observed pre-implantation at around E3.5 in
Mgat1 null embryos, these levels declined by E7.5, thus attributing the earlier levels to maternal derivation and further emphasizing the criticality of complex N-glycans in post-implantation development [
6]. Thus, these studies support the importance of complex-type N-glycans in the neurological development of mice. Moreover, expanding the glycan studies to zebrafish is ideal since they have two
Mgat1 genes (
Mgat1a and
1b), instead of a single
Mgat1 gene like mice, thus allowing for an examination of how lowered levels of GnT-I activity affect development and survival, minus the lethality associated with mice.
The glycome of zebrafish (
Danio rerio) is quite diverse, and all of the three N-glycan types are present as early as 6 h postfertilization (hpf), with an abundance of oligomannose-type N-glycans [
7]. Although complex-type N-glycans are found in smaller amounts, a sharp increase in levels is noted in the segmentation to the pharyngula period (10–48 hpf) of embryonic development [
7]. In adult zebrafish, although the proportion of complex- to oligomannose-type N-glycans varies among specific organs, most of the brain regions revealed a higher population of complex-relative to oligomannose-type N-glycans [
8]. Further, complex N-glycans found in the brain of adults were found to have the highest percentage of core fucose and highest overall sialyation pattern relative to other organs [
8]. It should also be noted that zebrafish, unlike mice and humans, have two genes (
Mgat1a/b) that encode GnTIa/b [
9]. Thus, the inactivation of one of the
Mgat1 genes will likely result in lowered GnTI activities and thereby decrease the amount of complex-type N-glycans.
Zebrafish is a model organism for vertebrate development due to the rapid progression of developmental stages. Zebrafish development is initiated with a single cell, the zygote period, and progresses to the blastula stage within 3 hpf [
10]. It is during the blastula phase when the embryo undergoes several important events, including the start of epiboly, a process of coordinated cell movement critical for body formation [
10]. Epiboly continues into gastrulation, during which the yolk is gradually internalized as cells continue to form. This is carried out through the thinning and spreading of the ectodermal layers while the endoderm layers move towards the inside of the embryo [
11]. The portion of the yolk cell that is covered by the blastoderm is referred to as percent epiboly, with 75% epiboly occurring at around 8 hpf and 100% epiboly occurring around at 10.5 hpf [
10]. During the segmentation phase (10–24 hpf), somites begin to form along with neural keel and neural crest migration. It is during the pharyngula stage (24–48 hpf) when the circulatory system is formed, and a heartbeat is initiated at the onset of this stage [
10]. Therefore, by silencing one of the
Mgat1 genes, the development of embryos can be monitored and compared with that in mice with conditional and global
Mgat1 knockouts.
The objective of this study was to create a Mgat1b mutant fish strain, (Mgat1b−/−), and to examine the impact of higher levels of oligomannose and less complex N-glycans in the survival and development of Mgat1b−/− relative to Wt AB zebrafish. Survivability and developmental studies revealed that a reduction in complex-type N-glycans perturbs survivability and development. Embryonic developmental staging implicated disruptions of the brain anlagen, the precursor for brain formation, in the lower survivability of zebrafish with silenced Mgat1b. Further, delayed skeletal muscle development coincides with a diminished amount of complex N-glycans, along with a reduction in motor and sensory functions. Likewise, cardiac muscle development is impeded in Mgat1b−/−. Taken together, the results of this study imply that a reduction in the amount of complex-type N-glycans is unfavorable in the survival and development of zebrafish.
2. Materials and Methods
2.1. Animal Husbandry, Staging, and Larva and Embryo Collections
All Zebrafish procedures were approved by the Institutional Animal Care & Use Committee (IACUC) of East Carolina University. The utilized adult wildtype Pseudoloma-free AB strain (Wt AB) was purchased from Sinnhuber Aquatic Research Laboratory (SARL), propagated at ECU, and utilized for the creation of mutant zebrafish with genetic editing of the
Mgat1b gene. All zebrafish were maintained at 28 °C on a light/dark cycle of 14 h on and 10 h off in a Pseudoloma-free lab. Embryos collected from natural spawns were transferred to 100 × 15 mm Petri dishes containing egg water (5.03 mM NaCL, 0.17 mM KCl, 0.33 mM CaCl
2•2H
2O, 0.33 mM MgSO
4 •7H
2O, and 0.05% methylene in 1 L system water) and developed in an incubator set at 28 °C. Embryos were staged based on morphological criteria and time post-fertilization as described by Kimel et al., 1995 [
10]. Fish older than 96 h of age were fed a high-protein diet of Gemma Micro pellets (Skretting, Tooele, UT, USA) every morning and afternoon. Larvae (6 dpf and 24 dpf) and adult fish were euthanized using an ice slurry bath for 10 min prior to glycoprotein or RNA analysis. All experiments using live zebrafish were performed at 28 °C.
