Diagnosis of a Rabbit Hemorrhagic Disease Virus 2 (RHDV2) and the Humoral Immune Protection Effect of VP60 Vaccine
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Animals
2.3. Virus Used in Challenge
2.4. Histopathological Examination
2.5. Reverse Transcription-Polymerase Chain Reaction
2.6. Phylogenetic Analysis
2.7. Determination of Serum Antibody
2.8. Temperature and Weight Measurements
2.9. Statistical Analysis
3. Results
3.1. Clinical Observation and Pathological Changes of Dead Rabbits
3.2. VP60 Genome Sequence and Phylogenetic Analysis of TA2020/0408 Isolated from RHDV2
3.3. The Safety and Protection of the New Type of Rabbit Plague Virus Baculovector (VP60) Vaccine
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bonvehí, C.; Ardiaca, M.; Montesinos, A.; Juan-Sallés, C.; Gómez, A.; Teso, B.; Barbero, S.; Ferrera, S.E. Clinicopathologic findings of naturally occurring Rabbit Hemorrhagic Disease Virus 2 infection in pet rabbits. Vet. Clin. Pathol. 2019, 48, 89–95. [Google Scholar] [CrossRef]
- Liu, S.J.; Xue, H.P.; Pu, B.Q.; Qian, N.H. A new viral disease in rabbits. Anim. Husb. Vet. Med. 1984, 16, 253–255. [Google Scholar]
- Müller, C.; Hrynkiewicz, R.; Bębnowska, D.; Maldonado, J.; Baratelli, M.; Köllner, B.; Niedźwiedzka-Rystwej, P. Immunity against Lagovirus europaeus and the Impact of the Immunological Studies on Vaccination. Vaccines 2021, 9, 255. [Google Scholar] [CrossRef] [PubMed]
- Lopes, A.M.; Magalhães, M.J.; Alves, P.C.; Esteves, P.J.; Abrantes, J. An update on the rabbit hemorrhagic disease virus (RHDV) strains circulating in Portugal in the 1990s: Earliest detection of G3–G5 and G6. Arch. Virol. 2017, 162, 2061–2065. [Google Scholar] [CrossRef] [PubMed]
- Rosell, J.M.; de la Fuente, L.F.; Parra, F.; Dalton, K.P.; Badiola Sáiz, J.I.; Pérez de Rozas, A.; Badiola Díez, J.J.; Fernández de Luco, D.; Casal, J.; Majó, N.; et al. Myxomatosis and Rabbit Haemorrhagic Disease: A 30-Year Study of the Occurrence on Commercial Farms in Spain. Animals 2019, 9, 780. [Google Scholar] [CrossRef] [Green Version]
- Gregg, D.A.; House, C.; Meyer, R.; Berninger, M. Viral haemorrhagic disease of rabbits in Mexico: Epidemiology and viral characterization. Rev. Sci. Tech. (Int. Off. Epizoot.) 1991, 10, 435–451. [Google Scholar] [CrossRef]
- Cox, T. Australia’s war against rabbits: The story of rabbit haemorrhagic disease. Australas J. Environ. Manag. 2017, 24, 91–92. [Google Scholar] [CrossRef]
- Hall, R.N.; King, T.; O’Connor, T.; Read, A.J.; Arrow, J.; Trought, K.; Duckworth, J.; Piper, M.; Strive, T. Age and Infectious Dose Significantly Affect Disease Progression after RHDV2 Infection in Naïve Domestic Rabbits. Viruses 2021, 13, 1184. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, F.; Gidlewski, T.; Berninger, M.L.; Petrowski, H.M.; Bracht, A.J.; de Rueda, C.B.; Barrette, R.W.; Grady, M.; O’Hearn, E.S.; Lewis, C.E.; et al. Comparative susceptibility of eastern cottontails and New Zealand white rabbits to classical rabbit haemorrhagic disease virus (RHDV) and RHDV2. Transbound. Emerg. Dis. 2021, 69, e968–e978. [Google Scholar] [CrossRef]
