Identification and Characterization of a Novel Protein ASP-3 Purified from Arca subcrenata and Its Antitumor Mechanism
Abstract
1. Introduction
2. Results
2.1. Isolation, Purification, and Identification of ASP-3
2.2. Spectral Characterization of ASP-3
2.3. Antiproliferative Activity of ASP-3 against HepG2 Cells
2.4. Differentially Expressed Genes (DEGs) of HepG2 Cells by ASP-3 Treatment
2.5. Effect of ASP-3 on p-VEGFR2 in HepG2 Cells
2.6. Determination of Interaction between ASP-3 and VEGFR2
2.7. Molecular Docking Simulations
2.8. Effect of ASP-3 on Tube Formation Assay
2.9. Inhibitory Effect of ASP-3 on Angiogenesis in a Zebrafish Model
3. Discussion
4. Materials and Methods
4.1. Isolation and Purification of Protein
4.2. Determination of Molecular Weight and Purity of Protein
4.3. In-Gel Digestion Preparation and Tandem Mass Spectrometric Identification
4.4. UV–Vis Spectroscopy Determination
4.5. Infrared Spectroscopy Analysis
4.6. Circular Dichroism Spectroscopy Analysis
4.7. Cell Culture
4.8. Cytotoxicity Assay
4.9. RNA-Sequencing Analysis
4.10. Immunofluorescence
4.11. Binding Constant Determination by SPR Analysis
4.12. Molecular Docking
4.13. Tube Formation Assay
4.14. Anti-Angiogenesis Assay in Transgenic Zebrafish Model
4.15. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Chen, W.; Zheng, R.; Baade, P.D.; Zhang, S.; Zeng, H.; Bray, F.; Jemal, A.; Yu, X.Q.; He, J. Cancer statistics in China, 2015. CA Cancer J. Clin. 2016, 66, 115–132. [Google Scholar] [CrossRef] [PubMed]
- Torre, L.A.; Bray, F.; Siegel, R.L.; Ferlay, J.; Lortet-Tieulent, J.; Jemal, A. Global cancer statistics, 2012. CA Cancer J. Clin. 2015, 65, 87–108. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2018. CA Cancer J. Clin. 2018, 60, 277–300. [Google Scholar] [CrossRef] [PubMed]
- Helena, C.; Alsinet, C.; Villanueva, A. Molecular pathogenesis of hepatocellular carcinoma. Alcohol. Clin. Exp. Res. 2011, 35, 821–825. [Google Scholar]
- Lee, S.C.; Tan, H.T.; Chung, M.C.M. Prognostic biomarkers for prediction of recurrence of hepatocellular carcinoma: Current status and future prospects. World. J. Gastroenterol. 2014, 20, 3112–3124. [Google Scholar] [CrossRef] [PubMed]
- Min, Y.; Li, J.; Qu, P.; Lin, P.C. C/EBP-δ positively regulates MDSC expansion and endothelial VEGFR2 expression in tumor development. Oncotarget 2017, 8, 50582–50593. [Google Scholar] [CrossRef] [PubMed]
- Cross, D.; Burmester, J.K. Gene therapy for cancer treatment: Past, present and future. Clin. Med. Res. 2006, 4, 218–227. [Google Scholar] [CrossRef] [PubMed]
- Watari, H.; Nakajima, H.; Atsuumi, W.; Nakamura, T.; Nanya, T.; Ise, Y.; Sakai, R. A novel sponge-derived protein thrombocorticin is a new agonist for thrombopoietin receptor. Comp. Biochem. Phys. C-Toxicol. Pharmacol. 2019, 221, 82–88. [Google Scholar] [CrossRef]
- Suzuki, H.; Oka, S.; Shigeta, S.; Ono, K.; Jyo, T.; Katsutani, T. Isolation and characterization of an asthma-inducing sea-squirt antigen. J. Biochem. 1984, 96, 849–857. [Google Scholar] [CrossRef]
