An In Vitro HL-1 Cardiomyocyte-Based Olfactory Biosensor for Olfr558-Inhibited Efficiency Detection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Materials
2.2. MEA Chips Fabrication and Electrophysiological Recording System
2.3. Culture of HL-1 Cells and Primary Cardiomyocytes
2.4. Immunocytochemical Staining
2.5. Live/Dead Staining
2.6. Quantitative Reverse Transcription-PCR Analysis on the HL-1 Cells and Cardiomyocytes
2.7. Odor Preparation and Stimulation
2.8. Data Process and Analysis
2.9. Statistical Analysis and IC50 Calculation
3. Results and Discussion
3.1. Construction of the In Vitro HCBO-Biosensor
3.1.1. Characterization and Identification of HL-1 Cardiomyocytes
3.1.2. RT-PCR Analysis of Odor Receptors on Mouse Cardiomyocytes
3.2. Detection and Analysis of the HCBO-Biosensor
3.2.1. Concentration-Dependent Response to Ligands of Olfr558
3.2.2. Specific Response Test of HCBO-Biosensor
3.3. Construction of Isovaleric Acid Response Model and Detection of Olfr558-Inhibited Efficiency
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Mayer, S.; Hazenkamp, M.; Kluttig, M.; Ochs, D. Inhibition of microbial production of the malodorous substance isovaleric acid by 4,4′dichloro 2-hydroxydiphenyl ether (DCPP). Microbiologyopen 2021, 10, e1174. [Google Scholar] [CrossRef]
- Hara, T.; Kyuka, A.; Shimizu, H. Butane-2,3-dione: The Key Contributor to Axillary and Foot Odor Associated with an Acidic Note. Chem. Biodivers. 2015, 12, 248–258. [Google Scholar] [CrossRef] [PubMed]
- Azuma, K.; Ikeda, K.; Kagi, N.; Yanagi, U.; Osawa, H. Prevalence and risk factors associated with nonspecific building-related symptoms in office employees in Japan: Relationships between work environment, Indoor Air Quality, and occupational stress. Indoor Air 2015, 25, 499–511. [Google Scholar] [CrossRef] [PubMed]
- Avery, R.C.; Wing, S.; Marshall, S.W.; Schiffman, S.S. Odor from industrial hog farming operations and mucosal immune function in neighbors. Arch. Environ. Health Int. J. 2004, 59, 101–108. [Google Scholar] [CrossRef] [PubMed]
- Hirasawa, Y.; Shirasu, M.; Okamoto, M.; Touhara, K. Subjective unpleasantness of malodors induces a stress response. Psychoneuroendocrinology 2019, 106, 206–215. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, E.C.V.d.; Salvador, D.S.; Holsback, V.; Shultz, J.D.; Michniak-Kohn, B.B.; Leonardi, G.R. Deodorants and antiperspirants: Identification of new strategies and perspectives to prevent and control malodor and sweat of the body. Int. J. Dermatol. 2021, 60, 613–619. [Google Scholar] [CrossRef] [PubMed]
- McGee, T.; Rankin, K.M.; Baydar, A. The design principles of axilla deodorant fragrances. In Olfaction and Taste XII: An International Symposium; Murphy, C., Ed.; New York Academy of Sciences: New York, NY, USA, 1998; Volume 855, pp. 841–846. [Google Scholar]
- Gautschi, M.; Natsch, A.; Schröder, F. Biochemistry of human axilla malodor and chemistry of deodorant ingredients. Chim. Int. J. Chem. 2007, 61, 27–32. [Google Scholar] [CrossRef]
- Boeker, P. On ‘electronic nose’ methodology. Sens. Actuators B Chem. 2014, 204, 2–17. [Google Scholar] [CrossRef]