- Alda, F.; Gaitero, T.; Suárez, M.; Merchán, T.; Rocha, G.; Doadrio, I. Evolutionary history and molecular epidemiology of rabbit haemorrhagic disease virus in the Iberian Peninsula and Western Europe. BMC Evol. Biol. 2010, 10, 347. [Google Scholar] [CrossRef] [Green Version]
- Bbnowska, D.; Niedwiedzka-Rystwej, P. Characteristics of a new variant of rabbit haemorrhagic disease virus—RHDV2. Acta Biol. 2019, 26, 83–97. [Google Scholar] [CrossRef]
- Hrynkiewicz, R.; Bebnowska, D.; Niedzwiedzka-Rystwej, P. Myeloperoxidase and Lysozymes as a Pivotal Hallmark of Immunity Status in Rabbits. Animals 2020, 10, 1581. [Google Scholar] [CrossRef]
- Bucher, K.; Tellechea, D.; Caya, F.; Stratton, J. Implementation of OIE international standards: Challenges and opportunities for monitoring. Rev. Sci. Tech. 2020, 39, 57–67. [Google Scholar] [CrossRef]
- Mahar, J.E.; Read, A.J.; Gu, X.; Urakova, N.; Mourant, R.; Piper, M.; Haboury, S.; Holmes, E.C.; Strive, T.; Hall, R.N. Detection and Circulation of a Novel Rabbit Hemorrhagic Disease Virus in Australia. Emerg. Infect. Dis. 2018, 24, 22–31. [Google Scholar] [CrossRef]
- Rouco, C.; Abrantes, J.; Serronha, A.; Lopes, A.M.; Maio, E.; Magalhães, M.J.; Blanco, E.; Bárcena, J.; Esteves, P.J.; Santos, N.; et al. Epidemiology of RHDV2 (Lagovirus europaeus/GI.2) in free-living wild European rabbits in Portugal. Transbound. Emerg. Dis. 2018, 65, e373–e382. [Google Scholar] [CrossRef]
- Mahar, J.E.; Hall, R.N.; Peacock, D.; Kovaliski, J.; Piper, M.; Mourant, R.; Huang, N.; Campbell, S.; Gu, X.; Read, A.; et al. Rabbit Hemorrhagic Disease Virus 2 (RHDV2; GI.2) Is Replacing Endemic Strains of RHDV in the Australian Landscape within 18 Months of Its Arrival. J. Virol. 2018, 92, e01374. [Google Scholar] [CrossRef] [Green Version]
- Taggart, P.L.; Hall, R.N.; Cox, T.E.; Kovaliski, J.; McLeod, S.R.; Strive, T. Changes in virus transmission dynamics following the emergence of RHDV2 shed light on its competitive advantage over previously circulating variants. Transbound. Emerg. Dis. 2021, 69, 1118–1130. [Google Scholar] [CrossRef]
- Hu, B.; Wei, H.; Fan, Z.; Song, Y.; Chen, M.; Qiu, R.; Zhu, W.; Xu, W.; Xue, J.; Wang, F. Emergence of rabbit haemorrhagic disease virus 2 in China in 2020. Vet. Med. Sci. 2021, 7, 236–239. [Google Scholar] [CrossRef]
- Toh, X.; Ong, J.; Chan, C.; Teo, X.H.; Toh, S.; Fernandez, C.J.; Huangfu, T. First detection of rabbit haemorrhagic disease virus (RHDV2) in Singapore. Transbound. Emerg. Dis. 2021, 69, 1521–1528. [Google Scholar] [CrossRef]
- Kennedy, A.; Britton, L.; Byrne, A.W.; Byrne, C.; Casey, M.; Flynn, O.; Lozano, J.M.; Marnell, F.; McElroy, M.; Reid, N.; et al. First detected case of rabbit Haemorrhagic disease virus 2 (RHDV2) in the Irish hare (Lepus timidus hibernicus). Ir. Vet. J. 2021, 74, 25. [Google Scholar] [CrossRef]
- Asin, J.; Rejmanek, D.; Clifford, D.L.; Mikolon, A.B.; Henderson, E.E.; Nyaoke, A.C.; Macías-Rioseco, M.; Streitenberger, N.; Beingesser, J.; Woods, L.W.; et al. Early circulation of rabbit haemorrhagic disease virus type 2 in domestic and wild lagomorphs in southern California, USA (2020–2021). Transbound. Emerg. Dis. 2021, 69, e394–e405. [Google Scholar] [CrossRef] [PubMed]
