LncRNA Expression Profiles in C6 Ceramide Treatment Reveal lnc_025370 as a Promoter in Canine Mammary Carcinoma CHMp Cells Progression
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Lines and Cell Culture
2.2. Cell Viability Assay
2.3. Colony Formation Assay
2.4. Sample Process and Transcriptome Sequencing
2.5. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.6. Nucleus-Cytoplasmic Separation
2.7. Cell Transfection
2.8. Cell Growth Curves
2.9. Cell Migration Assay
2.10. Invasion Assay
2.11. Western Blotting
2.12. Mouse Xenografts
2.13. Statistical Analysis
3. Results
3.1. The Growth Inhibition and LncRNA Expression Profiles Under the Treatment of C6 Ceramide in Chmp Cells
3.2. Overexpressing Lnc_025370 Promoted CHMp Cells Proliferation
3.3. Overexpressing Lnc_025370 Promoted CHMp Cells Metastasis
3.4. Overexpressing Lnc_025370 Attenuated Growth Inhibition of C6 Ceramide in CHMp Cells
3.5. Overexpressing Lnc_025370 Attenuated Metastasis Inhibition of C6 Ceramide in CHMp Cells
3.6. Lnc_025370 Promoted Xenograft Tumor Growth In Vivo
3.7. Lnc_025370 Promoted CHMp Cells Progress by Regulating NRG1
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zheng, H.H.; Du, C.T.; Yu, C.; Zhang, Y.Z.; Huang, R.L.; Tang, X.Y.; Xie, G.-H. Epidemiological Investigation of Canine Mammary Tumors in Mainland China Between 2017 and 2021. Front. Vet. Sci. 2022, 9, 843390. [Google Scholar] [CrossRef] [PubMed]
- Gedon, J.; Wehrend, A.; Failing, K.; Kessler, M. Canine mammary tumours: Size matters–A progression from low to highly malignant subtypes. Vet. Comp. Oncol. 2020, 19, 707–713. [Google Scholar] [CrossRef] [PubMed]
- Gray, M.; Meehan, J.; Martínez-Pérez, C.; Kay, C.; Turnbull, A.K.; Morrison, L.R.; Pang, L.Y.; Argyle, D. Naturally-Occurring Canine Mammary Tumors as a Translational Model for Human Breast Cancer. Front. Oncol. 2020, 10, 617. [Google Scholar] [CrossRef] [PubMed]
- Klopfleisch, R.; von Euler, H.; Sarli, G.; Pinho, S.S.; Gärtner, F.; Gruber, A.D. Molecular Carcinogenesis of Canine Mammary Tumors. Vet. Pathol. 2010, 48, 98–116. [Google Scholar] [CrossRef] [PubMed]
- Stratmann, N.; Failing, K.; Richter, A.; Wehrend, A. Mammary tumor recurrence in bitches after regional mastectomy. Vet. Surg. 2008, 37, 82–86. [Google Scholar] [CrossRef]
- Sleeckx, N.; de Rooster, H.; Veldhuis Kroeze, E.J.B.; Van Ginneken, C.; Van Brantegem, L. Canine Mammary Tumours, an Overview. Reprod. Domest. Anim. 2011, 46, 1112–1131. [Google Scholar] [CrossRef]
- Zhang, P.; Fu, C.; Hu, Y.; Dong, C.; Song, Y.; Song, E. C6-ceramide nanoliposome suppresses tumor metastasis by eliciting PI3K and PKCζ tumor-suppressive activities and regulating integrin affinity modulation. Sci. Rep. 2015, 5, 9275. [Google Scholar] [CrossRef]
- Migotto, A.; Carvalho, V.F.M.; Salata, G.C.; da Silva, F.W.M.; Yan, C.Y.I.; Ishida, K.; Costa-Lotufo, L.V.; Steiner, A.A.; Lopes, L.B. Multifunctional nanoemulsions for intraductal delivery as a new platform for local treatment of breast cancer. Drug Deliv. 2018, 25, 654–667. [Google Scholar] [CrossRef]
- Cruz, A.F.; Fonseca, N.A.; Malheiro, A.R.; Melo, J.B.; Gaspar, M.M.; Fernandes, R.; Moura, V.; Simões, S.; Moreira, J.N. Targeted liposomal doxorubicin/ceramides combinations: The importance to assess the nature of drug interaction beyond bulk tumor cells. Eur. J. Pharm. Biopharm. 2022, 172, 61–77. [Google Scholar] [CrossRef]
