Characterization and Phylogenetic Analysis of Campylobacter Species Isolated from Paediatric Stool and Water Samples in the Northwest Province, South Africa
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Stool and Water Sample Collection
2.3. Isolation of Campylobacter from Drinking Water and Fecal Materials
2.4. Campylobacter Species Identification
2.5. Antibiotic Susceptibility Testing
2.6. Antibiotic Susceptibility Testing
2.7. Detection of Antibiotic Resistance Genes
2.8. Sequence Assembly and Alignment
3. Results
3.1. Detection of Campylobacter spp.
3.2. Antimicrobial Susceptibility of Campylobacter Isolates
3.3. Determination of the Minimum Inhibitory Concentration (MIC)
3.4. Prevalence of Multiple-Antibiotics Resistance (MAR)
3.5. Expression of antibiotic resistance genes by Campylobacter isolates
3.6. Expression of Virulence Genes among Campylobacter Species
3.7. Phylogenetic Relationship of Campylobacter Strains by Partial Genome Sequencing
4. Discussion
4.1. Detection of Campylobacter spp.
4.2. Antibiotic Resistance Profiles of Campylobacter Species
4.3. Multi-Antibiotic Resistance (MAR)
4.4. Distribution of Antibiotic Resistance Genes
4.5. Detection of Campylobacter Virulence-Associated Genes
4.6. Genetic Relatedness of Campylobacter Isolates from Human and Water Samples
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Kaakoush, N.O.; Castaño-Rodríguez, N.; Mitchell, H.M.; Man, S.M. Global epidemiology of Campylobacter infection. Clin. Microbiol. Rev. 2015, 28, 687–720. [Google Scholar] [CrossRef] [PubMed]
- Chlebicz, A.; Śliżewska, K. Campylobacteriosis, salmonellosis, yersiniosis, and listeriosis as zoonotic foodborne diseases: A review. Int. J. Environ. Res. Public Health 2018, 15, 863. [Google Scholar] [CrossRef] [PubMed]
- Wieczorek, K.; Osek, J. Antimicrobial resistance mechanisms among Campylobacter. Biomed. Res. Int. 2013, 2013, 340605. [Google Scholar] [CrossRef] [PubMed]
- Keller, J.I.; Shriver, W.G. Prevalence of three Campylobacter species, C. jejuni, C. coli, and C. lari, using multilocus sequence typing in wild birds of the mid-Atlantic region, USA. J. Wildl. Dis. 2014, 50, 31–41. [Google Scholar] [CrossRef] [PubMed]
- Heikema, A.P.; Islam, Z.; Horst-Kreft, D.; Huizinga, R.; Jacobs, B.C.; Wagenaar, J.A.; Poly, F.; Guerry, P.; van Belkum, A.; Parker, C.T.; et al. Campylobacter jejuni capsular genotypes are related to Guillain–Barré syndrome. Clin. Microbiol. Infect. 2015, 21, 852.e1–852.e9. [Google Scholar] [CrossRef] [PubMed]
- Nyati, K.K.; Nyati, R. Role of Campylobacter jejuni infection in the pathogenesis of Guillain-Barré syndrome: An update. Biomed. Res. Int. 2013, 2013, 852195. [Google Scholar] [CrossRef] [PubMed]
- Karikari, A.B.; Obiri-Danso, K.; Frimpong, E.H.; Krogfelt, K.A. Antibiotic resistance in Campylobacter isolated from patients with gastroenteritis in a teaching hospital in Ghana. Open J. Med. Microbiol. 2017, 7, 1–11. [Google Scholar] [CrossRef]
- Crofts, A.A.; Poly, F.M.; Ewing, C.P.; Kuroiwa, J.M.; Rimmer, J.E.; Harro, C.; Sack, D.; Talaat, K.R.; Porter, C.K.; Gutierrez, R.L.; et al. Campylobacter jejuni transcriptional and genetic adaptation during human infection. Nat. Microbiol. 2018, 3, 494–502. [Google Scholar] [CrossRef]
- Mehat, J.W.; Park, S.F.; van Vliet, A.H.M.; La Ragionea, R.M. CapC, a novel autotransporter and virulence factor of Campylobacter jejuni. Appl. Environ. Microbiol. 2018, 84, e01032. [Google Scholar] [CrossRef]
- Bolton, D.J. Campylobacter virulence and survival factors. Food Microbiol. 2015, 48, 99–108. [Google Scholar] [CrossRef]
- Ghunaim, H.; Behnke, J.M.; Aigha, I.; Sharma, A.; Doiphode, S.H.; Deshmukh, A.; Abu-Madi, M.M. Analysis of resistance to antimicrobials and presence of virulence/stress response genes in Campylobacter isolates from patients with severe diarrhoea. PLoS ONE 2015, 10, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Shobo, C.O.; Bester, L.A.; Baijnath, S.; Somboro, A.M.; Peer, A.K.C.; Essack, S.Y. Antibiotic resistance profiles of Campylobacter species in the South Africa private health care sector. J. Infect. Dev. Ctries. 2016, 10, 1214–1221. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, R. Increasing antimicrobial resistance of Campylobacter jejuni isolated from paediatric diarrhea cases in a tertiary care hospital of New Delhi, India. J. Clin. Diagnostic Res. 2013, 7, 247–249. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Boto, D.; Herrera-León, S.; García-Peña, F.J.; Abad-Moreno, J.C.; Echeita, M.A. Molecular mechanisms of quinolone, macrolide, and tetracycline resistance among Campylobacter isolates from initial stages of broiler production. Avian. Pathol. 2014, 43, 176–182. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Migura, L.; Hendriksen, R.S.; Fraile, L.; Aarestrup, F.M. Antimicrobial resistance of zoonotic and commensal bacteria in Europe: The missing link between consumption and resistance in veterinary medicine. Vet. Microbiol. 2014, 170, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Redgrave, L.S.; Sutton, S.B.; Webber, M.A.; Piddock, L.J. V Fluoroquinolone resistance: Mechanisms, impact on bacteria, and role in evolutionary success. Trends Microbiol. 2014, 22, 438–445. [Google Scholar] [CrossRef]