- Erfan, A.M.; Shalaby, A.G. Genotyping of rabbit hemorrhagic disease virus detected in diseased rabbits in Egyptian Provinces by VP60 sequencing. Vet. World 2020, 13, 1098–1107. [Google Scholar] [CrossRef] [PubMed]
- Fukui, H.; Shimoda, H.; Kadekaru, S.; Henmi, C.; Une, Y. Rabbit hemorrhagic disease virus type 2 epidemic in a rabbit colony in Japan. J. Vet. Med. Sci. 2021, 83, 841–845. [Google Scholar] [CrossRef] [PubMed]
- Meyers, G.; Wirblich, C.; Thiel, H.-J.; Thumfart, J.R.O. Rabbit hemorrhagic disease virus: Genome organization and polyprotein processing of a calicivirus studied after transient expression of cDNA constructs. Virology 2000, 276, 349–363. [Google Scholar] [CrossRef] [PubMed]
- Duarte, M.; Carvalho, C.; Bernardo, S.; Barros, S.V.; Benevides, S.; Flor, L.; Monteiro, M.; Marques, I.; Henriques, M.; Barros, S.C.; et al. Rabbit haemorrhagic disease virus 2 (RHDV2) outbreak in Azores: Disclosure of common genetic markers and phylogenetic segregation within the European strains. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2015, 35, 163–171. [Google Scholar] [CrossRef]
- Capucci, L.; Cavadini, P.; Schiavitto, M.; Lombardi, G.; Lavazza, A. Increased pathogenicity in rabbit haemorrhagic disease virus type 2 (RHDV2). Vet. Rec. 2017, 180, 426. [Google Scholar] [CrossRef] [Green Version]
- Abade Dos Santos, F.A.; Magro, C.; Carvalho, C.L.; Ruivo, P.; Duarte, M.D.; Peleteiro, M.C. A Potential Atypical Case of Rabbit Haemorrhagic Disease in a Dwarf Rabbit. Animals 2020, 11, 40. [Google Scholar] [CrossRef]
- Hu, B.; Wang, F.; Fan, Z.; Song, Y.; Abrantes, J.; Zuo, Y.; Esteves, P.J. Recombination between G2 and G6 strains of rabbit hemorrhagic disease virus (RHDV) in China. Arch. Virol. 2017, 162, 269–272. [Google Scholar] [CrossRef]
- Velarde, R.; Cavadini, P.; Neimanis, A.; Cabezón, O.; Chiari, M.; Gaffuri, A.; Lavín, S.; Grilli, G.; Gavier-Widén, D.; Lavazza, A.; et al. Spillover Events of Infection of Brown Hares (Lepus europaeus) with Rabbit Haemorrhagic Disease Type 2 Virus (RHDV2) Caused Sporadic Cases of an European Brown Hare Syndrome-Like Disease in Italy and Spain. Transbound. Emerg. Dis. 2017, 64, 1750–1761. [Google Scholar] [CrossRef]
- Harcourt-Brown, N.; Silkstone, M.; Whitbread, T.J.; Harcourt-Brown, F.M. RHDV2 epidemic in UK pet rabbits. Part 1: Clinical features, gross post mortem and histopathological findings. J. Small Anim. Pract. 2020, 61, 419–427. [Google Scholar] [CrossRef]
- Harcourt-Brown, F.M.; Harcourt-Brown, N.; Joudou, L.M. RHDV2 epidemic in UK pet rabbits. Part 2: PCR results and correlation with vaccination status. J. Small Anim. Pract. 2020, 61, 487–493. [Google Scholar] [CrossRef]
- Hänske, G.G.; König, P.; Schuhmann, B.; Bertram, C.A.; Müller, K. Death in four RHDV2-vaccinated pet rabbits due to rabbit haemorrhagic disease virus 2 (RHDV2). J. Small Anim. Pract. 2021, 62, 700–703. [Google Scholar] [CrossRef] [PubMed]
- Guerrero-Casado, J.; Carpio, A.J.; Tortosa, F.S. Recent negative trends of wild rabbit populations in southern Spain after the arrival of the new variant of the rabbit hemorrhagic disease virus RHDV2. Mamm. Biol. 2016, 81, 361–364. [Google Scholar] [CrossRef]