- Thim, E.A.; Fox, T.; Deering, T.; Vass, L.R.; Sheybani, N.D.; Kester, M.; Price, R.J. Solid tumor treatment via augmentation of bioactive C6 ceramide levels with thermally ablative focused ultrasound. Drug Deliv. Transl. Res. 2023, 13, 3145–3153. [Google Scholar] [CrossRef]
- Companioni, O.; Mir, C.; Garcia-Mayea, Y.; Lleonart, M.E. Targeting Sphingolipids for Cancer Therapy. Front. Oncol. 2021, 11, 745092. [Google Scholar] [CrossRef] [PubMed]
- Gherman, L.-M.; Chiroi, P.; Nuţu, A.; Bica, C.; Berindan-Neagoe, I. Profiling canine mammary tumors: A potential model for studying human breast cancer. Vet. J. 2024, 303, 106055. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez-Bejarano, O.H.; Roa, L.; Vargas-Hernández, G.; Botero-Espinosa, L.; Parra-López, C.; Patarroyo, M.A. Strategies for studying immune and non-immune human and canine mammary gland cancer tumour infiltrate. Biochim. Biophys. Acta Rev. Cancer 2023, 1879, 189064. [Google Scholar] [CrossRef] [PubMed]
- Grillone, K.; Riillo, C.; Scionti, F.; Rocca, R.; Tradigo, G.; Guzzi, P.H.; Alcaro, S.; Di Martino, M.T.; Tagliaferri, P.; Tassone, P. Non-coding RNAs in cancer: Platforms and strategies for investigating the genomic “dark matter”. J. Exp. Clin. Cancer Res. 2020, 39, 117. [Google Scholar] [CrossRef]
- Hu, X.; Sood, A.K.; Dang, C.V.; Zhang, L. The role of long noncoding RNAs in cancer: The dark matter matters. Curr. Opin. Genet. Dev. 2018, 48, 8–15. [Google Scholar] [CrossRef]
- Aprile, M.; Costa, V.; Cimmino, A.; Calin, G.A. Emerging role of oncogenic long noncoding RNA as cancer biomarkers. Int. J. Cancer 2022, 152, 822–834. [Google Scholar] [CrossRef]
- Liu, S.; Sun, Y.; Hou, Y.; Yang, L.; Wan, X.; Qin, Y.; Liu, Y.; Wang, R.; Zhu, P.; Teng, Y.; et al. A novel lncRNA ROPM-mediated lipid metabolism governs breast cancer stem cell properties. J. Hematol. Oncol. 2021, 14, 178. [Google Scholar] [CrossRef]
- Park, M.K.; Zhang, L.; Min, K.-W.; Cho, J.-H.; Yeh, C.-C.; Moon, H.; Hormaechea-Agulla, D.; Mun, H.; Ko, S.; Lee, J.W.; et al. NEAT1 is essential for metabolic changes that promote breast cancer growth and metastasis. Cell Metab. 2021, 33, 2380–2397. [Google Scholar] [CrossRef]
- Zhang, Y.; Dong, X.; Guo, X.; Li, C.; Fan, Y.; Liu, P.; Yuan, D.; Ma, X.; Wang, J.; Zheng, J.; et al. LncRNA-BC069792 suppresses tumor progression by targeting KCNQ4 in breast cancer. Mol. Cancer 2023, 22, 41. [Google Scholar] [CrossRef]
- Le Béguec, C.; Wucher, V.; Lagoutte, L.; Cadieu, E.; Botherel, N.; Hédan, B.; De Brito, C.; Guillory, A.-S.; André, C.; Derrien, T.; et al. Characterisation and functional predictions of canine long non-coding RNAs. Sci. Rep. 2018, 8, 13444. [Google Scholar] [CrossRef]
- Lu, B.; Wu, J.; Chen, H.; Li, S.; Jia, K. LncRNA Expression Profiles in Canine Mammary Tumors Identify lnc34977 as a Promoter of Proliferation, Migration and Invasion of Canine Mammary Tumor Cells. Vet. Sci. 2022, 9, 82. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Wu, M.; Zhou, J.; Diao, H. Long Non-Coding RNA as a Potential Biomarker for Canine Tumors. Vet. Sci. 2023, 10, 637. [Google Scholar] [CrossRef] [PubMed]
- Ogretmen, B.; Hannun, Y.A. Biologically active sphingolipids in cancer pathogenesis and treatment. Nat. Rev. Cancer 2004, 4, 604–616. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Goyal, N.; Dai, L.; Lin, Z.; Del Valle, L.; Zabaleta, J.; Liu, J.; Post, S.R.; Foroozesh, M.; Qin, Z. Developing new ceramide analogs and identifying novel sphingolipid-controlled genes against a virus-associated lymphoma. Blood 2020, 136, 2175–2187. [Google Scholar] [CrossRef]