The CHOPCHOP program was employed to identify a guide RNA (gRNA) target sequence (ggccggtgaag
tgatcagat) in zebrafish
Mgat1b (accession number: NM_001079971), along with forward (gccatggttcgcaagaaagg) and reverse (ccaattctggtcattgcctg) primers for amplification of the fragment of interest [
12,
13,
14]. The target sequence has a BclI site which is shown in red font. The restriction sequence was selected to identify edited genomic DNA in the target sequence of an individual fish. Oligonucleotides were purchased from Thermofisher, Waltham, MA, USA. The gRNA target sequence also included a T7 promoter sequence added to the 5′ end and a 14 nucleotide overlap sequence added to the 3′ end for use of the EnGen
® sgRNA Synthesis Kit,
S. pyogenes (New England Biolabs, Ipswich, MA, USA). The transcribed nucleotide was purified using Monarch
® Kits for RNA Cleanup (New England Biolabs, Ipswich, MA, USA).
2.2. Genotyping of Embryos, Larvae, and Adult Fish
After collection of embryos, larvae, or a small portion of the adult fish tail, genomic DNA was extracted by incubating embryos in 50 mM NaOH at 99 °C for 20 min. The NaOH solution containing genomic DNA was used directly for PCR. PCR forward (gccatggttcgcaagaaagg) and reverse (ccaattctggtcattgcctg) primers were designed around the gRNA target and used to amplify the target region. PCR conditions: Initial denaturation for 2 min at 94 °C; 32 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, elongation at 72 °C for 30 s, then a final step at 70 °C for 10 min. Gene editing of the fragment was then identified by restriction enzyme (RE) digest reaction, followed by separation of band(s) on an agarose gel. The presence of an undigested band indicated that the DNA was edited for at least one of the Mgat1b alleles.
2.3. Generating the Mgat1b−/− Mutant Line
Single-cell embryos were microinjected with an about 500-picoliter mixture solution containing 100 ng/µL of sgRNA and 360 pg/µL of EnGen Spy Cas9 NLS ®. Microinjection was driven by compressed N2 gas under the control of a PV820 Pneumatic PicoPump (World Precision Instruments, Sarasota, FL, USA), accomplished using a microcapillary pipette attached to a micromanipulator, under a Nikon microscope (Tokyo, Japan). About thirty microinjected embryos (F0) were collected for estimating gRNA efficiency at 24 h post-fertilization (hpf) via genotyping. If pooled F0 embryos had undigested bands after treatment with the restriction enzyme BclI (Thermofisher, Waltham, MA, USA), then Cas9 successfully cut the targeted region and the cell incorrectly repaired the damage, destroying the BclI site and possibly creating a frameshift mutation. The remaining microinjected F0 embryos were raised to adulthood and then checked for gene editing via fin clipping and restriction enzyme (RE) digest. Adult F0 fish had their DNA sequenced to verify a frameshift, and then, they were outcrossed with Wt AB. F1 embryos were screened for gene editing, and furthermore, mutations were confirmed by DNA sequencing. Notably, the mutation (Δ5) was identical in F0 and F1 adult fish. Fish that were heterozygous for the same mutation were paired for spawning. F2 and embryos from subsequent generations, e.g., F3, were collected and grown into adulthood, when they were screened by RE digestion.
