Are COVID-19 Polymorphisms in ACE and ACE2 Prognosis Predictors?
Abstract
:1. Introduction
2. Materials and Methods
2.1. Participants and Sample
2.2. DNA Extraction
2.3. Library Preparation
2.4. Next-Generation Sequencing (NGS) and Data Analysis
3. Results
3.1. Angiotensin-Converting Enzyme (ACE) Polymorphisms
3.2. Angiotensin-Converting Enzyme 2 (ACE2) Polymorphisms
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Martinez-Gomez, L.E.; Herrera-Lopez, B.; Martinez-Armenta, C.; Ortega-Pena, S.; Camacho-Rea, M.D.C.; Suarez-Ahedo, C.; Vazquez-Cardenas, P.; Vargas-Alarcon, G.; Rojas-Velasco, G.; Fragoso, J.M.; et al. ACE and ACE2 Gene Variants Are Associated With Severe Outcomes of COVID-19 in Men. Front. Immunol. 2022, 13, 812940. [Google Scholar] [CrossRef] [PubMed]
- Osuchowski, M.F.; Winkler, M.S.; Skirecki, T.; Cajander, S.; Shankar-Hari, M.; Lachmann, G.; Monneret, G.; Venet, F.; Bauer, M.; Brunkhorst, F.M.; et al. The COVID-19 puzzle: Deciphering pathophysiology and phenotypes of a new disease entity. Lancet Respir. Med. 2021, 9, 622–642. [Google Scholar] [CrossRef] [PubMed]
- Rigat, B.; Hubert, C.; Alhenc-Gelas, F.; Cambien, F.; Corvol, P.; Soubrier, F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J. Clin. Investig. 1990, 86, 1343–1346. [Google Scholar] [CrossRef] [PubMed]
- Delanghe, J.R.; Speeckaert, M.M.; De Buyzere, M.L. COVID-19 infections are also affected by human ACE1 D/I polymorphism. Clin. Chem. Lab. Med. 2020, 58, 1125–1126. [Google Scholar] [CrossRef] [PubMed]
- Montgomery, H.E.; Clarkson, P.; Dollery, C.M.; Prasad, K.; Losi, M.A.; Hemingway, H.; Statters, D.; Jubb, M.; Girvain, M.; Varnava, A.; et al. Association of angiotensin-converting enzyme gene I/D polymorphism with change in left ventricular mass in response to physical training. Circulation 1997, 96, 741–747. [Google Scholar] [CrossRef] [PubMed]
- Keikha, M.; Karbalaei, M. Global distribution of ACE1 (rs4646994) and ACE2 (rs2285666) polymorphisms associated with COVID-19: A systematic review and meta-analysis. Microb. Pathog. 2022, 172, 105781. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, A.; Bandopadhyay, A.; Das, D.; Pandey, R.K.; Singh, V.; Khanam, N.; Srivastava, N.; Singh, P.P.; Dubey, P.K.; Pathak, A.; et al. Genetic Association of ACE2 rs2285666 Polymorphism With COVID-19 Spatial Distribution in India. Front. Genet. 2020, 11, 564741. [Google Scholar] [CrossRef] [PubMed]
- Yaghoobi, A.; Lord, J.S.; Rezaiezadeh, J.S.; Yekaninejad, M.S.; Amini, M.; Izadi, P. TMPRSS2 polymorphism (rs12329760) and the severity of the COVID-19 in Iranian population. PLoS ONE 2023, 18, e0281750. [Google Scholar] [CrossRef] [PubMed]
- Gallo Marin, B.; Aghagoli, G.; Lavine, K.; Yang, L.; Siff, E.J.; Chiang, S.S.; Salazar-Mather, T.P.; Dumenco, L.; Savaria, M.C.; Aung, S.N.; et al. Predictors of COVID-19 severity: A literature review. Rev. Med. Virol. 2021, 31, 1–10. [Google Scholar] [CrossRef]
- Iba, T.; Levy, J.H.; Levi, M.; Thachil, J. Coagulopathy in COVID-19. J. Thromb. Haemost. 2020, 18, 2103–2109. [Google Scholar] [CrossRef]
- Pati, A.; Mahto, H.; Padhi, S.; Panda, A.K. ACE deletion allele is associated with susceptibility to SARS-CoV-2 infection and mortality rate: An epidemiological study in the Asian population. Clin. Chim. Acta 2020, 510, 455–458. [Google Scholar] [CrossRef] [PubMed]
