Protective Effects of Apamin on Acetaminophen-Induced Hepatotoxicity in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Study
2.2. Biochemical Analysis
2.3. Histological Analysis, Immunochemistry (IHC), and Immunofluorescence (IF) Staining
2.4. Terminal Deoxynucleotidyl Transferase-Mediated dUTP Nick-End Labeling (TUNEL) Staining
2.5. Western Blot Analysis
2.6. Quantitative Reverse Transcription–Polymerase Chain Reaction (qRT-PCR)
2.7. Statistical Analysis
3. Results
3.1. APM Dampened APAP-Evoked Hepatotoxicity
3.2. APM Inhibited Oxidative Stress in APAP-Injected Mice
3.3. APM Suppressed Apoptotic Cell Death
3.4. APM Suppressed Inflammatory Responses
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sandhu, N.; Navarro, V. Drug-Induced Liver Injury in GI Practice. Hepatol. Commun. 2020, 4, 631–645. [Google Scholar] [CrossRef] [PubMed]
- Yan, T.; Huang, J.; Nisar, M.F.; Wan, C.; Huang, W. The Beneficial Roles of SIRT1 in Drug-Induced Liver Injury. Oxid. Med. Cell. Longev. 2019, 2019, 8506195. [Google Scholar] [CrossRef] [PubMed]
- Bunchorntavakul, C.; Reddy, K.R. Acetaminophen (APAP or N-Acetyl-p-Aminophenol) and Acute Liver Failure. Clin. Liver Dis. 2018, 22, 325–346. [Google Scholar] [CrossRef] [PubMed]
- Bunchorntavakul, C.; Reddy, K.R. Acetaminophen-related hepatotoxicity. Clin. Liver Dis. 2013, 17, 587–607. [Google Scholar] [CrossRef] [PubMed]
- Yan, M.; Huo, Y.; Yin, S.; Hu, H. Mechanisms of acetaminophen-induced liver injury and its implications for therapeutic interventions. Redox Biol. 2018, 17, 274–283. [Google Scholar] [CrossRef]
- Jaeschke, H.; Akakpo, J.; Umbaugh, D.S.; Ramachandran, A. Novel Therapeutic Approaches Against Acetaminophen-induced Liver Injury and Acute Liver Failure. Toxicol. Sci. 2020, 174, 159–167. [Google Scholar] [CrossRef]
- Wehbe, R.; Frangieh, J.; Rima, M.; El Obeid, D.; Sabatier, J.-M.; Fajloun, Z. Bee Venom: Overview of Main Compounds and Bioactivities for Therapeutic Interests. Molecules 2019, 24, 2997. [Google Scholar] [CrossRef]
- Son, D.J.; Lee, J.W.; Lee, Y.H.; Song, H.S.; Lee, C.K.; Hong, J.T. Therapeutic application of anti-arthritis, pain-releasing, and anti-cancer effects of bee venom and its constituent compounds. Pharmacol. Ther. 2007, 115, 246–270. [Google Scholar] [CrossRef]
- Moreno, M.; Giralt, E. Three Valuable Peptides from Bee and Wasp Venoms for Therapeutic and Biotechnological Use: Melittin, Apamin and Mastoparan. Toxins 2015, 7, 1126–1150. [Google Scholar] [CrossRef]
- Adelman, J.P.; Maylie, J.; Sah, P. Small-conductance Ca2+-activated K+ channels: Form and function. Annu. Rev. Physiol. 2012, 74, 245–269. [Google Scholar] [CrossRef]
- Kallarackal, A.J.; Simard, J.M.; Bailey, A.M. The effect of apamin, a small conductance calcium activated potassium (SK) channel blocker, on a mouse model of neurofibromatosis 1. Behav. Brain Res. 2013, 237, 71–75. [Google Scholar] [CrossRef] [PubMed]