2.4. Brain Dissections
Adult zebrafish were euthanized via an ice slurry bath for 10 min following operculum movement cessation in accordance with IACUC protocols. Euthanized fish were placed on a Sylgard (Sigma Aldrich, St. Louis, MO, USA)-coated 100 mm dish. Dissection pins were inserted through the mouth and extended through the ventral side of the fish to affix fish to the dish. Spring scissors were used to cut from the upper lip through the cranium, revealing the brain. Next, two perpendicular incisions were made behind the gills, running dorsal to ventral, starting at the initial cut. The optic nerves and brain stem were severed using spring scissors, and the brain was extracted with forceps. Dissected brains were placed in cryotubes, flash frozen in liquid nitrogen, and stored at −80 °C until ready for use.
2.5. Total Brain Membrane Preparations and Larval Homogenate
Total membranes of ten pooled adult zebrafish brains were isolated via ultracentrifugation, as previously described [
15]. Total membrane samples for glycan analysis were resuspended in 10 mM Tris, pH 7.4; 250 mM sucrose, 5 mM EDTA; protease inhibitor cocktail set III (Calbiochem, San Diego, CA, USA). All samples were stored at −80 °C until needed. Wt AB and
Mgat1b−/− larval zebrafish were pooled and collected for protein. About 90 larvae (6 dpf and 24 dpf) were resuspended in RIPA buffer (PBS, 1% Triton X-100, 0.5% sodium deoxycholate, and 0.1% SDS) plus protease inhibitor cocktail set III (EMD Biosciences, San Diego, CA, USA), followed by the addition of an SDS-PAGE sample buffer containing 200 mM DTT to reduce and denature the samples for lectin blotting and Coomassie blue staining.
2.6. Lectin Blots and Coomassie Blue-Stained Gels
The evaluation of total membrane proteins and larval homogenate was performed via Coomassie staining and lectin blotting. In brief, proteins were allowed to migrate on 10% SDS gels at 20 mA followed by incubation with Coomassie
® Brilliant Blue (MP Biomedical, Solon, OH), or transferred to nitrocellulose membranes (Whatman, Dassel, Germany) at 250 mA for lectin blotting, as previously described [
15]. Transferred proteins were probed with biotin-conjugated E-PHA or GNL lectins (10 µg/mL; Vector Laboratories, Burlingame, CA, USA).
2.7. RNA Extraction
Approximately 95 larval zebrafish were collected in a microcentrifuge tube placed in an ice slurry and resuspended in TRIzol ® (Invitrogen, Carlsbad, CA, USA) and homogenized until sufficiently disrupted. Homogenized samples were allowed to sit at room temperature for five minutes to complete dissociation of samples, followed by the addition of chloroform. Samples were centrifuged at 12,000× g for 5 min at 4 °C. The upper aqueous phase was collected, RNA was precipitated via the addition of isopropanol, and the RNA pellet was washed with ethanol. Total RNA was resuspended in RNAse-free water. Total RNA cleanup was performed using the RNeasy mini kit (Qiagen, Hilden, Germany) per the manufacturer’s protocol. The RNA quality and quantity was assayed using a NanoDrop 1000 (ThermoFisher Scientific, Waltham, MA, USA).
2.8. RT-PCR
A total of 1 µg of RNA in a 20 µL reaction was reverse-transcribed utilizing the iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA) according to manufacturer’s instructions. Quantitative real-time PCR was performed with a CFX96 Touch Real-Time PCR Detection System using IQ™SYBR Green SuperMix (Bio-Rad Laboratories, Hercules, CA, USA) and primers from ThermoFisher Scientific, Waltham, MA, USA. Primers for amplification were designed so the products would span at least one intron using Primer-Blast [
16], except those for elfα [
17]; see
Table S1 for sequences. The amplification of a single product was confirmed via agarose gel visualization and/or melting curve analysis for all primer sets; see
Figure S3. mRNA was quantified via ΔΔCT analysis using housekeeping genes β-actin and ELFα for normalization.