- Laprade, N.; Cloutier, M.; Lapen, D.R.; Topp, E.; Wilkes, G.; Villemur, R.; Khan, I.U.H. Detection of virulence, antibiotic resistance and toxin (VAT) genes in Campylobacter species using newly developed multiplex PCR assays. J. Microbiol. Methods 2016, 124, 41–47. [Google Scholar] [CrossRef]
- Dearlove, B.L.; Cody, A.J.; Pascoe, B.; Méric, G.; Wilson, D.J.; Sheppard, S.K. Rapid host switching in generalist Campylobacter strains erodes the signal for tracing human infections. ISME J. 2016, 10, 721–729. [Google Scholar] [CrossRef]
- Baig, A.; McNally, A.; Dunn, S.; Paszkiewicz, K.H.; Corander, J.; Manning, G. Genetic import and phenotype specific alleles associated with hyper-invasion in Campylobacter jejuni. BMC Genom. 2015, 16, 852. [Google Scholar] [CrossRef][Green Version]
- Gemmell, M.R.; Berry, S.; Mukhopadhya, I.; Hansen, R.; Nielsen, H.L.; Bajaj-Elliott, M.; Nielsen, H.; Hold, G.L. Comparative genomics of Campylobacter concisus: Analysis of clinical strains reveals genome diversity and pathogenic potential. Emerg. Microbes Infect. 2018, 7, 116. [Google Scholar] [CrossRef]
- Skarp, C.P.A.; Hänninen, M.-L.; Rautelin, H.I.K. Campylobacteriosis: The role of poultry meat. Clin. Microbiol. Infect. 2016, 22, 103–109. [Google Scholar] [CrossRef] [PubMed]
- Pitkänen, T. Review of Campylobacter spp. in drinking and environmental waters. J. Microbiol. Methods 2013, 95, 39–47. [Google Scholar] [CrossRef] [PubMed]
- Sales-Ortells, H.; Medema, G. Microbial health risks associated with exposure to stormwater in a water plaza. Water Res. 2015, 74, 34–46. [Google Scholar] [CrossRef] [PubMed]
- Kuhn, K.G.; Falkenhorst, G.; Emborg, H.D.; Ceper, T.; Torpdahl, M.; Krogfelt, K.A.; Ethelberg, S.; Mølbak, K. Epidemiological and serological investigation of a waterborne Campylobacter jejuni outbreak in a Danish town. Epidemiol. Infect. 2017, 145, 701–709. [Google Scholar] [CrossRef] [PubMed]
- Johnson, T.J.; Shank, J.M.; Johnson, J.G. Current and potential treatments for reducing Campylobacter colonization in animal hosts and disease in humans. Front. Microbiol. 2017, 8, 487. [Google Scholar] [CrossRef] [PubMed]
- Sainato, R.; ElGendy, A.; Poly, F.; Kuroiwa, J.; Guerry, P.; Riddle, M.S.; Porter, C.K. Epidemiology of Campylobacter infections among children in Egypt. Am. J. Trop. Med. Hyg. 2018, 98, 581–585. [Google Scholar] [CrossRef] [PubMed]
- Bessède, E.; Delcamp, A.; Sifré, E.; Buissonnière, A.; Mégraud, F. New methods for detection of campylobacters in stool samples in comparison to culture. J. Clin. Microbiol. 2011, 49, 941–944. [Google Scholar] [CrossRef] [PubMed]
- Jokinen, C.C.; Koot, J.M.; Carrillo, C.D.; Gannon, V.P.J.; Jardine, C.M.; Mutschall, S.K.; Topp, E.; Taboada, E.N. An enhanced technique combining pre-enrichment and passive filtration increases the isolation efficiency of Campylobacter jejuni and Campylobacter coli from water and animal fecal samples. J. Microbiol. Methods 2012, 91, 506–513. [Google Scholar] [CrossRef]
- Talay, F.; Molva, C.; Atabay, H.I. Isolation and identification of Arcobacter species from environmental and drinking water samples. Folia Microbiol. 2016, 61, 479–484. [Google Scholar] [CrossRef][Green Version]
- Onori, M.; Coltella, L.; Mancinelli, L.; Argentieri, M.; Menichella, D.; Villani, A.; Grandin, A.; Valentini, D.; Raponi, M.; Russo, C. Evaluation of a multiplex PCR assay for simultaneous detection of bacterial and viral enteropathogens in stool samples of paediatric patients. Diagn. Microbiol. Infect. Dis. 2014, 79, 149–154. [Google Scholar] [CrossRef]
- Wang, G.; Clark, C.G.; Taylor, T.M.; Pucknell, C.; Barton, C.; Price, L.; Woodward, D.L.; Rodgers, F.G. Colony multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. J. Clin. Microbiol. 2002, 40, 4744–4747. [Google Scholar] [CrossRef] [PubMed]
- Vondrakova, L.; Pazlarova, J.; Demnerova, K. Detection, identification and quantification of Campylobacter jejuni, coli and lari in food matrices all at once using multiplex qPCR. Gut Pathog. 2014, 6, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Best, E.L.; Powell, E.J.; Swift, C.; Grant, K.A.; Frost, J.A. Applicability of a rapid duplex real-time PCR assay for speciation of Campylobacter jejuni and Campylobacter coli directly from culture plates. FEMS Microbiol. Lett. 2003, 229, 237–241. [Google Scholar] [CrossRef]
- Rathlavath, S.; Kohli, V.; Singh, A.S.; Lekshmi, M.; Tripathi, G.; Kumar, S.; Nayak, B.B. Virulence genotypes and antimicrobial susceptibility patterns of Arcobacter butzleri isolated from seafood and its environment. Int. J. Food Microbiol. 2017, 263, 32–37. [Google Scholar] [CrossRef] [PubMed]
- CLSI 2014 M45. Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria; Proposed Guideline. 2015, Volume 35. Available online: https://clsi.org/media/1450/m45ed3_sample.pdf (accessed on 23 March 2019).