- Hammond, R.S.; Bond, C.T.; Strassmaier, T.; Ngo-Anh, T.J.; Adelman, J.P.; Maylie, J.; Stackman, R.W. Small-conductance Ca2+-activated K+ channel type 2 (SK2) modulates hippocampal learning, memory, and synaptic plasticity. J. Neurosci. 2006, 26, 1844–1853. [Google Scholar] [CrossRef] [PubMed]
- Gu, H.; Han, S.M.; Park, K.-K. Therapeutic Effects of Apamin as a Bee Venom Component for Non-Neoplastic Disease. Toxins 2020, 12, 195. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Leem, J.; Park, K.-K. Antioxidative, Antiapoptotic, and Anti-Inflammatory Effects of Apamin in a Murine Model of Lipopolysaccharide-Induced Acute Kidney Injury. Molecules 2020, 25, 5717. [Google Scholar] [CrossRef]
- Lee, Y.M.; Cho, S.-N.; Son, E.; Song, C.-H.; Kim, D.-S. Apamin from bee venom suppresses inflammation in a murine model of gouty arthritis. J. Ethnopharmacol. 2020, 257, 112860. [Google Scholar] [CrossRef]
- Bae, G.-S.; Heo, K.-H.; Park, K.-C.; Choi, S.B.; Jo, I.-J.; Seo, S.-H.; Kim, D.-G.; Shin, J.-Y.; Kang, D.-G.; Lee, H.-S.; et al. Apamin attenuated cerulein-induced acute pancreatitis by inhibition of JNK pathway in mice. Dig. Dis. Sci. 2013, 58, 2908–2917. [Google Scholar] [CrossRef]
- Kim, S.J.; Park, J.H.; Kim, K.H.; Lee, W.R.; Pak, S.C.; Han, S.M.; Park, K.K. The Protective Effect of Apamin on LPS/Fat-Induced Atherosclerotic Mice. Evid. Based Complement Alternat. Med. 2012, 2012, 305454. [Google Scholar] [CrossRef]
- Kim, J.-Y.; An, H.-J.; Kim, W.-H.; Park, Y.-Y.; Park, K.D.; Park, K.-K. Apamin suppresses biliary fibrosis and activation of hepatic stellate cells. Int. J. Mol. Med. 2017, 39, 1188–1194. [Google Scholar] [CrossRef]
- Lee, W.R.; Kim, K.H.; An, H.J.; Kim, J.Y.; Lee, S.J.; Han, S.M.; Pak, S.C.; Park, K.K. Apamin inhibits hepatic fibrosis through suppression of transforming growth factor β1-induced hepatocyte epithelial-mesenchymal transition. Biochem. Biophys. Res. Commun. 2014, 450, 195–201. [Google Scholar] [CrossRef]
- Feng, Y.; Cui, R.; Li, Z.; Zhang, X.; Jia, Y.; Zhang, X.; Shi, J.; Qu, K.; Liu, C.; Zhang, J. Methane Alleviates Acetaminophen-Induced Liver Injury by Inhibiting Inflammation, Oxidative Stress, Endoplasmic Reticulum Stress, and Apoptosis through the Nrf2/HO-1/NQO1 Signaling Pathway. Oxid. Med. Cell. Logev. 2019, 2019, 7067619. [Google Scholar] [CrossRef]
- Haton, C.; François, A.; Vandamme, M.; Wysocki, J.; Griffiths, N.M.; Benderitter, M. Imbalance of the antioxidant network of mouse small intestinal mucosa after radiation exposure. Radiat. Res. 2007, 167, 445–453. [Google Scholar] [CrossRef] [PubMed]