- Xiong, Y.; Chen, Y.; Chen, C.; Wei, X.; Xue, Y.; Wan, H.; Wang, P. An Odor Recognition Algorithm of Electronic Noses Based on Convolutional Spiking Neural Network for Spoiled Food Identification. J. Electrochem. Soc. 2021, 168, 077519. [Google Scholar] [CrossRef]
- Khorramifar, A.; Rasekh, M.; Karami, H.; Malaga-Toboła, U.; Gancarz, M. A Machine Learning Method for Classification and Identification of Potato Cultivars Based on the Reaction of MOS Type Sensor-Array. Sensors 2021, 21, 5836. [Google Scholar] [CrossRef]
- Zhang, J.; Xue, Y.; Sun, Q.; Zhang, T.; Chen, Y.; Yu, W.; Xiong, Y.; Wei, X.; Yu, G.; Wan, H. A miniaturized electronic nose with artificial neural network for anti-interference detection of mixed indoor hazardous gases. Sens. Actuators B Chem. 2021, 326, 128822. [Google Scholar] [CrossRef]
- Kim, K.-H. Experimental Demonstration of Masking Phenomena between Competing Odorants via an Air Dilution Sensory Test. Sensors 2010, 10, 7287–7302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Niu, Y.; Wang, P.; Xiao, Z.; Zhu, J.; Sun, X.; Wang, R. Evaluation of the perceptual interaction among ester aroma compounds in cherry wines by GC-MS, GC-O, odor threshold and sensory analysis: An insight at the molecular level. Food Chem. 2019, 275, 143–153. [Google Scholar] [CrossRef]
- Serizawa, S.U.; Miyamichi, K.; Sakano, H. One neuron-one receptor rule in the mouse olfactory system. Trends Genet. 2004, 20, 648–653. [Google Scholar] [CrossRef]
- Buck, L.; Axel, R. A Novel Multigene Family May Encode Odorant Receptors—A Molecular-Basis for Odor Recognition. Cell 1991, 65, 175–187. [Google Scholar] [CrossRef]
- Malnic, B.; Hirono, J.; Sato, T.; Buck, L.B. Combinatorial receptor codes for odors. Cell 1999, 96, 713–723. [Google Scholar] [CrossRef] [Green Version]
- Liu, M.T.; Na, M.; Li, Y.; Biscoe, M.R.; Ryan, K. Conformational Sensing by a Mammalian Olfactory Receptor. Chem. Eur. J. 2020, 26, 11462–11469. [Google Scholar] [CrossRef]
- Gregorio, G.G.; Masureel, M.; Hilger, D.; Terry, D.S.; Juette, M.; Zhao, H.; Zhou, Z.; Perez-Aguilar, J.M.; Hauge, M.; Mathiasen, S. Single-molecule analysis of ligand efficacy in β2AR–G-protein activation. Nature 2017, 547, 68–73. [Google Scholar] [CrossRef]
- Pfister, P.; Smith, B.C.; Evans, B.J.; Brann, J.H.; Trimmer, C.; Sheikh, M.; Arroyave, R.; Reddy, G.; Jeong, H.Y.; Raps, D.A.; et al. Odorant Receptor Inhibition Is Fundamental to Odor Encoding. Curr. Biol. 2020, 30, 2574–2587. [Google Scholar] [CrossRef]
- Kim, T.H.; Lee, S.H.; Lee, J.; Song, H.S.; Oh, E.H.; Park, T.H.; Hong, S. Single-Carbon-Atomic-Resolution Detection of Odorant Molecules using a Human Olfactory Receptor-based Bioelectronic Nose. Adv. Mater. 2009, 21, 91–94. [Google Scholar] [CrossRef]
- Lee, S.H.; Kwon, O.S.; Song, H.S.; Park, S.J.; Sung, J.H.; Jang, J.; Park, T.H. Mimicking the human smell sensing mechanism with an artificial nose platform. Biomaterials 2012, 33, 1722–1729. [Google Scholar] [CrossRef] [PubMed]
- Rosano, G.L.; Ceccarelli, E.A. Recombinant protein expression in Escherichia coli: Advances and challenges. Front. Microbiol. 2014, 5, 172. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhuang, L.; Wei, X.; Jiang, N.; Yuan, Q.; Qin, C.; Jiang, D.; Liu, M.; Zhang, Y.; Wang, P. A biohybrid nose for evaluation of odor masking in the peripheral olfactory system. Biosens. Bioelectron. 2021, 171, 112737. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Q.; Qin, C.; Duan, Y.; Jiang, N.; Liu, M.; Wan, H.; Zhuang, L.; Wang, P. An in vivo bioelectronic nose for possible quantitative evaluation of odor masking using M/T cell spatial response patterns. Analyst 2022, 147, 178–186. [Google Scholar] [CrossRef] [PubMed]