- Odeleye, T.; White, W.L.; Lu, J. Extraction techniques and potential health benefits of bioactive compounds from marine molluscs: A review. Food Funct. 2019, 10, 2278–2289. [Google Scholar] [CrossRef]
- Zhang, X.; Cao, D.; Sun, X.; Sun, S.; Xu, N. Preparation and identification of antioxidant peptides from protein hydrolysate of marine alga Gracilariopsis lemaneiformis. J. Appl. Phycol. 2019, 31, 2585–2596. [Google Scholar] [CrossRef]
- Kang, H.K.; Lee, H.H.; Seo, C.H.; Park, Y. Antimicrobial and immunomodulatory properties and applications of marine-derived proteins and peptides. Mar. Drugs 2019, 17, 350. [Google Scholar] [CrossRef] [PubMed]
- Cicatiello, P.; Stanzione, I.; Dardano, P.; De Stefano, L.; Birolo, L.; De Chiaro, A.; Monti, D.M.; Petruk, G.; D’Errico, G.; Giardina, P. Characterization of a surface-active protein extracted from a marine strain of Penicillium chrysogenum. Int. J. Mol. Sci. 2019, 20, 3242. [Google Scholar] [CrossRef] [PubMed]
- Pettit, G.R.; Hogan, F.; Toms, S. Antineoplastic agents. 592. Highly effective cancer cell growth inhibitory structural modifications of dolastatin 10. J. Nat. Prod. 2011, 74, 962–968. [Google Scholar] [CrossRef] [PubMed]
- Dave, K.; Lahiry, A. Conotoxins: Review and docking studies to determine potentials of conotoxin as an anticancer drug molecule. Curr. Top. Med. Chem. 2012, 12, 845–851. [Google Scholar] [CrossRef] [PubMed]
- Broggini, M.; Marchini, S.V.; Galliera, E.; Borsotti, P.; Taraboletti, G.; Erba, E.; Sironi, M.; Jimeno, J.; Faircloth, G.T.; Giavazzi, R.; et al. Aplidine, a new anticancer agent of marine origin, inhibits vascular endothelial growth factor (VEGF) secretion and blocks VEGF-VEGFR-1 (flt-1) autocrine loop in human leukemia cells MOLT-4. Leukemia 2003, 17, 52–59. [Google Scholar] [CrossRef] [PubMed]
- Beaulieu, L.; Thibodeau, J.; Bonnet, C.; Bryl, P.; Carbonneau, M.E. Evidence of anti-proliferative activities in blue mussel (Mytilus edulis) by-products. Mar. Drugs 2013, 11, 975–990. [Google Scholar] [CrossRef]
- Wang, Y.K.; He, H.L.; Wang, G.F.; Wu, H.; Zhou, B.C.; Chen, X.L.; Zhang, Y.Z. Oyster (Crassostrea gigas) hydrolysates produced on a plant scale have antitumor activity and immunostimulating effects in BALB/c mice. Mar. Drugs 2010, 8, 255–268. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Liu, M.; Cheng, L.; Wei, J.; Wu, N.; Zheng, L.; Lin, X. A novel polypeptide from Meretrix meretrix Linnaeus inhibits the growth of human lung adenocarcinoma. Exp. Biol. Med. 2012, 237, 442–450. [Google Scholar] [CrossRef] [PubMed]
- Sahayanathan, G.J.; Guha, S.; Chinnasamy, A. Antiproliferative effect of crude proteins extracted from marine clam donax variabilis on human cancer cell lines. Int. J. Pharm. Sci. Res. 2018, 9, 3180–3188. [Google Scholar]
- Fu, X.M.; Zhang, M.Q.; Shao, C.L.; Li, G.Q.; Bai, H.; Dai, G.L.; Chen, Q.W.; Kong, W.; Fu, X.J.; Wang, C.Y. Chinese marine materia medica resources: Status and potential. Mar. Drugs 2016, 14, 46. [Google Scholar] [CrossRef]