- Ryoo, S.; Choi, J.; Kim, J.; Bae, S.; Hong, J.; Jo, S.; Kim, S.; Lee, Y. BIRB 796 has Distinctive Anti-inflammatory Effects on Different Cell Types. Immune Netw. 2013, 13, 283–288. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Rupa, P.; Jiang, B.; Mine, Y. Hydrolysate from Eggshell Membrane Ameliorates Intestinal Inflammation in Mice. Int. J. Mol. Sci. 2014, 15, 22728–22742. [Google Scholar] [CrossRef] [PubMed]
- Shang, K.; Bai, Y.-P.; Wang, C.; Wang, Z.; Gu, H.-Y.; Du, X.; Zhou, X.-Y.; Zheng, C.-L.; Chi, Y.-Y.; Mukaida, N.; et al. Crucial involvement of tumor-associated neutrophils in the regulation of chronic colitis-associated carcinogenesis in mice. PLoS ONE 2012, 7, e51848. [Google Scholar] [CrossRef]
- Wang, H.; Zhang, L.; Zhang, I.Y.; Chen, X.; Da Fonseca, A.; Wu, S.; Ren, H.; Badie, S.; Sadeghi, S.; Ouyang, M.; et al. S100B promotes glioma growth through chemoattraction of myeloid-derived macrophages. Clin. Cancer Res. 2013, 19, 3764–3775. [Google Scholar] [CrossRef]
- Liu, Z.; Hu, Y.; Yu, P.; Lin, M.; Huang, G.; Kawai, T.; Taubman, M.; Wang, Z.; Xiaozhe, H. Toll-like receptor agonists Porphyromonas gingivalis LPS and CpG differentially regulate IL-10 competency and frequencies of mouse B10 cells. J. Appl. Oral Sci. 2017, 25, 90–100. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Jang, H.-J.; Leem, J.; Kim, G.-M. Protective Effects of Bee Venom-Derived Phospholipase A2 against Cholestatic Liver Disease in Mice. Biomedicines 2021, 9, 992. [Google Scholar] [CrossRef]
- Jaeschke, H.; Ramachandran, A. The role of oxidant stress in acetaminophe-induced liver injury. Curr. Opin. Toxicol. 2020, 20–21, 9–14. [Google Scholar] [CrossRef]
- Su, W.; Feng, M.; Liu, Y.; Cao, R.; Liu, Y.; Tang, J.; Pan, K.; Lan, R.; Mao, Z. ZnT8 Deficiency Protects From APAP-Induced Acute Liver Injury by Reducing Oxidative Stress through Upregulating Hepatic Zinc and Metallothioneins. Front. Pharmacol. 2021, 12, 721471. [Google Scholar] [CrossRef]
- Lad, A.; Hunyadi, J.; Connolly, J.; Breidenbach, J.D.; Khalaf, F.K.; Dube, P.; Zhang, S.; Kleinhenz, A.L.; Baliu-Rodriguez, D.; Isailovic, D.; et al. Antioxidant Therapy Significantly Attenuates Hepatotoxicity following Low Dose Exposure to Microcystin-LR in a Murine Model of Diet-Induced Non-Alcoholic Fatty Liver Disease. Antioxidants 2022, 11, 1625. [Google Scholar] [CrossRef]
- Kim, H.; Lee, J.H.; Park, J.-W. IDH2 deficiency exacerbates acetaminophen hepatotoxicity in mice via mitochondrial dysfunction-induced apoptosis. Biochim. Biophys. Acta Mol. Basis. Dis. 2019, 1865, 2333–2341. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Hu, J.-N.; Yan, M.-H.; Xing, J.-J.; Liu, W.-C.; Li, W. Caspase-Mediated Anti-Apoptotic Effect of Ginsenoside Rg5, a Main Rare Ginsenoside, on Acetaminophen-Induced Hepatotoxicity in Mice. J. Agric. Food Chem. 2017, 65, 9226–9236. [Google Scholar] [CrossRef] [PubMed]