- European Committee on Antimicrobial Susceptibility Testing-EUCAST. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 5.0. 2015, pp. 0–77. Available online: http://www.eucast.org (accessed on 23 March 2019).
- Lengerh, A.; Moges, F.; Unakal, C.; Anagaw, B. Prevalence, associated risk factors and antimicrobial susceptibility pattern of Campylobacter species among under five diarrheic children at Gondar University Hospital, Northwest Ethiopia. BMC Pediatr. 2013, 13, 82. [Google Scholar] [CrossRef] [PubMed]
- Oncul, O.; Zarakolu, P.; Oncul, O.; Gur, D. Antimicrobial susceptibility testing of Campylobacter jejuni: A comparison between Etest and agar dilution method. Diagn. Microbiol. Infect. Dis. 2003, 45, 69–71. [Google Scholar] [CrossRef]
- González, A.; Bayas Morejón, I.F.; Ferrús, M.A. Isolation, molecular identification and quinolone-susceptibility testing of Arcobacter spp. isolated from fresh vegetables in Spain. Food Microbiol. 2017, 65, 279–283. [Google Scholar] [CrossRef] [PubMed]
- Luo, N.; Pereira, S.; Sahin, O.; Lin, J.; Huang, S.; Michel, L.; Zhang, Q. Enhanced in vivo fitness of fluoroquinolone-resistant Campylobacter jejuni in the absence of antibiotic selection pressure. Proc. Natl. Acad. Sci. USA 2005, 102, 541–546. [Google Scholar] [CrossRef]
- Alonso, R.; Mateo, E.; Churruca, E.; Martinez, I.; Girbau, C.; Fernández-Astorga, A. MAMA-PCR assay for the detection of point mutations associated with high-level erythromycin resistance in Campylobacter jejuni and Campylobacter coli strains. J. Microbiol. Methods 2005, 63, 99–103. [Google Scholar] [CrossRef]
- Konkel, M.E.; Gray, S.A.; Kim, B.J.; Garvis, S.G.; Yoon, J. Identification of the Enteropathogens Campylobacter jejuni and Campylobacter coli Based on the cadF Virulence Gene and Its Product. J. Clin. Microbiol. 1999, 37, 510–517. [Google Scholar]
- Ziprin, R.L.; Young, C.R.; Byrd, J.A.; Stanker, L.H.; Hume, M.E.; Gray, S.A.; Kim, B.J.; Konkel, M.E. Role of Campylobacter jejuni potential virulence genes in cecal colonization. Avian Dis. 2014, 45, 549–557. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Skarp-de Haan, C.P.A.; Culebro, A.; Schott, T.; Revez, J.; Schweda, E.K.H.; Hänninen, M.L.; Rossi, M. Comparative genomics of unintrogressed Campylobacter coli clades 2 and 3. BMC Genom. 2014, 15, 129. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Platts-Mills, J.A.; Babji, S.; Bodhidatta, L.; Gratz, J.; Haque, R.; Havt, A.; McCormick, B.J.; McGrath, M.; Olortegui, M.P.; Samie, A.; et al. Pathogen-specific burdens of community diarrhoea in developing countries: A multisite birth cohort study (MAL-ED). Lancet Glob. Health 2015, 3, e564–e575. [Google Scholar] [CrossRef]
- Said, M.M.; El-Mohamady, H.; El-Beih, F.M.; Rockabrand, D.M.; Ismail, T.F.; Monteville, M.R.; Ahmed, S.F.; Klena, J.D.; Salama, M.S. Detection of gyrA mutation among clinical isolates of Campylobacter jejuni isolated in Egypt by MAMA PCR. J. Infect. Dev. Ctries. 2010, 4, 546–554. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ge, B.; Wang, F.; Sjölund-Karlsson, M.; McDermott, P.F. Antimicrobial resistance in Campylobacter: Susceptibility testing methods and resistance trends. J. Microbiol. Methods 2013, 95, 57–67. [Google Scholar] [CrossRef] [PubMed]
- Mughini-Gras, L.; Penny, C.; Ragimbeau, C.; Schets, F.M.; Blaak, H.; Duim, B.; Wagenaar, J.A.; de Boer, A.; Cauchie, H.-M.; Mossong, J.; et al. Quantifying potential sources of surface water contamination with Campylobacter jejuni and Campylobacter coli. Water Res. 2016, 101, 36–45. [Google Scholar] [CrossRef]
- Nilsson, A.; Johansson, C.; Skarp, A.; Kaden, R.; Bertilsson, S.; Rautelin, H. Survival of Campylobacter jejuni and Campylobacter coli water isolates in lake and well water. APMIS 2018, 126, 762–770. [Google Scholar] [CrossRef]
- Otigbu, A.C.; Clarke, A.M.; Fri, J.; Akanbi, E.O.; Njom, H.A. Antibiotic sensitivity profiling and virulence potential of Campylobacter jejuni isolates from estuarine water in the Eastern Cape Province, South Africa. Int. J. Environ. Res. Public Health 2018, 15, 925. [Google Scholar] [CrossRef]