2.9. N-Glycan Analysis
Total membrane protein fractions from the brain of Wt AB and
Mgat1b−/− adult zebrafish were diluted with 100 µL of 50 mM ammonium bicarbonate buffer, followed by the addition of 25 µL of 25 mM Dithiothreitol (DTT) and incubated at 50 °C for 30 min [
18]. The samples were subsequently desalted by centrifugal filtration using 10 k Amicon centrifuge filters (MilliporeSigma, Burlington, MA, USA, Cat. No. UFC501096) and then ultrasonicated to dissolve the proteins. The N-glycans were released from the samples by adding 5 µL of PNGaseF (New England Biolabs, Ipswich, MA, USA, Cat. No. P0709L) and incubating at 37 °C for 48 h. The released N-glycans were permethylated by using methyl iodide in the presence of NaOH-DMSO base. The permethylation reaction was quenched by the addition of water, and the permethylated N-glycans were extracted with dichloromethane. The dichloromethane layer was washed with water four times and evaporated to dryness by nitrogen gas, and the permethylated N-glycans were mixed in a 1:1 methanol–water (plus 1 mM NaOH) mixture for the LC-ESI-MS/MS analysis. Samples were analyzed on an Orbitrap Fusion Tribrid mass spectrometer equipped with a nanospray ion source and connected to a nanoLC system (Thermo Ultimate 3000). A nano-LC column 15 cm in length with 75 µm internal diameter filled with 3 µm C18 material (reverse phase) was used for chromatographic separation of the glycans. LC-ESI-MS/MS runs were performed for 72 min gradients using a sodiated buffer system (Buffer A: 1 mM NaOAc in H
2O; Buffer B: 80% ACN, 0.1% formic acid, and 1 mM NaOAc). A precursor ion scan was acquired at 120,000 resolution in the Orbitrap analyzer, and precursors at a time frame of 3 s were selected for subsequent MS/MS fragmentation in the Orbitrap analyzer at 15,000 resolution. MS/MS fragmentation was conducted with fixed CID (collision energy 40%) using a data-dependent scan (DDS) program, which performs an MS/MS acquisition for the most abundant ions in the MS spectrum. Precursors with an unknown charge state or a charge state of +1 were excluded, and dynamic exclusion was enabled (30 s duration). LC-MS/MS data were analyzed using Thermo Xcalibur 4.2, Thermo FreeStyle 1.8 SP2, and GlycoWorkBench 2.1 software. The area under the curve of different charge states of each N-glycan peak were extracted from the LC-MS chromatogram and added, and the relative percentages of individual N-glycans were calculated.
2.10. Tactile-Evoked Escape Response
A touch-evoked escape response assay was performed with embryos and larvae at 2 and 3 dpf, respectively, (fish that appeared maldeveloped were not used) from male and female crossed using Wt AB or Mgat1b−/−. Two dpf fish were manually dechorionated using needles, as needed. After at least 1 h, 15 larvae were put in a 100 mm dish with egg water and allowed to acclimate on a stereoscope for 10 min. A tactile stimulus was administered by a gentle tap with a P10 micropipette tip to the tail of the larvae. The escape behavior was scored according to the number of taps it took to get the larvae to swim away (response). All-points histograms were used to show the total number of larvae that responded to 1-9 taps and ≥10 taps. The mean ± S.D. was also determined from the total number of larvae tested for both groups and 2 and 3 dpf.
2.11. Vibrational Startle Response
Wt AB and Mgat1b−/− zebrafish larvae (10 dpf) were placed individually into a well of a 6-well plate containing roughly 4 mL of system water and then placed in the chamber of the Zantiks MWP unit. An acclimation period of 5 min was followed by a 20 s tracking period to locate the fish. Pre-startle activity was then logged for 10 s, followed by a 1 s vibration. The machine then tracked post-startle for 20 more seconds. The vibration and post-startle were repeated 2 more times, with the combined startle activity averaged.
2.12. Swimming Locomotor Activity
Wt AB and the Mgat1b homozygous mutant were maintained in 100 mm dishes containing egg water at 28 °C until 5 dpf, at which point the larvae (≥12) were housed in a 250 mL beaker containing a mixture of egg water and system water. The ratio of egg water to system water was adjusted incrementally as follows: 5 dpf (75:25), 6 dpf (50:50), 7 dpf (25:75), and ≥8 dpf (0:100). At 14 dpf, the larvae were transferred to a 1.8 L tank containing system water. For motor activity recordings, a single fish was placed in one well of a six-well plate containing 11 mL of egg water. The plate was transferred to the MWP unit (Zantiks, Cambridge, UK), and the fish was allowed to acclimate for 5 min. The motor activity of the larvae was tracked for five minutes (one minute intervals), with each one-minute interval followed by a 60 s acclimation period and a 10 s target acquisition period. The protocol was run in triplicate for each plate. After the procedure, the fish were removed from the plate and transferred to a clean beaker or tank containing a clean larvae medium and returned to the incubator. This process was repeated on the following days post-fertilization (dpf): 5, 7, 9, 14, 24, and 29.