- Qi, X.; Wu, F.; Kim, S.H.; Kaifi, J.T.; Kimchi, E.T.; Snyder, H.; Illendula, A.; Fox, T.; Kester, M.; Staveley-O’Carroll, K.F.; et al. Nanoliposome C6-Ceramide in combination with anti-CTLA4 antibody improves anti-tumor immunity in hepatocellular cancer. FASEB J. 2022, 36, e22250. [Google Scholar] [CrossRef]
- Wilhelm, R.; Eckes, T.; Imre, G.; Kippenberger, S.; Meissner, M.; Thomas, D.; Trautmann, S.; Merlio, J.P.; Chevret, E.; Kaufmann, R.; et al. C6 Ceramide (d18:1/6:0) as a Novel Treatment of Cutaneous T Cell Lymphoma. Cancers 2021, 13, 270. [Google Scholar] [CrossRef]
- Zhang, X.; Kitatani, K.; Toyoshima, M.; Ishibashi, M.; Usui, T.; Minato, J.; Egiz, M.; Shigeta, S.; Fox, T.; Deering, T.; et al. Ceramide Nanoliposomes as a MLKL-Dependent, Necroptosis-Inducing, Chemotherapeutic Reagent in Ovarian Cancer. Mol. Cancer Ther. 2018, 17, 50–59. [Google Scholar] [CrossRef]
- Fujiwara, K.; Yazama, H.; Donishi, R.; Koyama, S.; Fukuhara, T.; Kitatani, K.; Kataoka, H.; Takeuchi, H. C6-ceramide Inhibits the Motility of Anaplastic Thyroid Carcinoma Cells. Yonago Acta Med. 2020, 63, 95–98. [Google Scholar] [CrossRef]
- Che, J.; Huang, Y.; Xu, C.; Zhang, P. Increased ceramide production sensitizes breast cancer cell response to chemotherapy. Cancer Chemother. Pharmacol. 2017, 79, 933–941. [Google Scholar] [CrossRef]
- Yang, L.; Zheng, L.-Y.; Tian, Y.; Zhang, Z.-Q.; Dong, W.-L.; Wang, X.-F.; Zhang, X.-Y.; Cao, C. C6 ceramide dramatically enhances docetaxel-induced growth inhibition and apoptosis in cultured breast cancer cells: A mechanism study. Exp. Cell Res. 2015, 332, 47–59. [Google Scholar] [CrossRef]
- Flowers, M.; Fabriás, G.; Delgado, A.; Casas, J.; Abad, J.L.; Cabot, M.C. C6-Ceramide and targeted inhibition of acid ceramidase induce synergistic decreases in breast cancer cell growth. Breast Cancer Res. Treat. 2011, 133, 447–458. [Google Scholar] [CrossRef] [PubMed]
- Bridges, M.C.; Daulagala, A.C.; Kourtidis, A. LNCcation: lncRNA localization and function. J. Cell Biol. 2021, 220, e202009045. [Google Scholar] [CrossRef] [PubMed]
- Kugel, J.F.; Goodrich, J.A. Non-coding RNAs: Key regulators of mammalian transcription. Trends Biochem. Sci. 2012, 37, 144–151. [Google Scholar] [CrossRef] [PubMed]
- Melé, M.; Rinn John, L. “Cat’s Cradling” the 3D Genome by the Act of LncRNA Transcription. Mol. Cell 2016, 62, 657–664. [Google Scholar] [CrossRef] [PubMed]
- Yuan, J.H.; Liu, X.N.; Wang, T.T.; Pan, W.; Tao, Q.F.; Zhou, W.P.; Wang, F.; Sun, S.H. The MBNL3 splicing factor promotes hepatocellular carcinoma by increasing PXN expression through the alternative splicing of lncRNA-PXN-AS1. Nat. Cell Biol. 2017, 19, 820–832. [Google Scholar] [CrossRef]
- Lee, S.; Kopp, F.; Chang, T.-C.; Sataluri, A.; Chen, B.; Sivakumar, S.; Yu, H.; Xie, Y.; Mendell, J.T. Noncoding RNA NORAD Regulates Genomic Stability by Sequestering PUMILIO Proteins. Cell 2016, 164, 69–80. [Google Scholar] [CrossRef]
- Falls, D. Neuregulins: Functions, forms, and signaling strategies. Exp. Cell Res. 2003, 284, 14–30. [Google Scholar] [CrossRef]
- Park, J.; Sarode, V.R.; Euhus, D.; Kittler, R.; Scherer, P.E. Neuregulin 1-HER axis as a key mediator of hyperglycemic memory effects in breast cancer. Proc. Natl. Acad. Sci. USA 2012, 109, 21058–21063. [Google Scholar] [CrossRef]