- Diergaardt, S.M.; Venter, S.N.; Spreeth, A.; Theron, J.; Brözel, V.S. The occurrence of Campylobacters in water sources in South Africa. Water Res. 2004, 38, 2589–2595. [Google Scholar] [CrossRef]
- Savill, M.G.; Hudson, J.A.; Ball, A.; Klena, J.D.; Scholes, P.; Whyte, R.J.; McCormick, R.E.; Jankovic, D. Enumeration of Campylobacter in New Zealand recreational and drinking waters. J. Appl. Microbiol. 2001, 91, 38–46. [Google Scholar] [CrossRef] [PubMed]
- Van Dyke, M.I.; Morton, V.K.; McLellan, N.L.; Huck, P.M.; Dyke, M.I. Van The occurrence of Campylobacter in river water and waterfowl within a watershed in southern Ontario, Canada. J. Appl. Microbiol. 2010, 109, 1053–1066. [Google Scholar] [CrossRef] [PubMed]
- Rechenburg, A.; Kistemann, T. Sewage effluent as a source of Campylobacter sp. in a surface water catchment. Int. J. Environ. Health Res. 2009, 19, 239–249. [Google Scholar] [CrossRef] [PubMed]
- Hellein, K.; Battie, C. Culture-based indicators of fecal contamination and molecular microbial indicators rarely correlate with Campylobacter spp. in recreational waters. J. Water 2011, 9, 695–707. [Google Scholar] [CrossRef]
- Diergaardt, S.; Venter, S.; Chalmers, M. Evaluation of the Cape Town Protocol for the isolation of Campylobacter spp. from environmental waters: Short communication. Water SA 2003, 29, 225–229. [Google Scholar] [CrossRef][Green Version]
- Castro Burbarelli, M.F.d.; do Valle Polycarpo, G.; Deliberali Lelis, K.; Granghelli, C.A.; Carão de Pinho, A.C.; Ribeiro Almeida Queiroz, S.; Fernandes, A.M.; Moro de Souza, R.L.; Gaglianone Moro, M.E.; de Andrade Bordin, R.; et al. Cleaning and disinfection programs against Campylobacter jejuni for broiler chickens: Productive performance, microbiological assessment and characterization1. Poult. Sci. 2017, 96, 3188–3198. [Google Scholar] [CrossRef]
- Brown, H.L.; Hanman, K.; Reuter, M.; Betts, R.P.; van Vliet, A.H.M. Campylobacter jejuni biofilms contain extracellular DNA and are sensitive to DNase I treatment. Front. Microbiol. 2015, 6, 699. [Google Scholar] [CrossRef]
- Malema, M.S.; Abia, A.L.K.; Tandlich, R.; Zuma, B.; Kahinda, J.-M.M.; Ubomba-Jaswa, E. Antibiotic-resistant pathogenic Escherichia coli isolated from rooftop rainwater-harvesting tanks in the Eastern Cape, South Africa. Int. J. Environ. Res. Public Health 2018, 15, 892. [Google Scholar] [CrossRef]
- Abia, A.L.K.; Schaefer, L.; Ubomba-Jaswa, E.; Le Roux, W. Abundance of pathogenic Escherichia coli virulence-associated genes in well and borehole water used for domestic purposes in a peri-urban community of South Africa. Int. J. Environ. Res. Public Health 2017, 14, 320. [Google Scholar] [CrossRef]
- Chopra, I.; Roberts, M. Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiol. Mol. Biol. Rev. 2001, 65, 232–260. [Google Scholar] [CrossRef]
- Lehtopolku, M. Antimicrobial Resistance in Campylobacter jejuni and Campylobacter coli; Painosalama Oy: Turku, Finland, 2011. [Google Scholar]
- NARMS Integrated Report: 2012–2013; Food and Drug Administration: Silver Spring, MD, USA, 2013.
- Fuchs, A.; Bielicki, J.; Mathur, S.; Sharland, M.; Van Den Anker, J.N. Reviewing the WHO guidelines for antibiotic use for sepsis in neonates and children. Paediatr. Int. Child Health 2018, 38, S3–S15. [Google Scholar] [CrossRef] [PubMed]
- McWilliam, S.J.; Antoine, D.J.; Smyth, R.L.; Pirmohamed, M. Aminoglycoside-induced nephrotoxicity in children. Pediatr. Nephrol. 2017, 32, 2015–2025. [Google Scholar] [CrossRef] [PubMed]
- Bolinger, H.; Kathariou, S. The Current State of Macrolide Resistance in Campylobacter spp.: Trends and Impacts of Resistance Mechanisms. Appl. Environ. Microbiol. 2017, 83, e00416-17. [Google Scholar] [CrossRef]
- Antibiotic Resistance Threats in the United States, 2013; Centers for Disease Control and Prevention, U.S. Department of Health & Human Services: Washington, DC, USA, 2013.
