Molecular Characterization and Expression Changes of the bcl2l13 Gene in Response to Hypoxia in Megalobrama amblycephala
Abstract
:1. Introduction
2. Materials and Methods
2.1. M. amblycephala Maintenance and Sample Collection
2.2. Real-Time PCR
2.3. Sequence Alignment and Analysis
2.4. Cell Culture and Plasmid Constructs
2.5. Cell Transfection, Luciferase Reporter Assays and Subcellular Localization
2.6. Statistical Analysis
3. Results
3.1. Cloning and Molecular Characterization of M. amblycephala bcl2l13
3.2. Subcellular Localization of Bcl2l13
3.3. Spatial-Temporal Expression Patterns of M. amblycephala bcl2l13
3.4. Hypoxia Effect on Expression of bcl2l13 and Autophagy-Related Genes
3.5. Activity Analysis of M. amblycephala bcl2l13 Promoter and Hif-1α Regulation
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cebollero, E.; Reggiori, F. Regulation of autophagy in yeast Saccharomyces cerevisiae. Biochim. Biophys. Acta 2009, 1793, 1413–1421. [Google Scholar] [CrossRef]
- Narendra, D.; Tanaka, A.; Suen, D.F.; Youle, R.J. Parkin is recruited selectively to impaired mitochondria and promotes their autophagy. J. Cell Biol. 2008, 183, 795–803. [Google Scholar] [CrossRef]
- Deretic, V.; Levine, B. Autophagy, immunity, and microbial adaptations. Cell Host Microbe 2009, 5, 527–549. [Google Scholar] [CrossRef] [PubMed]
- Nixon, R.A. The role of autophagy in neurodegenerative disease. Nat. Med. 2013, 19, 983–997. [Google Scholar] [CrossRef]
- Kanki, T.; Wang, K.; Cao, Y.; Baba, M.; Klionsky, D.J. Atg32 is a mitochondrial protein that confers selectivity during mitophagy. Dev. Cell 2009, 17, 98–109. [Google Scholar] [CrossRef]
- Kataoka, T.; Holler, N.; Micheau, O.; Martinon, F.; Tinel, A.; Hofmann, K.; Tschopp, J. Bcl-rambo, a novel Bcl-2 homologue that induces apoptosis via its unique C-terminal extension. J. Biol. Chem. 2001, 276, 19548–19554. [Google Scholar] [CrossRef] [PubMed]
- Otsu, K.; Murakawa, T.; Yamaguchi, O. BCL2L13 is a mammalian homolog of the yeast mitophagy receptor Atg32. Autophagy 2015, 11, 1932–1933. [Google Scholar] [CrossRef] [PubMed]
- Murakawa, T.; Yamaguchi, O.; Hashimoto, A.; Hikoso, S.; Takeda, T.; Oka, T.; Yasui, H.; Ueda, H.; Akazawa, Y.; Nakayama, H.; et al. Bcl-2-like protein 13 is a mammalian Atg32 homologue that mediates mitophagy and mitochondrial fragmentation. Nat. Commun. 2015, 6, 7527. [Google Scholar] [CrossRef]
- Meng, F.; Sun, N.; Liu, D.; Jia, J.; Xiao, J.; Dai, H. BCL2L13: Physiological and pathological meanings. Cell Mol. Life Sci. 2021, 78, 2419–2428. [Google Scholar] [CrossRef]
- Lee, P.; Chandel, N.S.; Simon, M.C. Cellular adaptation to hypoxia through hypoxia inducible factors and beyond. Nat. Rev. Mol. Cell Biol. 2020, 21, 268–283. [Google Scholar] [CrossRef]