- Adamzik, M.; Frey, U.; Sixt, S.; Knemeyer, L.; Beiderlinden, M.; Peters, J.; Siffert, W. ACE I/D but not AGT (-6)A/G polymorphism is a risk factor for mortality in ARDS. Eur. Respir. J. 2007, 29, 482–488. [Google Scholar] [CrossRef] [PubMed]
- Zheng, H.; Cao, J.J. Angiotensin-Converting Enzyme Gene Polymorphism and Severe Lung Injury in Patients with Coronavirus Disease 2019. Am. J. Pathol. 2020, 190, 2013–2017. [Google Scholar] [CrossRef] [PubMed]
- Gomez, J.; Albaiceta, G.M.; Garcia-Clemente, M.; Lopez-Larrea, C.; Amado-Rodriguez, L.; Lopez-Alonso, I.; Hermida, T.; Enriquez, A.I.; Herrero, P.; Melon, S.; et al. Angiotensin-converting enzymes (ACE, ACE2) gene variants and COVID-19 outcome. Gene 2020, 762, 145102. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, N.; Ariumi, Y.; Nishida, N.; Yamamoto, R.; Bauer, G.; Gojobori, T.; Shimotohno, K.; Mizokami, M. SARS-CoV-2 infections and COVID-19 mortalities strongly correlate with ACE1 I/D genotype. Gene 2020, 758, 144944. [Google Scholar] [CrossRef] [PubMed]
- Boraey, N.F.; Bebars, M.A.; Wahba, A.A.; Abd El Lateef, H.M.; Attia, M.A.; Elsayed, A.H.; Rashed, K.A.; Sorour, E.I.; Ahmed, M.F.; Abd-Elrehim, G.A.B.; et al. Association of ACE1 I/D polymorphism and susceptibility to COVID-19 in Egyptian children and adolescents. Pediatr. Res. 2024. [Google Scholar] [CrossRef]
- Beyerstedt, S.; Casaro, E.B.; Rangel, E.B. COVID-19: Angiotensin-converting enzyme 2 (ACE2) expression and tissue susceptibility to SARS-CoV-2 infection. Eur. J. Clin. Microbiol. Infect. Dis. 2021, 40, 905–919. [Google Scholar] [CrossRef]
- Sousa, R.B.N.; Nascimento, L.; Costa, L.H.A.; Leite, V.; Borges, C.L.; Deus, J.M.; Rebelo, A.C.S.; Pinheiro, D.D.S.; Pedrino, G.R. Combinatorial analysis of ACE and ACE2 polymorphisms reveals protection against COVID-19 worsening: A genetic association study in Brazilian patients. PLoS ONE 2023, 18, e0288178. [Google Scholar] [CrossRef]
- Mahmudpour, M.; Roozbeh, J.; Keshavarz, M.; Farrokhi, S.; Nabipour, I. COVID-19 cytokine storm: The anger of inflammation. Cytokine 2020, 133, 155151. [Google Scholar] [CrossRef]
- Mohlendick, B.; Schonfelder, K.; Breuckmann, K.; Elsner, C.; Babel, N.; Balfanz, P.; Dahl, E.; Dreher, M.; Fistera, D.; Herbstreit, F.; et al. ACE2 polymorphism and susceptibility for SARS-CoV-2 infection and severity of COVID-19. Pharmacogenet Genom. 2021, 31, 165–171. [Google Scholar] [CrossRef]
- Sienko, J.; Marczak, I.; Kotowski, M.; Bogacz, A.; Tejchman, K.; Sienko, M.; Kotfis, K. Association of ACE2 Gene Variants with the Severity of COVID-19 Disease-A Prospective Observational Study. Int. J. Environ. Res. Public Health 2022, 19, 2622. [Google Scholar] [CrossRef] [PubMed]
- Varillas-Delgado, D.; Jimenez-Antona, C.; Lizcano-Alvarez, A.; Cano-de-la-Cuerda, R.; Molero-Sanchez, A.; Laguarta-Val, S. Predictive Factors and ACE-2 Gene Polymorphisms in Susceptibility to Long COVID-19 Syndrome. Int. J. Mol. Sci. 2023, 24, 16717. [Google Scholar] [CrossRef] [PubMed]
- Cafiero, C.; Rosapepe, F.; Palmirotta, R.; Re, A.; Ottaiano, M.P.; Benincasa, G.; Perone, R.; Varriale, E.; D’Amato, G.; Cacciamani, A.; et al. Angiotensin System Polymorphisms’ in SARS-CoV-2 Positive Patients: Assessment Between Symptomatic and Asymptomatic Patients: A Pilot Study. Pharmgenom. Pers. Med. 2021, 14, 621–629. [Google Scholar] [CrossRef] [PubMed]