- Samie, A.; Ramalivhana, J.; Igumbor, E.O.; Obi, C.L. Prevalence, haemolytic and haemagglutination activities and antibiotic susceptibility profiles of Campylobacter spp. isolated from human diarrhoeal stools in Vhembe District, South Africa. J. Health. Popul. Nutr. 2007, 25, 406–413. [Google Scholar] [PubMed]
- Luo, N.; Sahin, O.; Lin, J.; Michel, L.O.; Zhang, Q. In vivo selection of Campylobacter isolates with high levels of fluoroquinolone resistance associated with gyrA mutations and the function of the CmeABC efflux pump. Antimicrob. Agents Chemother. 2003, 47, 390–394. [Google Scholar] [CrossRef] [PubMed]
- Engberg, J.; Neimann, J.; Nielsen, E.M.; Aerestrup, F.M.; Fussing, V. Quinolone-resistant Campylobacter infections: Risk factors and clinical consequences. Emerg. Infect. Dis. 2004, 10, 1056–1063. [Google Scholar] [CrossRef] [PubMed]
- Lehtopolku, M.; Nakari, U.M.; Kotilainen, P.; Huovinen, P.; Siitonen, A.; Hakanen, A.J. Antimicrobial susceptibilities of multidrug-resistant Campylobacter jejuni and C. coli strains: In vitro activities of 20 antimicrobial agents. Antimicrob. Agents Chemother. 2010, 54, 1232–1236. [Google Scholar] [CrossRef]
- Unicomb, L.E.; Ferguson, J.; Stafford, R.J.; Ashbolt, R.; Kirk, M.D.; Becker, N.G.; Patel, M.S.; Gilbert, G.L.; Valcanis, M.; Mickan, L. Low-level fluoroquinolone resistance among Campylobacter jejuni isolates in Australia. Clin. Infect. Dis. 2006, 42, 1368–1374. [Google Scholar] [CrossRef] [PubMed]
- Obeng, A.S.; Rickard, H.; Sexton, M.; Pang, Y.; Peng, H.; Barton, M. Antimicrobial susceptibilities and resistance genes in Campylobacter strains isolated from poultry and pigs in Australia. J. Appl. Microbiol. 2012, 113, 294–307. [Google Scholar] [CrossRef]
- Alfredson, D.A.; Korolik, V. Antibiotic resistance and resistance mechanisms in Campylobacter jejuni and Campylobacter coli. FEMS Microbiol. Lett. 2007, 277, 123–132. [Google Scholar] [CrossRef]
- Dinos, G.P. The macrolide antibiotic renaissance. Br. J. Pharmacol. 2017, 174, 2967–2983. [Google Scholar] [CrossRef] [PubMed]
- Roberts, M.C. Update on acquired tetracycline resistance genes. FEMS Microbiol. Lett. 2005, 245, 195–203. [Google Scholar] [CrossRef] [PubMed]
- Guévremont, E.; Nadeau, É.; Sirois, M.; Quessy, S. Antimicrobial susceptibilities of thermophilic Campylobacter from humans, swine, and chicken broilers. Can. J. Vet. Res. 2006, 70, 81–86. [Google Scholar] [PubMed]
- Uaboi-Egbenni, P.O.; Bessong, P.O.; Samie, A.; Obi, C.L. Prevalence and antimicrobial susceptibility profiles of Campylobacter jejuni and coli isolated from diarrheic and non-diarrheic goat faeces in Venda region, South Africa. Afr. J. Biotechnol. 2011, 10, 14116–14124. [Google Scholar] [CrossRef]
- Ugarte-Ruiz, M.; Florez-Cuadrado, D.; Wassenaar, T.M.; Porrero, M.C.; Domínguez, L. Method comparison for enhanced recovery, isolation and qualitative detection of C. jejuni and C. coli from wastewater effluent samples. Int. J. Environ. Res. Public Health 2015, 12, 2749–2764. [Google Scholar] [CrossRef] [PubMed]
- Akosua, B.K.; Kwasi, O.-D.; Enoch, H.F.; Karen, A.K. Occurrence and susceptibility patterns of Campylobacter isolated from environmental water sources. Afr. J. Microbiol. Res. 2016, 10, 1576–1580. [Google Scholar] [CrossRef]
- Lastovica, A.J. Antibiotic resistance patterns of Campylobacter jejuni, C. concisus and C. upsaliensis isolates from paediatric patients in Cape Town, South Africa, 1998–2005. In Proceedings of the 106th General Meeting of the American Society for Microbiology, Orlando, FL, USA, 21–25 May 2006. Poster presentation C-03. [Google Scholar]
- Bester, L.A.; Essack, S.Y. Observational study of the prevalence and antibiotic resistance of Campylobacter spp. from different poultry production systems in KwaZulu-Natal, South Africa. J. Food Prot. 2012, 75, 154–159. [Google Scholar] [CrossRef] [PubMed]