- Feldmesser, E.; Olender, T.; Khen, M.; Yanai, I.; Ophir, R.; Lancet, D. Widespread ectopic expression of olfactory receptor genes. BMC Genom. 2006, 7, 121. [Google Scholar] [CrossRef] [Green Version]
- Tham, E.H.; Dyjack, N.; Kim, B.E.; Rios, C.; Seibold, M.A.; Leung, D.Y.M.; Goleva, E. Expression and function of the ectopic olfactory receptor OR10G7 in patients with atopic dermatitis. J. Allergy Clin. Immunol. 2019, 143, 1838–1848. [Google Scholar] [CrossRef]
- Woodcock, E.A.; Matkovich, S.J. Cardiomyocytes structure, function and associated pathologies. Int. J. Biochem. Cell Biol. 2005, 37, 1746–1751. [Google Scholar] [CrossRef]
- Massberg, D.; Hatt, H. Human Olfactory Receptors: Novel Cellular Functions Outside of the Nose. Physiol. Rev. 2018, 98, 1739–1763. [Google Scholar] [CrossRef]
- Foster, S.R.; Porrello, E.R.; Purdue, B.; Chan, H.-W.; Voigt, A.; Frenzel, S.; Hannan, R.D.; Moritz, K.M.; Simmons, D.G.; Molenaar, P. Expression, regulation and putative nutrient-sensing function of taste GPCRs in the heart. PLoS ONE 2013, 8, e64579. [Google Scholar] [CrossRef] [Green Version]
- Wei, X.; Qin, C.; Gu, C.; He, C.; Yuan, Q.; Liu, M.; Zhuang, L.; Wan, H.; Wang, P. A novel bionic in vitro bioelectronic tongue based on cardiomyocytes and microelectrode array for bitter and umami detection. Biosens. Bioelectron. 2019, 145, 111673. [Google Scholar] [CrossRef]
- Wu, C.; Hwang, S.H.; Jia, Y.; Choi, J.; Kim, Y.-J.; Choi, D.; Pathiraja, D.; Choi, I.-G.; Koo, S.-H.; Lee, S.-J. Olfactory receptor 544 reduces adiposity by steering fuel preference toward fats. J. Clin. Investig. 2017, 127, 4118–4123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jovancevic, N.; Dendorfer, A.; Matzkies, M.; Kovarova, M.; Heckmann, J.C.; Osterloh, M.; Boehm, M.; Weber, L.; Nguemo, F.; Semmler, J. Medium-chain fatty acids modulate myocardial function via a cardiac odorant receptor. Basic Res. Cardiol. 2017, 112, 13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Halperin Kuhns, V.L.; Sanchez, J.; Sarver, D.C.; Khalil, Z.; Rajkumar, P.; Marr, K.A.; Pluznick, J.L. Characterizing novel olfactory receptors expressed in the murine renal cortex. Am. J. Physiol.-Ren. Physiol. 2019, 317, F172–F186. [Google Scholar] [CrossRef] [PubMed]
- Qin, C.; Yuan, Q.; Zhang, S.; He, C.; Wei, X.; Liu, M.; Jiang, N.; Huang, L.; Zhuang, L.; Wang, P. Biomimetic in vitro respiratory system using smooth muscle cells on ECIS chips for anti-asthma TCMs screening. Anal. Chim. Acta 2021, 1162, 338452. [Google Scholar] [CrossRef]
- Addis, R.C.; Ifkovits, J.L.; Pinto, F.; Kellam, L.D.; Esteso, P.; Rentschler, S.; Christoforou, N.; Epstein, J.A.; Gearhart, J.D. Optimization of direct fibroblast reprogramming to cardiomyocytes using calcium activity as a functional measure of success. J. Mol. Cell. Cardiol. 2013, 60, 97–106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mermer, P.; Strotmann, J.; Kummer, W.; Paddenberg, R. Olfactory receptor Olfr78 (prostate-specific G protein-coupled receptor PSGR) expression in arterioles supplying skeletal and cardiac muscles and in arterioles feeding some murine organs. Histochem. Cell Biol. 2021, 156, 539–553. [Google Scholar] [CrossRef] [PubMed]