2.13. Skeletal and Cardiac Muscle Developmental Assays
The skeletal muscle integrity of Wt AB and
Mgat1b−/− fish strains was monitored in embryos (58 hpf) and larvae (3 dpf and 4 dpf) via the employment of a birefringence assay [
19]. The 58 hpf embryos were dechorionated with needles, if needed. Images were collected using a Leica M80 stereoscope and an attached Leica IC90 E camera at 2× magnification with two polarized lenses. One lens was stationary, and the other was rotated to adjust the polarizing light for muscle fiber illumination. Using image J, mean intensity measurements were taken from somites 12 through 20. The birefringence was normalized to Wt AB for each timepoint. Heart development was assayed by the direct visual observation of a heartbeat in zebrafish embryos at 25 hpf and 28 hpf using a Zeiss 47 50 52- 9901 stereoscope at 5× magnification. The number of embryos with a visually detectable heartbeat was recorded as the percent per plate. Experiments were set up on 2 occasions. Five and seven clutches were collected for Wt AB and
Mgat1b−/−. Twenty embryos were added to each plate for Wt AB, and eight, sixteen, fifteen, ten, twenty-two, twenty-five, and thirty-two embryos were added per plate for Mgat1b
−/−. The percentage of embryos with a heartbeat was determined per plate.
2.14. Statistical Analysis
The N-glycan structures were assigned with the aid of GlycoworkBench 2.1 software based on precursor masses (sodium adduct) obtained by ESI-MS/MS and the common mammalian biosynthetic pathway [
18]. Image J 1.54d software was used for somite mean intensity measurements. Adobe Photoshop was employed to obtain agarose gel and lectin blot pictures. Origin 9.55 was used for graphics and statistics. Data are presented as the mean ± S.E., where n denotes the number of observations, as indicated. A statistical comparison of two groups was accomplished using unpaired Student’s
t-test.
4. Discussion
Previously, our lab utilized in vitro cell models to demonstrate that disruption in the N-glycosylation pathway alters aberrant cellular properties in neuronal-derived cells [
15,
24] and that the ecotopic expression of incomplete N-glycosylation of a voltage-gated K
+ channel (Kv3.1b) in primary motor neurons (e.g., caudal primary, CaP) of zebrafish results in maldeveloped CaP neurons [
25]. Here, we extended those studies to reveal the deleterious consequences of a global knockdown of one of two GnT-I enzymes (GnT-Ib) in zebrafish. Genotyping confirmed an introduced frameshift in the
Mgat1b−/− strain. Additionally, swimming locomotor activity in the
Mgat1b−/− larvae was slower than that of Wt AB, as well as
Mgat1b+/+ and
Mgat1b+/−, minimizing the likelihood of off-target effects. The glycomic analysis supported an increase in the oligomannose type, along with decreases in the hybrid and complex types of N-glycans in the adult brains of the
Mgat1b−/− zebrafish strain compared to the Wt AB strain. Lectin blotting and qRT-PCR supported the knockdown in GnT-I activity in the adult brain, as well as the whole organism from 8 hpf to 24 dpf. Although prior glycomic studies have reported on the overall glycan populations of embryos and various zebrafish organs [
7,
8], our study investigated how reduced GnT-I activities contribute to the N-glycan population by altering the various types of N-glycans, such as lowering the levels of complex-type N-glycans. Moreover, our study investigated the negative consequences in the survival and development of zebrafish from this change in the N-glycan population.