- Abade Dos Santos, F.A.; Pinto, A.; Burgoyne, T.; Dalton, K.P.; Carvalho, C.L.; Ramilo, D.W.; Carneiro, C.; Carvalho, T.; Peleteiro, M.C.; Parra, F.; et al. Spillover events of rabbit haemorrhagic disease virus 2 (recombinant GI.4P-GI.2) from Lagomorpha to Eurasian badger. Transbound. Emerg. Dis. 2021, 69, 1030–1045. [Google Scholar] [CrossRef]
- Guo, H.; Zhu, J.; Tan, Y.; Li, C.; Chen, Z.; Sun, S.; Liu, G. Self-assembly of virus-like particles of rabbit hemorrhagic disease virus capsid protein expressed in Escherichia coli and their immunogenicity in rabbits. Antivir. Res. 2016, 131, 85–91. [Google Scholar] [CrossRef]
- Qi, R.; Miao, Q.; Zhu, J.; Tang, J.; Tang, A.; Wang, X.; Dong, D.; Guo, H.; Liu, G. Construction and immunogenicity of novel bivalent virus-like particles bearing VP60 genes of classic RHDV(GI.1) and RHDV2(GI.2). Vet. Microbiol. 2020, 240, 108529. [Google Scholar] [CrossRef]
- Müller, C.; Ulrich, R.; Franzke, K.; Müller, M.; Köllner, B. Crude extracts of recombinant baculovirus expressing rabbit hemorrhagic disease virus 2 VLPs from both insect and rabbit cells protect rabbits from rabbit hemorrhagic disease caused by RHDV2. Arch. Virol. 2019, 164, 137–148. [Google Scholar] [CrossRef]
- Ambagala, A.; Schwantje, H.; Laurendeau, S.; Snyman, H.; Joseph, T.; Pickering, B.; Hooper-McGrevy, K.; Babiuk, S.; Moffat, E.; Lamboo, L.; et al. Incursions of rabbit haemorrhagic disease virus 2 in Canada-Clinical, molecular and epidemiological investigation. Transbound. Emerg. Dis. 2021, 68, 1711–1720. [Google Scholar] [CrossRef]
- Rouco, C.; Aguayo-Adán, J.A.; Santoro, S.; Abrantes, J.; Delibes-Mateos, M. Worldwide rapid spread of the novel rabbit haemorrhagic disease virus (GI.2/RHDV2/b). Transbound. Emerg. Dis. 2019, 66, 1762–1764. [Google Scholar] [CrossRef] [PubMed]
- Miao, Q.; Qi, R.; Veldkamp, L.; Ijzer, J.; Kik, M.L.; Zhu, J.; Tang, A.; Dong, D.; Shi, Y.; van Oers, M.M.; et al. Immunogenicity in Rabbits of Virus-Like Particles from a Contemporary Rabbit Haemorrhagic Disease Virus Type 2 (GI.2/RHDV2/b) Isolated in The Netherlands. Viruses 2019, 11, 553. [Google Scholar] [CrossRef] [Green Version]
- Almeida, T.; Lopes, A.M.; Magalhães, M.J.; Neves, F.; Pinheiro, A.; Gonçalves, D.; Leitão, M.; Esteves, P.J.; Abrantes, J. Tracking the evolution of the G1/RHDVb recombinant strains introduced from the Iberian Peninsula to the Azores islands, Portugal. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2015, 34, 307–313. [Google Scholar] [CrossRef]
- Mahar, J.E.; Jenckel, M.; Huang, N.; Smertina, E.; Holmes, E.C.; Strive, T.; Hall, R.N. Frequent intergenotypic recombination between the non-structural and structural genes is a major driver of epidemiological fitness in caliciviruses. Virus Evol. 2021, 7, veab080. [Google Scholar] [CrossRef]
- Strive, T.; Piper, M.; Huang, N.; Mourant, R.; Kovaliski, J.; Capucci, L.; Cox, T.E.; Smith, I. Retrospective serological analysis reveals presence of the emerging lagovirus RHDV2 in Australia in wild rabbits at least five months prior to its first detection. Transbound. Emerg. Dis. 2020, 67, 822–833. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.Y. Viral haemorrhagic disease of rabbits in the People’s Republic of China: Epidemiology and virus characterization. Rev. Sci. Tech. De L’oie 1991, 10, 393–408. [Google Scholar]