- Song, L.; Ren, S.; Yu, R.; Yan, C.; Li, T.; Zhao, Y. Purification, characterization and in vitro anti-tumor activity of proteins from Arca subcrenata Lischke. Mar. Drugs 2008, 6, 418–430. [Google Scholar] [CrossRef]
- He, Y.; Liu, C.; Chen, Y.; Ji, A.; Shen, Z.; Xi, T.; Yao, Q. Isolation and structural characterization of a novel polysaccharide prepared from arca subcrenata lischke. J. Biosci. Bioeng. 2007, 104, 111–116. [Google Scholar] [CrossRef]
- Wu, Y.; Hu, X.; Song, L.; Zhu, J.; Yu, R. The inhibitory effect of a novel polypeptide fraction from Arca subcrenata on cancer-related inflammation in human cervical cancer HeLa cells. Sci. World J. 2014, 2014, 768938. [Google Scholar]
- Hu, X.; Song, L.; Huang, L.; Zheng, Q.; Yu, R. Antitumor effect of a polypeptide fraction from Arca subcrenata in vitro and in vivo. Mar. Drugs 2012, 10, 2782–2794. [Google Scholar] [CrossRef]
- Hu, X.; Zhang, Z.; Liu, T.; Song, L.; Zhu, J.; Guo, Z.; Cai, J.; Yu, R. Polypeptide fraction from Arca subcrenata, induces apoptosis and G2/M phase arrest in HeLa cells via ROS-Mediated MAPKs pathways. Evid. Based Complement. Altern. Med. 2015, 1–12. [Google Scholar] [CrossRef]
- Shen, H.; Gu, Z.; Jian, K.; Qi, J. In vitro study on the binding of gemcitabine to bovine serum albumin. J. Pharm. Biomed. Anal. 2013, 75, 86–93. [Google Scholar] [CrossRef]
- Katrahalli, U.; Kalalbandi, V.K.; Jaldappagari, S. The effect of anti-tubercular drug, ethionamide on the secondary structure of serum albumins: A biophysical study. J. Pharm. Biomed. Anal. 2012, 59, 102–108. [Google Scholar] [CrossRef]
- Rahman, M.A.; Halfar, J. First evidence of chitin in calcified coralline algae: New insights into the calcification process of Clathromorphum compactum. Sci. Rep. 2014, 4. [Google Scholar] [CrossRef]
- Kabsch, W.; Sander, C. Dictionary of protein secondary structure: Pattern recognition of hydrogen-bonded and geometrical features. Biopolymers 1983, 22, 2577–2637. [Google Scholar] [CrossRef]
- Morrisett, J.D.; David, J.S.; Pownall, H.J.; Gotto, A.M.J. Interaction of an apolipoprotein (apoLP-alanine) with phosphatidylcholine. Biochemistry 1973, 12, 1290–1299. [Google Scholar] [CrossRef]
- Pelton, J.T.; McLean, L.R. Spectroscopic methods for analysis of protein secondary structure. Anal. Biochem. 2000, 277, 167–176. [Google Scholar] [CrossRef]
- Xie, W.; Zhang, Y.; He, Y.; Zhang, K.; Wan, G.; Huang, Y.; Zhou, Z.; Huang, G.; Wang, J. A novel recombinant human Frizzled-7 protein exhibits anti-tumor activity against triple negative breast cancer via abating Wnt/beta-catenin pathway. Int. J. Biochem. Cell Biol. 2018, 103, 45–55. [Google Scholar] [CrossRef]
- Phumisantiphong, U.; Siripanichgon, K.; Reamtong, O.; Diraphat, P. A novel bacteriocin from Enterococcus faecalis 478 exhibits a potent activity against vancomycin-resistant enterococci. PLoS ONE 2017, 12, e0186415. [Google Scholar] [CrossRef]