- Yun, S.; Koh, J.; Nam, S.K.; Park, J.O.; Lee, S.M.; Lee, K.; Lee, K.S.; Ahn, S.-H.; Park, D.J.; Kim, H.-H.; et al. Clinical significance of overexpression of NRG1 and its receptors, HER3 and HER4, in gastric cancer patients. Gastric Cancer 2017, 21, 225–236. [Google Scholar] [CrossRef]
- De luliis, F.; Salerno, G.; Taglieri, L.; Lanza, R.; Cardelli, P.; Scarpa, S. Circulating Neuregulin-1 and Galectin-3 can be Prognostic Markers in Breast Cancer. Int. J. Biol. Markers 2017, 32, 333–336. [Google Scholar] [CrossRef]
- Chandra Gupta, S.; Nandan Tripathi, Y. Potential of long non-coding RNAs in cancer patients: From biomarkers to therapeutic targets. Int. J. Cancer 2016, 140, 1955–1967. [Google Scholar] [CrossRef] [PubMed]
Genes | Sequence (5’→3’) |
---|---|
Lnc_025370 | Forward: GTAGTGGCAATCCAAGAAGGAG Reverse: AAAGTCATACCAGGCAAGAAGG |
Lnc_005073 | Forward: CTGCACCTCCTCCATACTTACC Reverse: CCTGAGCAATACCTGTCTCTCC |
Lnc_012045 | Forward: TGCCAACTAAAACACAGGTCAG Reverse: ACATGGCAGTGGGATGAAAG |
Lnc_043506 | Forward: ACTCCCTTGGCTACCAGATAC Reverse: CGTCAAGAAGGACTTTAAGCAG |
Lnc_039293 | Forward: TATATGCTGGCCAAAGCTCAC Reverse: TAGCACAGTGTTTTCCTGGTTC |
Lnc_011725 | Forward: ATGCGCTCTCTCTCTCTCTCTC Reverse: GATTCCAGGCCACTCTAATCTC |
Lnc_008774 | Forward: GGGAGCTGTACTGTGGGTTC Reverse: TGACCCTGTATGGCTCTGTG |
Lnc_016795 | Forward: GCAAACATCATAGAAGGGGATG Reverse: GGAGAACATTTGGCAGAGAGAG |
Lnc_019527 | Forward: TGACTGATGACTACGAGGAAGG Reverse: TTTAAGTCGCGTGCTCTGTG |
Lnc_007403 | Forward: TGAAATCAGTGTCCCAAGAGG Reverse: AACCTGGAACCCACAGAGTTAG |
Lnc_022140 | Forward: AGGCCTCGGTTCCTTAAGAC Reverse: ACACGCCGAGAAGTTTCATT |
Lnc_039502 | Forward: TAGTGAATTCGGGCATACAGG Reverse: GCCAACGATGTATTCAACAGG |
Lnc_020255 | Forward: CGTTGCATCCTCTGGTTGTA Reverse: GCAGATCGGAGTTGAGAAGG |
Lnc_020908 | Forward: TCAGGAGCAAGTGAAGAGTAGG Reverse: AATGGACAGACGACAGGTACAG |
NRG1 | Forward: ATGGTTCAAGAACGGGAATG Reverse: CGATGGTGATATTGGCAGAG |
GAPDH | Forward: ATGTTTGTGATGGGCGTGAA Reverse: GCTAGAGGAGCCAAGCAGTT |
U6 | Forward: AAGATGGCGGACAAAGAG Reverse: CTCTGTCAGCTTGTACTGGTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Diao, H.; Zhao, F.; Wu, M.; Zhang, Y.; Tao, Q.; Chen, S.; Lin, D. LncRNA Expression Profiles in C6 Ceramide Treatment Reveal lnc_025370 as a Promoter in Canine Mammary Carcinoma CHMp Cells Progression. Curr. Issues Mol. Biol. 2024, 46, 14190-14203. https://doi.org/10.3390/cimb46120849
Diao H, Zhao F, Wu M, Zhang Y, Tao Q, Chen S, Lin D. LncRNA Expression Profiles in C6 Ceramide Treatment Reveal lnc_025370 as a Promoter in Canine Mammary Carcinoma CHMp Cells Progression. Current Issues in Molecular Biology. 2024; 46(12):14190-14203. https://doi.org/10.3390/cimb46120849
Chicago/Turabian StyleDiao, Hongxiu, Fangying Zhao, Meijin Wu, Yan Zhang, Qianting Tao, Shichao Chen, and Degui Lin. 2024. "LncRNA Expression Profiles in C6 Ceramide Treatment Reveal lnc_025370 as a Promoter in Canine Mammary Carcinoma CHMp Cells Progression" Current Issues in Molecular Biology 46, no. 12: 14190-14203. https://doi.org/10.3390/cimb46120849
APA StyleDiao, H., Zhao, F., Wu, M., Zhang, Y., Tao, Q., Chen, S., & Lin, D. (2024). LncRNA Expression Profiles in C6 Ceramide Treatment Reveal lnc_025370 as a Promoter in Canine Mammary Carcinoma CHMp Cells Progression. Current Issues in Molecular Biology, 46(12), 14190-14203. https://doi.org/10.3390/cimb46120849