- Perugorria, M.J.; Esparza-Baquer, A.; Oakley, F.; Labiano, I.; Korosec, A.; Jais, A.; Mann, J.; Tiniakos, D.; Santos-Laso, A.; Arbelaiz, A.; et al. Non-parenchymal TREM-2 protects the liver from immune-mediated hepatocellular damage. Gut 2019, 68, 533–546. [Google Scholar] [CrossRef] [PubMed]
- Numata, K.; Kubo, M.; Watanabe, H.; Takagi, K.; Mizuta, H.; Okada, S.; Kunkel, S.L.; Ito, T.; Matsukawa, A. Overexpression of suppressor of cytokine signaling-3 in T cells exacerbates acetaminophen-induced hepatotoxicity. J. Immunol. 2007, 178, 3777–3785. [Google Scholar] [CrossRef]
- Park, J.-H.; Leem, J.; Lee, S.-J. Protective Effects of Carnosol on Renal Interstitial Fibrosis in a Murine Model of Unilateral Ureteral Obstruction. Antioxidants 2022, 11, 2341. [Google Scholar] [CrossRef]
- Matusmoto, K.; Kawanaka, H.; Hori, M.; Kusamori, K.; Utsumi, D.; Tsukahara, T.; Amagase, K.; Horie, S.; Yamamoto, A.; Ozaki, H.; et al. Role of transient receptor potential melastatin 2 in surgical inflammation and dysmotility in a mouse model of postoperative ileus. Am. J. Physiol. Gastrointest. Liver Physiol. 2018, 315, G104–G116. [Google Scholar] [CrossRef]
- Roth, K.; Strickland, J.; Joshi, N.; Deng, M.; Kennedy, R.C.; Rockwell, C.E.; Luyendyk, J.P.; Billiar, T.R.; Copple, B.L. Dichotomous Role of Plasmin in Regulation of Macrophage Function after Acetaminophen Overdose. Am. J. Pathol. 2019, 189, 1986–2001. [Google Scholar] [CrossRef]
- Kwo, P.Y.; Cohen, S.M.; Lim, J.K. ACG Clinical Guideline: Evaluation of Abnormal Liver Chemistries. Am. J. Gastroenterol. 2017, 112, 18–35. [Google Scholar] [CrossRef]
- Park, J.-H.; Seo, K.-S.; Tadi, S.; Ahn, B.-H.; Lee, J.-U.; Heo, J.-Y.; Han, J.; Song, M.-S.; Kim, S.-H.; Yim, Y.-H.; et al. An indole derivative protects against acetaminophen-induced liver injury by directly binding to N-acetyl-p-benzoquinone imine in mice. Antioxid. Redox Signal. 2013, 18, 1713–1722. [Google Scholar] [CrossRef]
- Wu, C.-T.; Deng, J.-S.; Huang, W.-C.; Shieh, P.-C.; Chung, M.-I.; Huang, G.-J. Salvianolic Acid C against Acetaminophen-Induced Acute Liver Injury by Attenuating Inflammation, Oxidative Stress, and Apoptosis through Inhibition of the Keap1/Nrf2/HO-1 Signaling. Oxid. Med. Cell. Longev. 2019, 2019, 9056845. [Google Scholar] [CrossRef]
- Wang, Z.; Hao, W.; Hu, J.; Mi, X.; Han, Y.; Ren, S.; Jiang, S.; Wang, Y.; Li, X.; Li, W. Maltol Improves APAP-Induced Hepatotoxicity by Inhibiting Oxidative Stress and Inflammation Response via NF-κB and PI3K/Akt Signal Pathways. Antioxidants 2019, 8, 395. [Google Scholar] [CrossRef] [PubMed]