- Friedman, C.R.; Hoekstra, R.M.; Samuel, M.; Marcus, R.; Bender, J.; Shiferaw, B.; Reddy, S.; Desai Ahuja, S.; Helfrick, D.L.; Hardnett, F.; et al. Risk Factors for Sporadic Campylobacter Infection in the United States: A Case-Control Study in FoodNet Sites. Clin. Infect. Dis. 2004, 38, S285–S296. [Google Scholar] [CrossRef] [PubMed]
- Avrain, L.; Vernozy-Rozand, C.; Kempf, I. Evidence for natural horizontal transfer of tetO gene between Campylobacter jejuni strains in chickens. J. Appl. Microbiol. 2004, 97, 134–140. [Google Scholar] [CrossRef]
- Engberg, J.; Aarestrup, F.M.; Taylor, D.E.; Gerner-smidt, P.; Nachamkin, I. Quinolone and macrolide resistance in Campylobacter jejuni and C. coli: Resistance mechanisms and trends in human isolates. Emerg. Infect. Dis. 2001, 7, 24–34. [Google Scholar]
- Pérez-Boto, D.; López-Portolés, J.A.; Simón, C.; Valdezate, S.; Echeita, M.A. Study of the molecular mechanisms involved in high-level macrolide resistance of Spanish Campylobacter jejuni and Campylobacter coli strains. J. Antimicrob. Chemother. 2010, 65, 2083–2088. [Google Scholar] [CrossRef] [PubMed]
- Vacher, S.; Menard, A.; Bernard, E.; Santos, A.; Megraud, F. Detection of mutations associated with macrolide resistance in thermophilic Campylobacter spp. by real-time PCR. Microb. Drug Resist. 2005, 11, 40–47. [Google Scholar] [CrossRef] [PubMed]
- Parkhill, J.; Wren, B.W.; Mungall, K.; Ketley, J.M.; Churcher, C.; Basham, D.; Chillingworth, T.; Davies, R.M.; Feltwell, T.; Holroyd, S.; et al. The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 2000, 403, 665–668. [Google Scholar] [CrossRef] [PubMed]
- Aksomaitiene, J.; Ramonaite, S.; Olsen, J.E.; Malakauskas, M. Prevalence of genetic determinants and phenotypic resistance to ciprofloxacin in Campylobacter jejuni from lithuania. Front. Microbiol. 2018, 9, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Ruiz, J. Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection. J. Antimicrob. Chemother. 2003, 51, 1109–1117. [Google Scholar] [CrossRef] [PubMed]
- Duarte, A.; Santos, A.; Manageiro, V.; Martins, A.; Fraqueza, M.J.; Caniça, M.; Domingues, F.C.; Oleastro, M. Human, food and animal Campylobacter spp. isolated in Portugal: High genetic diversity and antibiotic resistance rates. Int. J. Antimicrob. Agents 2014, 44, 306–313. [Google Scholar] [CrossRef]
- Koolman, L.; Whyte, P.; Burgess, C.; Bolton, D. Distribution of virulence-associated genes in a selection of Campylobacter isolates. Foodborne Pathog. Dis. 2015, 12, 424–432. [Google Scholar] [CrossRef]
- Talukder, K.A.; Aslam, M.; Islam, Z.; Azmi, I.J.; Dutta, D.K.; Hossain, S.; Nur-E.-Kamal, A.; Nair, G.B.; Cravioto, A.; Sack, D.A.; et al. Prevalence of virulence genes and cytolethal distending toxin production in Campylobacter jejuni isolates from diarrheal patients in Bangladesh. J. Clin. Microbiol. 2008, 46, 1485–1488. [Google Scholar] [CrossRef]
- Biswas, D.; Hannon, S.J.; Townsend, H.G.G.; Potter, A.; Allan, B.J. Genes coding for virulence determinants of Campylobacter jejuni in human clinical and cattle isolates from Alberta, Canada, and their potential role in colonization of poultry. Int. Microbiol. 2011, 14, 25–32. [Google Scholar]
- Eucker, T.P.; Konkel, M.E. The cooperative action of bacterial fibronectin-binding proteins and secreted proteins promote maximal Campylobacter jejuni invasion of host cells by stimulating membrane ruffling. Cell Microbiol. 2012, 14, 226–238. [Google Scholar] [CrossRef]
- Monteville, M.R.; Yoon, J.E.; Konkel, M.E. Maximal adherence and invasion of INT 407 cells by Campylobacter jejuni requires the CadF outer membrane protein and microfilament reorganization. Microbiology 2003, 149, 153–165. [Google Scholar] [CrossRef] [PubMed]