- Bellot, G.; Garcia-Medina, R.; Gounon, P.; Chiche, J.; Roux, D.; Pouysségur, J.; Mazure, N.M. Hypoxia-induced autophagy is mediated through hypoxia-inducible factor induction of BNIP3 and BNIP3L via their BH3 domains. Mol. Cell Biol. 2009, 29, 2570–2581. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Feng, D.; Chen, G.; Chen, M.; Zheng, Q.; Song, P.; Ma, Q.; Zhu, C.; Wang, R.; Qi, W.; et al. Mitochondrial outer-membrane protein FUNDC1 mediates hypoxia-induced mitophagy in mammalian cells. Nat. Cell Biol. 2012, 14, 177–185. [Google Scholar] [CrossRef] [PubMed]
- Ren, M.; Habte-Tsion, H.M.; Xie, J.; Liu, B.; Zhou, Q.; Ge, X.; Pan, L. Effects of dietary carbohydrate source on growth performance, diet digestibility and liver glucose enzyme activity in blunt snout bream, Megalobrama amblycephala. Aquaculture 2015, 438, 75–81. [Google Scholar] [CrossRef]
- Wu, C.B.; Liu, Z.Y.; Li, F.G.; Chen, J.; Jiang, X.Y.; Zou, S.M. Gill remodeling in response to hypoxia and temperature occurs in the hypoxia sensitive blunt snout bream (Megalobrama amblycephala). Aquaculture 2017, 479, 479–486. [Google Scholar] [CrossRef]
- Zhao, Y.; Gul, Y.; Li, S.; Wang, W. Cloning, identification and accurate normalization expression analysis of PPARα gene by GeNorm in Megalobrama amblycephala. Fish Shellfish Immunol. 2011, 31, 462–468. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Sambrook, J.D.; Russell, W. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 2000. [Google Scholar]
- Fujiwara, M.; Tian, L.; Le, P.T.; DeMambro, V.E.; Becker, K.A.; Rosen, C.J.; Guntur, A.R. The mitophagy receptor Bcl-2-like protein 13 stimulates adipogenesis by regulating mitochondrial oxidative phosphorylation and apoptosis in mice. J. Biol. Chem. 2019, 294, 12683–12694. [Google Scholar] [CrossRef]
- Guillemin, Y.; Lalle, P.; Gillet, G.; Guerin, J.F.; Hamamah, S.; Aouacheria, A. Oocytes and early embryos selectively express the survival factor BCL2L10. J. Mol. Med. 2009, 87, 923–940. [Google Scholar] [CrossRef]
- Arnaud, E.; Ferri, K.F.; Thibaut, J.; Haftek-Terreau, Z.; Aouacheria, A.; Le Guellec, D.; Lorca, T.; Gillet, G. The zebrafish bcl-2 homologue Nrz controls development during somitogenesis and gastrulation via apoptosis-dependent and -independent mechanisms. Cell Death Differ. 2006, 13, 1128–1137. [Google Scholar] [CrossRef]
- Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of embryonic development of the zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef]
- Ávila-Arcos, M.C.; McManus, K.F.; Sandoval, K.; Rodríguez-Rodríguez, J.E.; Villa-Islas, V.; Martin, A.R.; Luisi, P.; Peñaloza-Espinosa, R.I.; Eng, C.; Huntsman, S.; et al. Population history and gene divergence in native mexicans inferred from 76 human exomes. Mol. Biol. Evol. 2020, 37, 994–1006. [Google Scholar] [CrossRef]