- Lin, L.; Guan, H.; Li, R.; Liao, X.; Zhao, F.; Wang, M.; Li, J.; Xu, G.; He, X.; Zhang, J.; et al. Auriculatone Sulfate Effectively Protects Mice Against Acetaminophen-Induced Liver Injury. Molecules 2019, 24, 3642. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Choi, Y.; Leem, J.; Song, J.E. Heme Oxygenase-1 Induction by Cobalt Protoporphyrin Ameliorates Cholestatic Liver Disease in a Xenobiotic-Induced Murine Model. Int. J. Mol. Sci. 2021, 22, 8253. [Google Scholar] [CrossRef] [PubMed]
- Ramachandran, A.; Jaeschke, H. Acetaminophen Hepatotoxicity. Semin. Liver Dis. 2019, 39, 221–234. [Google Scholar] [CrossRef] [PubMed]
- Shalini, S.; Dorstyn, L.; Dawar, S.; Kumar, S. Old, new and emerging functions of caspases. Cell Death Differ. 2015, 22, 526–539. [Google Scholar] [CrossRef]
- Kim, S.-J.; Park, J.-H.; Kim, K.-H.; Lee, W.-R.; An, H.-J.; Min, B.-K.; Han, S.-M.; Kim, K.-S.; Park, K.-K. Apamin inhibits THP-1-derived macrophage apoptosis via mitochondria-related apoptotic pathway. Exp. Mol. Pathol. 2012, 93, 129–134. [Google Scholar] [CrossRef]
- Park, J.; Jang, K.M.; Park, K.-K. Effects of Apamin on MPP+-Induced Calcium Overload and Neurotoxicity by Targeting CaMKII/ERK/p65/STAT3 Signaling Pathways in Dopaminergic Neuronal Cells. Int. J. Mol. Sci. 2022, 23, 15255. [Google Scholar] [CrossRef]
- Antoniades, C.G.; Quaglia, A.; Taams, L.S.; Mitry, R.R.; Hussain, M.; Abeles, R.; Possamai, L.A.; Bruce, M.; McPhail, M.; Starling, C.; et al. Source and characterization of hepatic macrophages in acetaminophen-induced acute liver failure in humans. Hepatology 2012, 56, 735–746. [Google Scholar] [CrossRef]
- Williams, C.D.; Bajt, M.L.; Sharpe, M.R.; McGill, M.R.; Farhood, A.; Jaeschke, H. Neutrophil activation during acetaminophen hepatotoxicity and repair in mice and humans. Toxicol. Appl. Pharmacol. 2014, 275, 122–133. [Google Scholar] [CrossRef]
- Mossanen, J.C.; Krenkel, O.; Ergen, C.; Govaere, O.; Liepelt, A.; Puengel, T.; Heymann, F.; Kalthoff, S.; Lefebvre, E.; Eulberg, D.; et al. Chemokine (C-C motif) receptor 2-positive monocytes aggravate the early phase of acetaminophen-induced acute liver injury. Hepatology 2016, 64, 1667–1682. [Google Scholar] [CrossRef]
- Dambach, D.M.; Durham, S.K.; Laskin, J.D.; Laskin, D.L. Distinct roles of NF-kappaB p50 in the regulation of acetaminophen-induced inflammatory mediator production and hepatotoxicity. Toxicol. Appl. Pharmacol. 2006, 211, 157–165. [Google Scholar] [CrossRef] [PubMed]
- Liu, A.; Tanaka, N.; Sun, L.; Guo, B.; Kim, J.-H.; Krausz, K.W.; Fang, Z.; Jiang, C.; Yang, J.; Gonzalez, F.J. Saikosaponin d protects against acetaminophen-induced hepatotoxicity by inhibiting NF-κB and STAT3 signaling. Chem. Biol. Interact. 2014, 223, 80–86. [Google Scholar] [CrossRef] [PubMed]
- Park, J.; Jang, K.M.; Park, K.-K. Apamin Suppresses LPS-Induced Neuroinflammatory Responses by Regulating SK Channels and TLR4-Mediated Signaling Pathways. Int. J. Mol. Sci. 2020, 21, 4319. [Google Scholar] [CrossRef] [PubMed]