- Lv, S.; Gao, J.; Liu, T.; Zhu, J.; Xu, J.; Song, L.; Liang, J.; Yu, R. Purification and partial characterization of a new antitumor protein from Tegillarca granosa. Mar. Drugs 2015, 13, 1466–1480. [Google Scholar] [CrossRef]
- Chen, L.; Song, L.; Li, T.; Zhu, J.; Xu, J.; Zheng, Q.; Yu, R. A New Antiproliferative and Antioxidant Peptide Isolated from Arca subcrenata. Mar. Drugs 2013, 11, 1800–1814. [Google Scholar] [CrossRef]
- He, Y.; Gao, L. Machine learning-based genetic evolution of antitumor proteins containing unnatural amino acids by integrating chemometric modeling and cytotoxicity analysis. J. Chemom. 2018, 32, e2974. [Google Scholar] [CrossRef]
- Yoon, K.A.; Kim, K.; Kim, A.Y.; Park, Y.H.; Bang, W.Y.; Kim, C.; Yeo, J.H.; Koh, Y.H.; Lee, S.H. Selective anti-tumor activities of venom peptides from the lesser paper wasp Parapolybia varia. J. Asia-Pac. Entomol. 2016, 19, 821–828. [Google Scholar] [CrossRef]
- Wang, K.R.; Zhang, B.Z.; Zhang, W.; Yan, J.X.; Li, J.; Wang, R. Antitumor effects, cell selectivity and structure-activity relationship of a novel antimicrobial peptide polybia-MPI. Peptides 2008, 29, 963–968. [Google Scholar] [CrossRef]
- Avci, F.G.; Akbulut, B.S.; Ozkirimli, E. Membrane active peptides and their biophysical characterization. Biomolecules 2018, 8, 77. [Google Scholar] [CrossRef]
- Tang, F.; Barbacioru, C.; Wang, Y.; Nordman, E.; Lee, C.; Xu, N.; Wang, X.; Bodeau, J.; Tuch, B.B.; Siddiqui, A. mRNA-Seq whole-transcriptome analysis of a single cell. Nat. Methods 2009, 6, 377–382. [Google Scholar] [CrossRef] [PubMed]
- Hao, S.; Li, S.; Wang, J.; Zhao, L.; Yan, Y.; Cao, Q.; Wu, T.; Liu, L.; Wang, C. Transcriptome analysis of phycocyanin-mediated inhibitory functions on non-small cell lung cancer A549 cell growth. Mar. Drugs 2018, 16, 511. [Google Scholar] [CrossRef] [PubMed]
- Weijts, B.G.; van Impel, A.; Schulte-Merker, S.; de Bruin, A. Atypical E2fs control lymphangiogenesis through transcriptional regulation of Ccbe1 and Flt4. PLoS ONE 2013, 8, e73693. [Google Scholar] [CrossRef]
- Weijts, B.G.; Bakker, W.J.; Cornelissen, P.W.; Liang, K.H.; Schaftenaar, F.H.; Westendorp, B.; de Wolf, C.A.; Paciejewska, M.; Scheele, C.L.; Kent, L.; et al. E2F7 and E2F8 promote angiogenesis through transcriptional activation of VEGFA in cooperation with HIF1. EMBO J. 2012, 31, 3871–3884. [Google Scholar] [CrossRef] [PubMed]
- Bakker, W.J.; Weijts, B.G.; Westendorp, B.; de Bruin, A. HIF proteins connect the RB-E2F factors to angiogenesis. Transcription 2013, 4, 62–66. [Google Scholar] [CrossRef] [PubMed]
- Gonda, T.J.; Ramsay, R.G. Adenoid cystic carcinoma can be driven by MYB or MYBL1 rearrangements: New insights into MYB and tumor biology. Cancer Discov. 2016, 6, 125–127. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ramkissoon, L.A.; Horowitz, P.M.; Craig, J.M.; Ramkissoon, S.H.; Rich, B.E.; Schumacher, S.E.; McKenna, A.; Lawrence, M.S.; Bergthold, G.; Brastianos, P.K.; et al. Genomic analysis of diffuse pediatric low-grade gliomas identifies recurrent oncogenic truncating rearrangements in the transcription factor MYBL1. Proc. Natl. Acad. Sci. USA 2013, 110, 8188–8193. [Google Scholar] [CrossRef] [PubMed]