- Arribat, Y.; Broskey, N.T.; Greggio, C.; Boutant, M.; Conde Alonso, S.; Kulkarni, S.S.; Lagarrigue, S.; Carnero, E.A.; Besson, C.; Cantó, C.; et al. Distinct patterns of skeletal muscle mitochondria fusion, fission and mitophagy upon duration of exercise training. Acta Physiol. 2019, 225, e13179. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.L.; Lin, S.R.; Chen, J.S.; Lin, S.W.; Yu, S.L.; Chen, H.Y.; Yen, C.T.; Lin, C.Y.; Lin, J.F.; Lin, K.H.; et al. Expression and prognostic significance of the apoptotic genes BCL2L13, Livin, and CASP8AP2 in childhood acute lymphoblastic leukemia. Leuk. Res. 2010, 34, 18–23. [Google Scholar] [CrossRef] [PubMed]
- Holleman, A.; den Boer, M.L.; de Menezes, R.X.; Cheok, M.; Cheng, C.; Kazemier, K.M.; Janka-Schaub, G.E.; Göbel, U.; Graubner, U.B.; Evans, W.E.; et al. The expression of 70 apoptosis genes in relation to lineage, genetic subtype, cellular drug resistance, and outcome in childhood acute lymphoblastic leukemia. Blood 2006, 107, 769–776. [Google Scholar] [CrossRef] [PubMed]
- Ding, H.; Chen, W.; Chen, X. Serum miR-96-5p is a novel and non-invasive marker of acute myocardial infarction associated with coronary artery disease. Bioengineered 2022, 13, 3930–3943. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.; Guo, J.; Zeng, J.; Zhang, X.; Chen, R.; Wang, G.; Liang, W. LncRNA SNHG14 is beneficial to oxygen glucose deprivation/reoxygenation-induced neuro-2a cell injury via mir-98-5p sequestration-caused BCL2L13 upregulation. Metab. Brain Dis. 2022, 37, 2005–2016. [Google Scholar] [CrossRef]
- Mazure, N.M.; Pouysségur, J. Hypoxia-induced autophagy: Cell death or cell survival? Curr. Opin. Cell Biol. 2010, 22, 177–180. [Google Scholar] [CrossRef]
- Li, H.; Zhu, C.; Tao, Z.; Xu, W.; Song, W.; Hu, Y.; Zhu, W.; Song, C. Myod and myf6 gene expression patterns in skeletal muscle during embryonic and posthatch development in the domestic duck (Anas platyrhynchos domestica). J. Anim. Breed. Genet. 2014, 131, 194–201. [Google Scholar] [CrossRef]
- Lazure, F.; Blackburn, D.M.; Corchado, A.H.; Sahinyan, K.; Karam, N.; Sharanek, A.; Nguyen, D.; Lepper, C.; Najafabadi, H.S.; Perkins, T.J.; et al. Myf6/MRF4 is a myogenic niche regulator required for the maintenance of the muscle stem cell pool. EMBO Rep. 2020, 21, e49499. [Google Scholar] [CrossRef]
Name of Primers | Sequence of Primers (5′-3′) | Use |
---|---|---|
pro-bcl2l13-F-1 | CCTTGCAAAGATGGACAGACT | promoter |
pro-bcl2l13-F-2 | CGTGGCTTCATCCTCTTG | |
pro-bcl2l13-F-3 | CTCATATCAAGCAGTCAAGCG | |
pro-bcl2l13-R | ATCTCTTACCCTCCGCTGTC | |
bcl2l13-WT-F | CGACGCGTCTTACACCATTTGAGGGCAG | HRE confirmation |
bcl2l13-WT-R | GGAAGATCTTTACAGTTTTCACAAGTCCT | |
bcl2l13-WT-HRE1-Fm | CGTTTAAGATGAAGTGTGCGT | |
bcl2l13-WT-HRE1-Rm | ACGCACACTTCATCTTAAACG | |
bcl2l13-WT-HRE2-Fm | TCCCCCGGGATGTCTGAACAC | |
bcl2l13-WT-HRE2-Rm | TCCCCCGGGGAGTGGTGTCCATG | |
bcl2l13-WT-HRE3-Fm | TCCCCCGGGGTTACATTGTAC | |
bcl2l13-WT-HRE3-Rm | TCCCCCGGGGGACACCCACTGCAC | |
bcl2l13-ORF-F | CGAAGCTTATGGCTGCCTCTGGCTCCTCCACCACAGTG | ORF |
bcl2l13-ORF-R | GCGGATCCCTCTTCTTCCTGTAGGCCAGC | |
bcl2l13-qRT-F | TGGGCAGCGAAAGCGAACT | Real-time PCR |
bcl2l13-qRT-R | ACGGGCAATGAGGCGGTAG | |
bnip3l-qRT-F | GAGGAGGATGATGGGATGGT | |