- Müller, C.; Ulrich, R.; Schinköthe, J.; Müller, M.; Köllner, B. Characterization of protective humoral and cellular immune responses against RHDV2 induced by a new vaccine based on recombinant baculovirus. Vaccine 2019, 37, 4195–4203. [Google Scholar] [CrossRef]
- Reemers, S.; Peeters, L.; van Schijndel, J.; Bruton, B.; Sutton, D.; van der Waart, L.; van de Zande, S. Novel Trivalent Vectored Vaccine for Control of Myxomatosis and Disease Caused by Classical and a New Genotype of Rabbit Haemorrhagic Disease Virus. Vaccines 2020, 8, 441. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Xia, T.; Guo, T.; Ru, Y.; Jiang, Y.; Cui, W.; Zhou, H.; Qiao, X.; Tang, L.; Xu, Y.; et al. Recombinant Lactobacillus casei Expressing Capsid Protein VP60 can Serve as Vaccine against Rabbit Hemorrhagic Disease Virus in Rabbits. Vaccines 2019, 7, 172. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Farnos, O.; Rodriguez, M.; Chiong, M.; Parra, F.; Boue, O.; Lorenzo, N.; Colas, M.; Lleonart, R. The recombinant rabbit hemorrhagic disease virus VP60 protein obtained from Pichia pastoris induces a strong humoral and cell-mediated immune response following intranasal immunization in mice. Vet. Microbiol. 2006, 114, 187–195. [Google Scholar] [CrossRef]
- Carvalho, C.L.; Duarte, E.L.; Monteiro, M.; Botelho, A.; Albuquerque, T.; Fevereiro, M.; Henriques, A.M.; Barros, S.S.; Duarte, M.D. Challenges in the rabbit haemorrhagic disease 2 (RHDV2) molecular diagnosis of vaccinated rabbits. Vet. Microbiol. 2017, 198, 43–50. [Google Scholar] [CrossRef] [Green Version]
- Roldao, A.; Mellado, M.C.; Castilho, L.R.; Carrondo, M.J.; Alves, P.M. Virus-like particles in vaccine development. Expert Rev. Vaccines 2010, 9, 1149–1176. [Google Scholar] [CrossRef]
Primers Name | Gene Segment | Primers Sequence (5′→3′) | Product Size (nt) |
---|---|---|---|
VP60 F/R | VP60 | F: atggagggcaaagcccg | 1636 |
R: tcagacataagaaaagccattagttgtgcc |
Group | Quantity | Challenge after 2 Days | |
---|---|---|---|
Survived | Died | ||
Vaccinated | 15 | 14 | 1 |
Unvaccinated | 15 | 0 | 15 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Z.; Song, K.; Du, Y.; Zhang, Z.; Fan, R.; Zheng, P.; Liu, J. Diagnosis of a Rabbit Hemorrhagic Disease Virus 2 (RHDV2) and the Humoral Immune Protection Effect of VP60 Vaccine. Curr. Issues Mol. Biol. 2023, 45, 6605-6617. https://doi.org/10.3390/cimb45080417
Li Z, Song K, Du Y, Zhang Z, Fan R, Zheng P, Liu J. Diagnosis of a Rabbit Hemorrhagic Disease Virus 2 (RHDV2) and the Humoral Immune Protection Effect of VP60 Vaccine. Current Issues in Molecular Biology. 2023; 45(8):6605-6617. https://doi.org/10.3390/cimb45080417
Chicago/Turabian StyleLi, Zhaoming, Kaimin Song, Yongzhen Du, Zhuanglong Zhang, Rupeng Fan, Pimiao Zheng, and Jianzhu Liu. 2023. "Diagnosis of a Rabbit Hemorrhagic Disease Virus 2 (RHDV2) and the Humoral Immune Protection Effect of VP60 Vaccine" Current Issues in Molecular Biology 45, no. 8: 6605-6617. https://doi.org/10.3390/cimb45080417