- Müller, J.; Schulze, F.; Müller, W.; Hänel, I. PCR detection of virulence-associated genes in Campylobacter jejuni strains with differential ability to invade Caco-2 cells and to colonize the chick gut. Vet. Microbiol. 2006, 113, 123–129. [Google Scholar] [CrossRef] [PubMed]
- Do Nascimento Veras, H.; Medeiros, P.H.Q.S.; Ribeiro, S.A.; Freitas, T.M.; Santos, A.K.S.; Amaral, M.S.M.G.; Bona, M.D.; Havt, A.; Lima, I.F.N.; Lima, N.L.; et al. Campylobacter jejuni virulence genes and immune-inflammatory biomarkers association with growth impairment in children from Northeastern Brazil. Eur. J. Clin. Microbiol. Infect. Dis. 2018, 37, 2011–2020. [Google Scholar] [CrossRef] [PubMed]
- Al-Mahmeed, A.; Senok, A.C.; Ismaeel, A.Y.; Bindayna, K.M.; Tabbara, K.S.; Botta, G.A. Clinical relevance of virulence genes in Campylobacter jejuni isolates in Bahrain. J. Med. Microbiol. 2006, 55, 839–843. [Google Scholar] [CrossRef] [PubMed]
- Rozynek, E.; Dzierzanowska-Fangrat, K.; Jozwiak, P.; Popowski, J.; Korsak, D.; Dzierzanowska, D. Prevalence of potential virulence markers in Polish Campylobacter jejuni and Campylobacter coli isolates obtained from hospitalized children and from chicken carcasses. J. Med. Microbiol. 2005, 54, 615–619. [Google Scholar] [CrossRef]
- Gubbels, S.-M.; Kuhn, K.G.; Larsson, J.T.; Adelhardt, M.; Engberg, J.; Ingildsen, P.; Hollesen, L.W.; Muchitsch, S.; Mølbak, K.; Ethelberg, S. A waterborne outbreak with a single clone of Campylobacter jejuni in the Danish town of Køge in May 2010. Scand. J. Infect. Dis. 2012, 44, 586–594. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Primer Name | Sequence (5′–3′) | Size (bp) | Reference |
---|---|---|---|---|
cadF | cadF-F2B cadF-R1B | CTAATACCTAAAGTTGAAAC CTAATACCTAAAGTTGAAAC | 400 | [42] |
ciaB | ciaB-652 ciaB-1159 | TGCGAGATTTTTCGAGAATG TGCCCGCCTTAGAACTTACA | 527 | [43] |
gryA | GyrAF1 GyrAR1 | CAACTGGTTCTAGCCTTTTG AATTTCACTCATAGCCTCACG | 210 | [40] |
tetO | TetO | GTGACATCTTTTCAGTGGGAGG CTTCCATCTGCACATTCCCC | 1014 | [14] |
23S rRNA at position 2074 | 23SRNA-F ERY2074R | TTAGCTAATGTTGCCCGTACCG TAGTAAAGGTCCACGGGGTCGC | 486 | [41] |
23S rRNA at position 2074 | 23SRNA-F ERY2074R | TTAGCTAATGTTGCCCGTACCG AGTAAAGGTCCACGGGGTCTCG | 485 | [41] |
Water Source | No. of Samples Collected | No. of Campylobacter Identified | C. jejuni | C. coli | C. upsaliensis |
---|---|---|---|---|---|
Direct Tap water | 8 | 0 | 0 | 0 | 0 |
Stored Tap water | 38 | 5 (13.2%) | 2 (10%) | 2 (10%) | 1 (5%) |
Stored well water | 42 | 15 (35.7%) | 9 (45%) | 6 (30%) | 0 |
River water | 4 | 0 | 0 | 0 | 0 |
Total | 92 | 20 (21.7%) | 11 (55%) | 8 (40%) | 1 (5%) |
Class of Antibiotic | Antibiotics | Code | Conc. (µg) | No. Resistant (%) | |
---|---|---|---|---|---|
Human Samples | WATER Samples | ||||
Macrolides | Clarithromycin | CLR | 15 | 44 (29.3) | 19 (95) |
Erythromycin | ERY | 15 | 40 (26.7) | 17 (85) | |
Carbapenem | Meropenem | MEM | 10 | 29 (19.3) | 3 (15) |
Imipenem | IPM | 10 | 23 (15.3) | 0 | |
β-lactam/β-lactamase inhibitor combination | Amoxicillin/clavulanic acid | AMX | 30 | 97 (64.7) | 6 (30) |
Penicillin | Ampicillin | AMP | 2 | 91 (60.7) | 14 (70) |
Fluoroquinolones | Ciprofloxacin | CIP | 5 | 27 (18) | 5 (25) |
Norfloxacin | NOR | 10 | 17 (13.3) | 8 (40) | |
Aminoglycosides | Amikacin | AMK | 30 | 27 (18) | 8 (40) |
Gentamicin | GEN | 10 | 23 (15.3) | 9 (45) | |
Tetracycline | Tetracycline | TET | 30 | 48 (32) | 11 (55) |
Tigecycline | TGC | 15 | 45 (30) | 9 (45) | |
Cephalosporine | Cephazolin | CFZ | 30 | 90 (60) | 10 (50) |
Cefuroxime | CXM | 30 | 81 (54) | 7 (35) |
Antibiotics | C. jejuni | C. coli | C. upsaliensis | |||
---|---|---|---|---|---|---|
Human Samples (n = 66) | Water Samples (n = 11) | Human Samples (n = 59) | Water Samples (n = 8) | Human Samples (n = 25) | Water Samples (n = 1) | |
Clarithromycin | 19 (28.7%) | 10 (90.9%) | 21 (35.5%) | 8 (100%) | 4 (16%) | 0 |
Erythromycin | 15 (22.7%) | 11 (100%) | 21 (35.5%) | 6 (75%) | 4 (16%) | 0 |
Meropenem | 9 (13.6%) | 1 (9%) | 16 (27%) | 2 (25%) | 4 (16%) | 0 |