- Buffet, C.; Hecale-Perlemoine, K.; Bricaire, L.; Dumont, F.; Baudry, C.; Tissier, F.; Bertherat, J.; Cochand-Priollet, B.; Raffin-Sanson, M.L.; Cormier, F.; et al. DUSP5 and DUSP6, two ERK specific phosphatases, are markers of a higher MAPK signaling activation in BRAF mutated thyroid cancers. PLoS ONE 2017, 12, e0184861. [Google Scholar] [CrossRef] [PubMed]
- Bellou, S.; Hink, M.A.; Bagli, E.; Panopoulou, E.; Bastiaens, P.I.; Murphy, C.; Fotsis, T. VEGF autoregulates its proliferative and migratory ERK1/2 and p38 cascades by enhancing the expression of DUSP1 and DUSP5 phosphatases in endothelial cells. Am. J. Physiol. Cell Physiol. 2009, 297, C1477–C1489. [Google Scholar] [CrossRef] [PubMed]
- Zhang, N.; Ma, D.; Wang, L.; Zhu, X.; Pan, Q.; Zhao, Y.; Zhu, W.; Zhou, J.; Wang, L.; Chai, Z.; et al. Insufficient radiofrequency ablation treated hepatocellular carcinoma cells promote metastasis by up-regulation ITGB3. J. Cancer 2017, 8, 3742–3754. [Google Scholar] [CrossRef] [PubMed]
- Hood, J.D.; Meininger, C.J.; Ziche, M.; Granger, H.J. Vegf upregulates ecnos message, protein, and no production in human endothelial cells. Am. J. Physiol. 1998, 274, 1054–1058. [Google Scholar] [CrossRef] [PubMed]
- Letamendia, A.; Quevedo, C.; Ibarbia, I.; Virto, J.M.; Holgado, O.; Diez, M.; Izpisua Belmonte, J.C.; Callol-Massot, C. Development and validation of an automated high-throughput system for zebrafish in vivo screenings. PLoS ONE 2012, 7, e36690. [Google Scholar] [CrossRef] [PubMed]
- Nicoli, S.; Ribatti, D.; Cotelli, F.; Presta, M. Mammalian tumor xenografts induce neovascularization in zebrafish embryos. Cancer Res. 2007, 67, 2927–2931. [Google Scholar] [CrossRef] [PubMed]
- Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Jang, H.L.; Liceaga, A.M.; Yoon, K.Y. Purification, characterisation and stability of an antioxidant peptide derived from sandfish (Arctoscopus japonicus) protein hydrolysates. J. Funct. Foods 2016, 20, 433–442. [Google Scholar] [CrossRef]
- Kalita, B.; Patra, A.; Jahan, S.; Mukherjee, A.K. First report of the characterization of a snake venom apyrase (Ruviapyrase) from Indian Russell’s viper (Daboia russelii) venom. Int. J. Biol. Macromol. 2018, 111, 639–648. [Google Scholar] [CrossRef] [PubMed]
- Meetani, M.A.; Zahid, O.K.; Conlon, J.M. Investigation of the pyrolysis products of methionine-enkephalin-Arg-Gly-Leu using liquid chromatography-tandem mass spectrometry. J. Mass Spectr. 2010, 45, 1320–1331. [Google Scholar] [CrossRef] [PubMed]
- Krivoshiev, B.V.; Beemster, G.T.S.; Sprangers, K.; Cuypers, B.; Laukens, K.; Blust, R.; Husson, S.J. Toxicogenomics of the flame retardant tris (2-butoxyethyl) phosphate in HepG2 cells using RNA-seq. Toxicol. In Vitro 2018, 46, 178–188. [Google Scholar] [CrossRef]