Characteristics | All Participants (n = 6) | Total ACE Polymorphisms | Total ACE2 Polymorphisms |
---|---|---|---|
Median age (range)—yrs | 62.1 (50.9–80.4) | ||
Male sex—no. (%) | 4 (66.6) | ||
Moderate | 1 (16.6) | 13 | 0 |
Severe | 3 (50.0) | 18 | 4 |
Critical | 2 (33.3) | 4 | 1 |
Hospitalized no. (%) | 6 (100) |
Locus | Type | Region | Reference Allele | Found Allele | COVID-19 Severity | Participants | ||
---|---|---|---|---|---|---|---|---|
Moderate | Severe | Critical | ||||||
chr17:61556298 | SNV | Intron | C | G/G | 1 | 1 | 0 | S03; S06 |
chr17:61557200 | SNV | Exon | C | C/T | 0 | 0 | 1 | S05 |
chr17:61559923 | SNV | Exon | C | C/T | 1 | 1 | 0 | S03; S06 |
chr17:61562309 | SNV | Intron | C | C/T; T/T | 1 | 1 | 0 | S03; S06 |
chr17:61562490 | INDEL | Intron | A | A/AG | 0 | 1 | 0 | S03 |
chr17:61562553 | SNV | Intron | G | G/A; A/A | 1 | 1 | 0 | S03; S06 |
chr17:61562774 | SNV | Intron | T | T/C; C/C | 1 | 1 | 0 | S03; S06 |
chr17:61564052 | SNV | Exon | A | A/G; G/G | 1 | 1 | 0 | S03; S06 |
chr17:61564522 | SNV | Intron | T | T/C; C/C | 1 | 2 | 0 | S02; S03; S06 |
chr17:61565990 | SNV | Intron | G | G/C; C/C | 1 | 1 | 0 | S03; S06 |
chr17:61565998 | SNV | Intron | A | A/C; C/C | 1 | 1 | 0 | S03; S06 |
chr17:61566031 | SNV | Exon | G | G/A; A/A | 1 | 1 | 0 | S03; S06 |
chr17:61571516 | INDEL | Intron | AGT | AGT/A | 1 | 3 | 2 | S01; S02; S03; S05; S06; S08 |
chr17:61573761 | SNV | Exon | T | T/C; C/C | 1 | 1 | 0 | S03; S06 |
chr17:61574442 | INDEL | Intron | ACCCTTGCCCTGCCCTGCCCA | ACCCTTGCCCTGCCCTGCCCA/ACCCTTGCCCTGCCCA | 0 | 1 | 0 | S02 |
chr17:61574446 | INDEL | Intron | TTGCCC | TTGCCC/T | 0 | 0 | 1 | S05 |
chr17:61574492 | SNV | Intron | G | G/A; A/A | 1 | 1 | 0 | S03; S06 |
Total Events | 13 | 18 | 4 |
Locus | Type | Region | Reference Allele | Found Allele | COVID-19 Severity | Participants | ||
---|---|---|---|---|---|---|---|---|
Moderate | Severe | Critical | ||||||
chrX:15582265 | SNV | Exon | G | A/A | 0 | 1 | 0 | S02 |
chrX:15589725 | SNV | Intron | C | G/G | 0 | 1 | 0 | S02 |
chrX:15589925 | INDEL | Intron | CAAAAAAAG | CAAAAAAAG/CAAAAAAA | 0 | 1 | 1 | S02; S05 |
chrX:15610348 | SNV | Intron | C | T/T | 0 | 1 | 0 | S05 |
Total Events | 0 | 4 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guarienti, F.A.; Xavier, F.A.C.; Ferraz, M.D.; Wagner, F.; Marinowic, D.R.; da Costa, J.C.; Machado, D.C. Are COVID-19 Polymorphisms in ACE and ACE2 Prognosis Predictors? Curr. Issues Mol. Biol. 2024, 46, 8111-8117. https://doi.org/10.3390/cimb46080480
Guarienti FA, Xavier FAC, Ferraz MD, Wagner F, Marinowic DR, da Costa JC, Machado DC. Are COVID-19 Polymorphisms in ACE and ACE2 Prognosis Predictors? Current Issues in Molecular Biology. 2024; 46(8):8111-8117. https://doi.org/10.3390/cimb46080480
Chicago/Turabian StyleGuarienti, Fabiana Amaral, Fernando Antônio Costa Xavier, Mateus Duarte Ferraz, Fernanda Wagner, Daniel Rodrigo Marinowic, Jaderson Costa da Costa, and Denise Cantarelli Machado. 2024. "Are COVID-19 Polymorphisms in ACE and ACE2 Prognosis Predictors?" Current Issues in Molecular Biology 46, no. 8: 8111-8117. https://doi.org/10.3390/cimb46080480