- Kim, W.-H.; An, H.-J.; Kim, J.-Y.; Gwon, M.-G.; Gu, H.; Lee, S.-J.; Park, J.Y.; Park, K.-D.; Han, S.-M.; Kim, M.-K.; et al. Apamin inhibits TNF-α- and IFN-γ-induced inflammatory cytokines and chemokines via suppressions of NF-κB signaling pathway and STAT in human keratinocytes. Pharmacol. Rep. 2017, 69, 1030–1035. [Google Scholar] [CrossRef]
- Soeda, J.; Mouralidarane, A.; Ray, S.; Novelli, M.; Thomas, S.; Roskams, T.; Diehl, A.M.; Oben, J.A. The β-adrenoceptor agonist isoproterenol rescues acetaminophen-injured livers through increasing progenitor numbers by Wnt in mice. Hepatology 2014, 60, 1023–1034. [Google Scholar] [CrossRef]
- Chen, Q.; Yan, D.; Zhang, Q.; Zhang, G.; Xia, M.; Li, J.; Zhan, W.; Shen, E.; Li, Z.; Lin, L.; et al. Treatment of acetaminophen-induced liver failure by blocking the death checkpoint protein TRAIL. Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165583. [Google Scholar] [CrossRef]
- Kim, Y.-H.; Hwang, J.H.; Kim, K.-S.; Noh, J.-R.; Choi, D.-H.; Kim, D.-K.; Tadi, S.; Yim, Y.-H.; Choi, H.-S.; Lee, C.-H. Metformin ameliorates acetaminophen hepatotoxicity via Gadd45β-dependent regulation of JNK signaling in mice. J. Hepatol. 2015, 63, 75–82. [Google Scholar] [CrossRef] [PubMed]
- Jaeschke, H.; Xie, Y.; McGill, M.R. Acetaminophen-induced Liver Injury: From Animal Models to Humans. J. Clin. Transl. Hepatol. 2014, 2, 153–161. [Google Scholar]
Gene | Primer Sequence (5′→3′) | Reference |
---|---|---|
Catalase | F: GCTGAGAAGCCTAAGAACGCA R: CCTTCGCAGCCATGTGAGA | [21] |
Sod2 | F: GCGGCCTACGTGAACAATCT R: CATCTCCCTTGGCCAGAGC | [21] |
Gpx1 | F: TTTCCAGGAAAATCCCCTCA R: TAGGTGGAAAGGCATCGGC | [21] |
Tnfα | F: GTTCTGTCCCTTTCACTCACTG R: GGTAGAGAATGGATGAACAC | [22] |
Il6 | F: CCGGAGAGGAGACTTCACAG R: CAGAATTGCCATTGCACAAC | [23] |
Il1b | F: TGGTGTGTGACGTTCCCATTA R: CCGACAGCACGAGGCTTTT | [21] |
Cxcl5 | F: TTGATCGCTAATTTGGAGGTG R: GCATTCCGCTTAGCTTTCTTT | [24] |
Mcp1 | F: ACTCACCTGCTGCTACTCATTCAC R: AACTACAGCTTCTTTGGGACACCT | [25] |
Gapdh | F: CCCCAGCAAGGACACTGAGCAA R: GTGGGTGCAGCGAACTTTATTGATG | [26] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jang, H.-J.; Leem, J.; Kim, G.M. Protective Effects of Apamin on Acetaminophen-Induced Hepatotoxicity in Mice. Curr. Issues Mol. Biol. 2023, 45, 4389-4399. https://doi.org/10.3390/cimb45050279
Jang H-J, Leem J, Kim GM. Protective Effects of Apamin on Acetaminophen-Induced Hepatotoxicity in Mice. Current Issues in Molecular Biology. 2023; 45(5):4389-4399. https://doi.org/10.3390/cimb45050279
Chicago/Turabian StyleJang, Hyo-Jeong, Jaechan Leem, and Gyun Moo Kim. 2023. "Protective Effects of Apamin on Acetaminophen-Induced Hepatotoxicity in Mice" Current Issues in Molecular Biology 45, no. 5: 4389-4399. https://doi.org/10.3390/cimb45050279