- Shevchenko, A.; Sunyaev, S.; Loboda, A.; Shevchenko, A.; Bork, P.; Ens, W.; Standing, K.G. Charting the proteomes of organisms with unsequenced genomes by MALDI-quadrupole time-of-flight mass spectrometry and BLAST homology searching. Anal. Chem. 2001, 73, 1917–1926. [Google Scholar] [CrossRef]
- Dutta, S.; Chanda, A.; Kalita, B.; Islam, T.; Patra, A.; Mukherjee, A.K. Proteomic analysis to unravel the complex venom proteome of eastern India Naja naja: Correlation of venom composition with its biochemical and pharmacological properties. J. Proteom. 2017, 156, 29–39. [Google Scholar] [CrossRef] [PubMed]
- Cuellar-Bermudez, S.P.; Aguilar-Hernandez, I.; Cardenas-Chavez, D.L.; Ornelas-Soto, N.; Romero-Ogawa, M.A.; Parra-Saldivar, R. Extraction and purification of high-value metabolites from microalgae: Essential lipids, astaxanthin and phycobiliproteins. Microb. Biotechnol. 2015, 8, 190–209. [Google Scholar] [CrossRef] [PubMed]
- Goldberg, M.E.; Chaffotte, A.F. Undistorted structural analysis of soluble proteins by attenuated total reflectance infrared spectroscopy. Protein Sci. 2005, 14, 2781–2792. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Yang, L.; Chen, T.; Liu, X.; Guo, Y.; Zhu, Q.; Tong, X.; Yang, W.; Xu, Q.; Huang, D.; et al. A novel lncRNA MCM3AP-AS1 promotes the growth of hepatocellular carcinoma by targeting miR-194-5p/FOXA1 axis. Mol. Cancer 2019, 18. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Ding, R.; Zhang, Y.; Mao, C.; Kang, R.; Meng, J.; Huang, Q.; Xiong, L.; Guo, Z. Transcriptome profiling analysis of differentially expressed mRNAs and lncRNAs in HepG2 cells treated with peptide 9R-P201. Biotechnol. Lett. 2017, 39, 1639–1647. [Google Scholar] [CrossRef] [PubMed]
- Cevallos, M.; Riha, G.M.; Wang, X. Cyclic strain induces expression of specific smooth muscle cell markers in human endothelial cells. Differentiation 2006, 74, 552–561. [Google Scholar] [CrossRef] [PubMed]
- Shen, J.; Zhang, T.; Cheng, Z.; Zhu, N.; Wang, H.; Lin, L.; Wang, Z.; Yi, H.; Hu, M. Lycorine inhibits glioblastoma multiforme growth through EGFR suppression. J. Exp. Clin. Cancer Res. 2018, 37. [Google Scholar] [CrossRef] [PubMed]
- Mostafa, A.S.; Gomaa, R.M.; Elmorsy, M.A. Design and synthesis of 2-phenyl benzimidazole derivatives as VEGFR-2 inhibitors with anti-breast cancer activity. Chem. Biol. Drug Des. 2019, 93, 454–463. [Google Scholar] [CrossRef]
- Carrillo, P.; Martínez-Poveda, B.; Cheng-Sánchez, I.; Guerra, J.; Tobia, C.; López-Romero, J.M.; Sarabia, F.; Medina, M.Á.; Quesada, A.R. Exploring the antiangiogenic potential of solomonamide A bioactive precursors: In vitro and in vivo evidences of the inhibitory activity of solo F-OH during angiogenesis. Mar. Drugs 2019, 17, 228. [Google Scholar] [CrossRef]