bnip3l-qRT-R | AGTTACTACTACGGCTGGATTCG | |
bnip3-qRT-F | CGTTCCAGCACACTCAGCAT | |
bnip3-qRT-R | AGTAGTAATACGCCTTCCGA | |
bax-qRT-F | CTTTTCTACTTTGCGTGCCG | |
bax-qRT-R | CTGCCAGGAAAACCCCAA | |
becn1-qRT-F | GAGTTGCCATTGTATTGC | |
becn1-qRT-R | GAACCTCCACTGCCACCG | |
parkin-qRT-F | GCTGTGGGTTTGTGTTTT | |
parkin-qRT-R | ATGAGTGGTTTTGGCTAT | |
fundc1-qRT-F | AGGATGGTGTGCTGGATA | |
fundc1-qRT-R | CAGGGGCTGCTTTGTTTG | |
p62-qRT-F | GCAGTGATGAGGAATGGA | |
p62-qRT-R | GGACCCTGTGTGTCGCTTGT | |
18S-rRNA-qRT-F | CGGAGGTTCGAAGACGATCA | |
18S-rRNA-qRT-R | GGGTCGGCATCGTTTACG | |
β-actin-qRT-F | ACCCACACCGTGCCCATCTA | |
β-actin-qRT-R | CGGACAATTTCTCTTTCGGCTG |
Name | Score | Predicted Sequences | Region |
---|---|---|---|
MA0497.1.MEF2C | 15.95222 | GAAACAAAAATAGAT | −475 to +111 |
MA0041.2.FOXD3 | 14.70476 | AGAACAAACAAACAAA | |
MA1487.1.FOXE1 | 14.64539 | CCTAGAACAAACAAA | |
MA0508.2.PRDM1 | 13.98241 | TCACTTTCAA | |
MA0042.1.FOXI1 | 13.57833 | TTTTGTTTGTTT | |
MA0465.2.CDX2 | 13.49907 | TTGCAATAAACG | |
MA0905.1.HOXC10 | 13.41888 | GTCATTAAAT | |
MA1530.1.NKX6-3 | 13.38798 | GTCATTAAA | |
MA0869.2.Sox11 | 13.35816 | GAGCACAAAGGA | |
MA0514.1.Sox3 | 13.29434 | CCTTTGTGCT | |
MA0909.3.Hoxd13 | 13.01262 | TGCAATAAAC | |
MA0667.1.MYF6 | 16.66626 | TGTACACAATGTTCT | −998 to −475 |
MA1125.1.ZNF384 | 16.30834 | TTGTACACAATGTTCTA | |
MA0113.2.NR3C1 | 16.2096 | ACCACTTAA | |
MA0727.1.NR3C2 | 15.97045 | ATTTATTTTTTT | |
MA0647.1.GRHL1 | 14.76465 | CGCACGCGGA | |
MA1640.1.MEIS2 | 14.7477 | GTACAATGTAA | |
MA0124.2.Nkx3-1 | 14.69338 | TTGTACACAAT | |
MA1113.2.PBX2 | 14.62967 | AACATTGTG | |
MA1968.1.TFCP2 | 14.54535 | TAAATCACTT | |
MA0007.2.AR | 14.41048 | ACACAATGTTC | |
MA0122.3.Nkx3-2 | 14.16071 | TTAAGTGGT | |
MA1511.1.KLF10 | 14.00595 | CGCGTG | |
MA0672.1.NKX2-3 | 13.95893 | CGCGTG | |
MA0122.2.NKX3-2 | 13.94363 | CGCGTG | |
MA1963.1.SATB1 | 13.54465 | CACCTT | |
MA0632.2.TCFL5 | 13.49938 | CACCTT | |
MA0506.1.NRF1 | 13.23179 | ATCAAA | |
MA1639.1.MEIS1 | 13.08374 | TTAAGTG | |
MA0624.2.Nfatc1 | 13.01802 | ATGAGTGGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, A.; Guo, X.; Bao, K.; Wu, D.; Liu, H.; Gao, Z.; Wang, H. Molecular Characterization and Expression Changes of the bcl2l13 Gene in Response to Hypoxia in Megalobrama amblycephala. Curr. Issues Mol. Biol. 2024, 46, 1136-1149. https://doi.org/10.3390/cimb46020072
Zhang A, Guo X, Bao K, Wu D, Liu H, Gao Z, Wang H. Molecular Characterization and Expression Changes of the bcl2l13 Gene in Response to Hypoxia in Megalobrama amblycephala. Current Issues in Molecular Biology. 2024; 46(2):1136-1149. https://doi.org/10.3390/cimb46020072
Chicago/Turabian StyleZhang, Axin, Xuefei Guo, Kaikai Bao, Danyang Wu, Hong Liu, Zexia Gao, and Huanling Wang. 2024. "Molecular Characterization and Expression Changes of the bcl2l13 Gene in Response to Hypoxia in Megalobrama amblycephala" Current Issues in Molecular Biology 46, no. 2: 1136-1149. https://doi.org/10.3390/cimb46020072