- Bragança, B.; Oliveira-Monteiro, N.; Ferreirinha, F.; Lima, P.A.; Faria, M.; Fontes-Sousa, A.P.; Correia-de-Sá, P. Ion Fluxes through KCa2 (SK) and Cav1 (L-type) Channels Contribute to Chronoselectivity of Adenosine A1 Receptor-Mediated Actions in Spontaneously Beating Rat Atria. Front. Pharmacol. 2016, 7, 45. [Google Scholar] [CrossRef] [Green Version]
- Takeuchi, H.; Ishida, H.; Hikichi, S.; Kurahashi, T. Mechanism of olfactory masking in the sensory cilia. J. Gen. Physiol. 2009, 133, 583–601. [Google Scholar] [CrossRef] [Green Version]
- Inagaki, S.; Iwata, R.; Iwamoto, M.; Imai, T. Widespread Inhibition, Antagonism, and Synergy in Mouse Olfactory Sensory Neurons In Vivo. Cell Rep. 2020, 31, 107814. [Google Scholar] [CrossRef]
- Takahashi, Y.K. Detection and Masking of Spoiled Food Smells by Odor Maps in the Olfactory Bulb. J. Neurosci. 2004, 24, 8690–8694. [Google Scholar] [CrossRef] [Green Version]
- Murugathas, T.; Hamiaux, C.; Colbert, D.; Kralicek, A.V.; Plank, N.O.; Carraher, C. Evaluating Insect Odorant Receptor Display Formats for Biosensing Using Graphene Field Effect Transistors. ACS Appl. Electron. Mater. 2020, 2, 3610–3617. [Google Scholar] [CrossRef]
- Gao, K.; Gao, F.; Du, L.; He, C.; Wan, H.; Wang, P. Integrated olfaction, gustation and toxicity detection by a versatile bioengineered cell-based biomimetic sensor. Bioelectrochemistry 2019, 128, 1–8. [Google Scholar] [CrossRef]
- Du, L.; Wu, C.; Peng, H.; Zou, L.; Zhao, L.; Huang, L.; Wang, P. Piezoelectric olfactory receptor biosensor prepared by aptamer-assisted immobilization. Sens. Actuators B Chem. 2013, 187, 481–487. [Google Scholar] [CrossRef]
Gene | Forward Primer | Reverse Primer |
---|---|---|
Adrβ2 | GGGAACGACAGCGACTTCTT | GCCAGGACGATAACCGACAT |
β-actin | GATTACTGCTCTGGCTCCTA | ATCGTACTCCTGCTTGCTGA |
Olfr544 | CCTTATTGTCTTTGACTGCAACAT | TCGGTTGAAGATGCGAACAG |
Olfr558 | GGGGAAAAGACACACAGGCT | AGCCAGCCAAAACTGAACCT |
Olfr78 | CTGCAACTTCACCCATGCCACC | GATTGAACATAGC |
Group | R2 | IC50 [nM] |
---|---|---|
IVA | 0.9874 | 361.8 |
IVA + 10−7 M CIT | 0.8058 | 341.2 |
IVA + 10−7 M DMO | 0.7838 | 2694 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yuan, Q.; Qin, C.; Zhang, S.; Wu, J.; Qiu, Y.; Chen, C.; Huang, L.; Wang, P.; Jiang, D.; Zhuang, L. An In Vitro HL-1 Cardiomyocyte-Based Olfactory Biosensor for Olfr558-Inhibited Efficiency Detection. Chemosensors 2022, 10, 200. https://doi.org/10.3390/chemosensors10060200
Yuan Q, Qin C, Zhang S, Wu J, Qiu Y, Chen C, Huang L, Wang P, Jiang D, Zhuang L. An In Vitro HL-1 Cardiomyocyte-Based Olfactory Biosensor for Olfr558-Inhibited Efficiency Detection. Chemosensors. 2022; 10(6):200. https://doi.org/10.3390/chemosensors10060200
Chicago/Turabian StyleYuan, Qunchen, Chunlian Qin, Saisai Zhang, Jianguo Wu, Yong Qiu, Changming Chen, Liquan Huang, Ping Wang, Deming Jiang, and Liujing Zhuang. 2022. "An In Vitro HL-1 Cardiomyocyte-Based Olfactory Biosensor for Olfr558-Inhibited Efficiency Detection" Chemosensors 10, no. 6: 200. https://doi.org/10.3390/chemosensors10060200