- Yuan, Y.; Zhang, Y.; Yao, S.; Shi, H.; Huang, X.; Li, Y.; Wei, Y.; Lin, S. The translation initiation factor eIF3i up-regulates vascular endothelial growth factor A, accelerates cell proliferation, and promotes angiogenesis in embryonic development and tumorigenesis. J. Biol. Chem. 2014, 289, 28310–28323. [Google Scholar] [CrossRef]
- Lawson, N.D.; Weinstein, B.M. In vivo imaging of embryonic vascular development using transgenic zebrafish. Dev. Biol. 2002, 248, 307–318. [Google Scholar] [CrossRef] [PubMed]












| Sequence | #PG | Protein | #PSMs | #MPA | #MC | Theo. MH + (Da) | #XCS-HT | #CS-HT | #P-PEP-S-HT |
|---|---|---|---|---|---|---|---|---|---|
| ASGGGELSEEMFIK | 1 | 1 | 5 | cds.c115914_g1_i1 | 0 | 1470.6781 | 3.594579 | High | 0.005789 |
| ISFEDVEESR | 1 | 1 | 80 | cds.c115914_g1_i1 | 0 | 1210.5586 | 2.922874 | High | 0.001299 |
| MDYLTSKWK | 1 | 1 | 1 | cds.c115914_g1_i1 | 1 | 1213.5922 | 2.751659 | High | 0.02739 |
| LWFHSLDVNHDGK | 1 | 1 | 80 | cds.c115914_g1_i1 | 0 | 1567.7652 | 4.516015 | High | 0.000136 |
| AFELLEPK | 1 | 1 | 1 | cds.c115914_g1_i1 | 0 | 946.5244 | 2.033109 | High | 0.04643 |
| EGLVPLR | 1 | 1 | 20 | cds.c115914_g1_i1 | 0 | 783.4723 | 2.547228 | High | 0.1515 |
| AFGHENEGLVTK | 1 | 1 | 72 | cds.c115914_g1_i1 | 0 | 1301.6484 | 4.752275 | High | 0.0009847 |
| LLGDKASGVK | 1 | 1 | 1 | cds.c115914_g1_i1 | 1 | 987.5833 | 2.092421 | High | 0.009428 |
| ISFEDVEESRNK | 1 | 1 | 22 | cds.c115914_g1_i1 | 1 | 1452.6965 | 3.626442 | High | 0.003369 |
| MDYLTSK | 1 | 1 | 7 | cds.c115914_g1_i1 | 0 | 899.4178 | 1.727565 | High | 0.1352 |
| NKFTDLHK | 1 | 1 | 2 | cds.c115914_g1_i1 | 1 | 1002.5367 | 2.358591 | High | 0.1699 |
| Sequence | #PG | Protein | #PSMs | #MPA | #MC | Theo. MH + (Da) | #XCS-HT | #CS-HT | #P-PEP-S-HT |
|---|---|---|---|---|---|---|---|---|---|
| ISFEDVEESRNK | 1 | 1 | 10 | cds.c115914_g1_i1 | 4 | 1452.6965 | 3.665950 | High | 0.05819 |
| EGLVPLRD | 1 | 1 | 1 | cds.c115914_g1_i1 | 1 | 898.4992 | 2.320368 | High | 0.1443 |
| GKISFEDVEESRNK | 1 | 1 | 3 | cds.c115914_g1_i1 | 5 | 1637.8129 | 2.822085 | High | 0.1253 |
| ASGGGELSEEMFIK | 1 | 1 | 1 | cds.c115914_g1_i1 | 3 | 1470.6781 | 2.409946 | High | 0.06772 |
| LWFHSLDVNHDGK | 1 | 1 | 25 | cds.c115914_g1_i1 | 2 | 1567.7652 | 4.727426 | High | 0.07214 |
| MDYLTSKWK | 1 | 1 | 1 | cds.c115914_g1_i1 | 2 | 1213.5921 | 2.403629 | High | 0.07387 |
| ASGVKVDME | 1 | 1 | 7 | cds.c115914_g1_i1 | 2 | 951.4451 | 2.751384 | High | 0.09791 |
| SRNKFTDLHK | 1 | 1 | 9 | cds.c115914_g1_i1 | 2 | 1245.6698 | 4.092405 | High | 0.06579 |
| AFGHENEGLVTK | 1 | 1 | 5 | cds.c115914_g1_i1 | 2 | 1301.6484 | 4.602788 | High | 0.00178 |
| DVEESRNKFTDLHK | 1 | 1 | 1 | cds.c115914_g1_i1 | 5 | 1717.8503 | 2.546801 | High | 0.09369 |
| LLGDKASGVKVDME | 1 | 1 | 1 | cds.c115914_g1_i1 | 4 | 1477.7566 | 2.016416 | High | 0.115 |
| Sequence | #PG | Protein | #PSMs | #MPA | #MC | Theo. MH + (Da) | #XCS-HT | #CS-HT | #P-PEP-S-HT |
|---|---|---|---|---|---|---|---|---|---|
| GHENEGLVTKAF | 1 | 1 | 20 | cds.c115914_g1_i1 | 1 | 1301.6484 | 3.934973 | High | 0.01547 |