Imipenem | 8 (12%) | 0 | 13 (22%) | 0 | 2 (8%) | 0 |
Amoxicillin/clavulanic acid | 44 (66.6%) | 4 (36.4%) | 36 (61%) | 2 (25%) | 17 (68%) | 0 |
Ampicillin | 40 (60.6%) | 10 (90.9%) | 37 (62.7%) | 5 (62.5%) | 14 (68%) | 1 (100%) |
Ciprofloxacin | 16 (24.2%) | 1 (9%) | 11 (18.6%) | 3 (37.5%) | 0 | 1 (100%) |
Norfloxacin | 11 (16.6%) | 2 (18%) | 5 (8.4%) | 5 (62.5%) | 1 (4%) | 1 (100%) |
Amikacin | 16 (24.2%) | 4 (36.4%) | 10 (16.9%) | 3 (37.5%) | 1 (4%) | 1 (100%) |
Gentamicin | 14 (21.2%) | 4 (36.4%) | 9 (15.2%) | 4 (50%) | 0 | 1 (100%) |
Tetracycline | 24 (36.3%) | 3 (27.3%) | 19 (32.2%) | 6 (75%) | 5 (20%) | 1 (100%) |
Tigecycline | 24 (36.3%) | 3 (27.3%) | 16 (32.2%) | 6 (75%) | 5 (20%) | 1 (100%) |
Cephazolin | 41 (62%) | 5 (45.5%) | 35 (59.3%) | 4 (50%) | 14 (56%) | 1 (100%) |
Cefuroxime | 33 (50%) | 2 (18%) | 37 (62.7%) | 4 (50%) | 11 (44%) | 1 (100%) |
Antibiotics/MIC | C. jejuni | C. coli | C. upsaliensis | |||
---|---|---|---|---|---|---|
Human | Water | Human | Water | Human | Water | |
Erythromycin | 16 (24.4%) | 10 (90%) | 22 (37.2%) | 5 (62.5%) | 4 (16%) | 0 |
Ciprofloxacin | 11 (16.6%) | 1 (9%) | 10 (16.9%) | 3 (37.5%) | 0 | 1 (100%) |
Tetracycline | 19 (28%) | 3 (27.3%) | 11 (18.6%) | 6 (75%) | 4 (16%) | 1 (100%) |
Ampicillin | 37 (56%) | 10 (90.9%) | 29 (49%) | 5 (62.5%) | 14 (56%) | 1 (100%) |
Gentamicin | 14 (21.2%) | 4 (36.45) | 6 (10%) | 4 (50%) | 0 | 1 (100%) |
Species | n | Human Samples | Water Sample | |||||
---|---|---|---|---|---|---|---|---|
gryA (%) | tetO (%) | Mutation at A2074C/A2075G (%) | n | gryA Gene (%) | tetO Gene (%) | Mutation at A2074C/A2075G (%) | ||
C. jejuni | 91 | 18 (19.7%) | 29 (31.8) | 17 (18.6) | 11 | 1 (9) | 3 (27.3) | 8 (72.7) |
C. coli | 81 | 14 (17.2) | 25 (30.8) | 20 (24.6) | 8 | 3 (37) | 5 (62.5) | 6 (75) |
C. upsaliensis | 34 | 6 (17.6) | 5 (14.7) | 3 (8.8) | 1 | 1 (100) | 0 | 1 (100) |
Total 206 | 206 | 38 (18.4) | 59 (28.6) | 40(19.4) | 20 | 5 (25) | 8 (40) | 15 (75) |
Campylobacter spp. | Human Samples | Water Samples | ||||
---|---|---|---|---|---|---|
n | ciaB (%) | cadF (%) | n | ciaB (%) | cadF (%) | |
C. jejuni | 108 | 40 (37) | 59 (54.6) | 11 | 8 (72.7) | 10 (90.9) |
C. coli | 89 | 35 (39.3) | 48 (53.9) | 8 | 7 (87.5) | 6 (75) |
C. upsaliensis | 40 | 15 (37.5) | 14 (35) | 1 | 1(100) | 1 (100) |
Total | 237 | 90 (38) | 121 (51) | 20 | 16 (80) | 17 (85) |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chukwu, M.O.; Abia, A.L.K.; Ubomba-Jaswa, E.; Obi, L.; Dewar, J.B. Characterization and Phylogenetic Analysis of Campylobacter Species Isolated from Paediatric Stool and Water Samples in the Northwest Province, South Africa. Int. J. Environ. Res. Public Health 2019, 16, 2205. https://doi.org/10.3390/ijerph16122205
Chukwu MO, Abia ALK, Ubomba-Jaswa E, Obi L, Dewar JB. Characterization and Phylogenetic Analysis of Campylobacter Species Isolated from Paediatric Stool and Water Samples in the Northwest Province, South Africa. International Journal of Environmental Research and Public Health. 2019; 16(12):2205. https://doi.org/10.3390/ijerph16122205
Chicago/Turabian StyleChukwu, Martina O., Akebe Luther King Abia, Eunice Ubomba-Jaswa, Lawrence Obi, and John Barr Dewar. 2019. "Characterization and Phylogenetic Analysis of Campylobacter Species Isolated from Paediatric Stool and Water Samples in the Northwest Province, South Africa" International Journal of Environmental Research and Public Health 16, no. 12: 2205. https://doi.org/10.3390/ijerph16122205
APA StyleChukwu, M. O., Abia, A. L. K., Ubomba-Jaswa, E., Obi, L., & Dewar, J. B. (2019). Characterization and Phylogenetic Analysis of Campylobacter Species Isolated from Paediatric Stool and Water Samples in the Northwest Province, South Africa. International Journal of Environmental Research and Public Health, 16(12), 2205. https://doi.org/10.3390/ijerph16122205