N-glycomics is an important analytical technique that has been used in numerous different aspects of research to correlate glycan structure with cellular function [
15,
26,
27]. Assaying
Mgat1b−/− in conjunction with Wt AB revealed that reduced complex-type N-glycans decreased the survivability of the mutant fish and, furthermore, delayed embryonic development. Embryonic survivability was about 50% for the
Mgat1b−/− mutant strain. To elaborate, there was a drastic decline in embryonic survivability from 8 to 12 hpf and less decline after 12 hpf for the
Mgat1b−/− mutant strain. Further, various clutches had a similar survivability as the median value of percent viable embryos was like the mean value. Since embryonic development relies on maternal gene products [
28], it is of interest to evaluate the contribution of maternal mRNA. Our observations of developmental staging revealed that the
Mgat1b−/− mutant fish were lagging in development as they reached 75% epiboly at about 9 hpf and those that survived reached 90% epiboly at about 10–11 hpf, while the Wt AB embryos followed the developmental staging outlined by Kimmel et al., 1995 [
10]. As such, the majority of
Mgat1b−/− embryos died during the transition from 75% to 90% epiboly, a stage of prominent cell movement, which transpires around 8–9 hpf in Wt AB zebrafish [
10]. Given that at 90% epiboly, brain anlagen formation occurs [
29], it is plausible to associate the inability of the
Mgat1b−/− to transition from 75% to 90% epiboly with inefficient cell migration to the lessened complex-type N-glycans. Interestingly, the embryonic development of zebrafish at 12–15 hpf is equivalent to 9.5 to 10.5 embryonic days in mice [
30], at which point GnT-I knockout is lethal due to maldevelopment of the neural tube [
5], indicating that complex-type N-glycans are crucial even earlier in zebrafish development relative to mice since we observed a drastic decline in survival prior to 12 hpf. Taken together, our current study implicates GnT-Ib knockdown as an impediment in zebrafish embryonic survivability and, specifically, supports that the developmental progression is halted due to possible inhibition of brain anlagen formation.
Complex-type N-glycans are present before brain anlagen development and during neuron development. Reports have shown that all three glycan types form as early as 6 hpf [
7]. Moreover, glycomic studies indicated variable expression levels of complex-type N-glycans and a significant increase in the complex type at 12–15 hpf, [
30], which is during the segmentation period when somites are formed and during the initiation of primary organs [
10]. Our past studies supported the involvement of complex N-glycans in cell migration [
15,
24,
25] and, further, revealed the impact of partially N-glycosylated Kv3 channels, containing Kv3.1b protein, on primary motor neuron development and swimming locomotor activity in zebrafish [
25]. Together, the necessity of complex-type N-glycans is evident in embryonic development and neuronal function of zebrafish.
For the surviving
Mgat1b−/− zebrafish, the influence of GnT-I knockdown in skeletal muscle organization and function was visible in the locomotion assays. Muscle performance during burst movements upon sensing external stimuli [
19,
31,
32] was impaired at 2, 3, and 10 dpf in mutant fish relative to Wt AB. Further, spontaneous swimming distance, which is indicative of sustained muscle activity [
32], was quite diminished in the
Mgat1b−/− mutant compared to Wt AB from 5 to 29 dpf. Organization of the muscle sarcomeres increased during skeletal muscle development [
19,
31]. Here, we show that the organization of the sarcomeres was reduced in the embryos and larvae with GnT-I activity knocked down. Thus, the delay in skeletal muscle development coincides with a reduction in motor and sensory functions. Likewise, past studies using the conditional inactivation of
Mgat1 in mice corroborates the relevance of complex-type N-glycans in locomotor activity [
4]. As such, our study implicates that inadequate levels of complex-type N-glycans can impair skeletal muscle development, thus coinciding with less efficient locomotor activity in zebrafish.
A range of diverse phenotypes from no marked clinical phenotype to severe disease is found in individuals with similar genetic variants [
33]. Here, the indel introduced in both alleles of
Mgat1b showed incomplete penetrance and variable expressivity. As noted, embryonic survivability and developmental delays, including cardiac and skeletal muscle development, were observed in
Mgat1b−/− fish. Moreover, sensory and motor developmental delays were observed at 48 hpf in
Mgat1b−/− fish as less than 40% of embryos showed burst movements in response to one touch, while 65% of Wt AB had a response. Developmental delays in sensory and motor functions of the
Mgat1b−/− larvae were also noted at 3 dpf, which was supported by the delay in skeletal muscle development. Continued measurements of muscle performance via burst movements upon sensing external stimuli [
19,
32] and sustained muscle activity [
32] revealed delays in motor function and sensory physiology throughout larval development. Thus, fish homozygous for the
Mgat1b mutation showed different degrees of disease, which support individuals suffering from congenital disorders of glycosylation, including disorders of N-glycosylation processing [
2].