| KASGGGELSEEMF | 1 | 1 | 2 | cds.c115914_g1_i1 | 1 | 1357.5940 | 2.346765 | High | 0.1362 |
| KAFGHENEGLVTKAF | 1 | 1 | 68 | cds.c115914_g1_i1 | 2 | 1647.8489 | 5.835577 | High | 0.0009434 |
| MDYLTSKW | 1 | 1 | 2 | cds.c115914_g1_i1 | 2 | 1059.4815 | 2.338743 | High | 0.1578 |
| IFKASGGGEL | 1 | 1 | 1 | cds.c115914_g1_i1 | 1 | 978.5254 | 2.468635 | High | 0.07504 |
| VTSTDQSKPDAIKQAF | 1 | 1 | 1 | cds.c115914_g1_i1 | 0 | 1735.8861 | 1.956635 | High | 0.1823 |
| EDVEESRNKF | 1 | 1 | 2 | cds.c115914_g1_i1 | 0 | 1252.5804 | 3.350192 | High | 0.01405 |
| KAFGHENEGL | 1 | 1 | 2 | cds.c115914_g1_i1 | 1 | 1101.5323 | 3.058953 | High | 0.1461 |
| Gene Type | Gene | mRNA | lncRNA |
|---|---|---|---|
| Sum | 289 | 419 | 83 |
| Up | 211 | 343 | 52 |
| Down | 78 | 76 | 31 |
| Gene | Gene_Type | mRNA_Symbol | lncRNA_Symbol | Description | KEGG Pathway |
|---|---|---|---|---|---|
| E2F8 | protein_coding | - | - | E2F transcription factor 8 | - |
| MYBL1 | protein_coding | - | - | MYB proto-oncogene like 1 | - |
| DUSP5 | protein_coding | NM_004419.3 | ENSG0000027314.1 | dual specificity phosphatase 5 | MAPK signaling pathway |
| ITGB3 | protein_coding | NM_000212.2 | THC AT158 | integrin subunit beta 3 | PI3K-Akt signaling pathway |
| NOS3 | protein_coding | NM_000603.4 | ATG9B | nitric oxide synthase 3 | VEGF signaling pathway |
| Gene | Primer Forward (5′-3′) | Primer Reverse (5′-3′) |
|---|---|---|
| MYBL1 | AGCGAATTCCATCACAGCCT | TAACACAGCGTTTGCCTCCA |
| E2F8 | TTTCCTGTCAAGCGACCTCC | AAGTTTTAATATCCTGTTCGCAGAT |
| DUSP5 | TCCTGAGTGTTGCGTGGATG | TGGGCCACCCTGGTCATAA |
| ITGB3 | TTGGAGACACGGTGAGCTTC | TTAGGTTCAGCTTGGGCCTG |
| NOS3 | AGTGGCTGGTACATGAGCAC | GGTGACTTTGGCTAGCTGGT |
| GAPDH | GACCTGACCTGCCGTCTA | AGGAGTGGGTGTCGCTGT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, Z.; Shi, H.; Li, C.; Luo, Y.; Bi, S.; Yu, R.; Wang, H.; Liu, W.; Zhu, J.; Huang, W.; et al. Identification and Characterization of a Novel Protein ASP-3 Purified from Arca subcrenata and Its Antitumor Mechanism. Mar. Drugs 2019, 17, 528. https://doi.org/10.3390/md17090528
Guo Z, Shi H, Li C, Luo Y, Bi S, Yu R, Wang H, Liu W, Zhu J, Huang W, et al. Identification and Characterization of a Novel Protein ASP-3 Purified from Arca subcrenata and Its Antitumor Mechanism. Marine Drugs. 2019; 17(9):528. https://doi.org/10.3390/md17090528
Chicago/Turabian StyleGuo, Zhongyi, Hui Shi, Chunlei Li, Yuanyuan Luo, Sixue Bi, Rongmin Yu, Haoran Wang, Wanying Liu, Jianhua Zhu, Weijuan Huang, and et al. 2019. "Identification and Characterization of a Novel Protein ASP-3 Purified from Arca subcrenata and Its Antitumor Mechanism" Marine Drugs 17, no. 9: 528. https://doi.org/10.3390/md17090528
APA StyleGuo, Z., Shi, H., Li, C., Luo, Y., Bi, S., Yu, R., Wang, H., Liu, W., Zhu, J., Huang, W., & Song, L. (2019). Identification and Characterization of a Novel Protein ASP-3 Purified from Arca subcrenata and Its Antitumor Mechanism. Marine Drugs, 17(9), 528. https://doi.org/10.3390/md17090528

