Molecular Analysis of HLA-G in Women with High-Risk Pregnancy and Their Partners with Regard to Possible Complications
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Groups and a Control Group
2.2. Division into Groups
2.3. Isolation of Genome DNA from Peripheral Blood Leukocytes
2.4. Sequencing
2.5. Analysis of the 14-bp ins/del Polymorphism in the 3′-Untranslated Region of the HLA-G Gene
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Limitations
Author Contributions
Funding
Conflicts of Interest
References
- Dahl, M.; Klitkou, L.; Christiansen, O.B.; Djurisic, S.; Piosik, Z.M.; Skovbo, P.; Møller, A.M.; Steffensen, R.; Hviid, T.V. Human leukocyte antigen (HLA)-G during pregnancy part II: Associations between maternal and fetal HLA-G genotypes and soluble HLA. Hum. Immunol. 2015, 76, 260–271. [Google Scholar] [CrossRef] [PubMed]
- Hunt, J.S.; Langat, D.L. HLA-G: A human pregnancy-related immunomodulator. Curr. Opin. Pharmacol. 2009, 9, 462–469. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Larsen, M.H.; Hviid, T.V. Human leukocyte antigen-G polymorphism in relation to expression, function, and disease. Hum. Immunol. 2009, 70, 1026–1034. [Google Scholar] [CrossRef] [PubMed]
- Kovats, S.; Main, E.K.; Librach, C.; Stubblebine, M.; Fisher, S.J.; DeMars, R. A class I antigen, HLA-G, expressed in human trophoblasts. Science 1990, 248, 220–223. [Google Scholar] [CrossRef] [PubMed]
- Jurisicova, A.; Casper, R.F.; MacLusky, N.J.; Mills, G.B.; Librach, C.L. HLA-G expression during preimplantation human embryo development. Proc. Natl. Acad. Sci. USA 1996, 93, 161–165. [Google Scholar] [CrossRef] [PubMed]
- Rous-Freiss, N.; GonZalves, R.M.; Menier, C.; Dausset, J.; Carosella, E.D. Direct evidence to support the role of HLA-G in protecting the fetus from maternal uterine natural killer cytolysis. Proc. Natl. Acad. Sci. USA 1997, 94, 11520–11525. [Google Scholar] [CrossRef] [Green Version]
- Ober, C.; Aldrich, C.; Rosinsky, B.; Robertson, A.; Walker, M.A.; Willadsen, S.; Verp, M.S.; Geraghty, D.E.; Hunt, J.S. HLA-G1 protein expression is not essential for fetal survival. Placenta 1998, 19, 127–132. [Google Scholar] [CrossRef]
- Kalotra, V.; Lall, M.; Verma, I.C.; Kaur, A. The HLA-G 14 bp insertion/deletion polymorphism and its association with soluble HLA-G levels in women with recurrent miscarriages. HLA 2018, 91, 167–174. [Google Scholar] [CrossRef]
- Kim, S.K.; Jeong, K.H.; Kang, I.J.; Chung, J.H.; Shin, M.K.; Lee, M.H. Relationship between the HLA-G 14 bp insertion/deletion polymorphism and susceptibility to autoimmune disease: A meta-analysis. Genet. Mol. Res. 2015, 14, 15839–15847. [Google Scholar] [CrossRef]
- Miyakis, S.; Lockshin, M.D.; Atsumi, T.; Branch, D.W.; Brey, R.L.; Cervera, R.; Derksen, R.H.; De Groot, P.G.; Koike, T.; Meroni, P.L.; et al. International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome (APS). J. Thromb. Haemost. 2006, 4, 295–306. [Google Scholar] [CrossRef] [Green Version]
- American College of Obstetricians and Gynecologists; Task Force on Hypertension in Pregnancy. Hypertension in pregnancy. Report of the American College of Obstetricians and Gynecologists’ Task Force on Hypertension in Pregnancy. Obstet. Gynecol. 2013, 122, 1122–1131. [Google Scholar] [CrossRef]
- Leszczyńska-Gorzelak, B.; Poniedziałek-Czajkowska, E. Rzucawka w ciąży—Aktualny problem kliniczny. Perinatologia Neonatologia i Ginekologia 2009, 2, 94–101. [Google Scholar]
- Yamashita, T.; Fujii, T.; Watanabe, Y.; Tokunaga, K.; Tadokoro, K.; Juji, T.; Taketani, Y. HLA-G genepolymorphism in a Japanese population. Immunogenetics 1996, 44, 186–191. [Google Scholar] [CrossRef]
- International Classification of HLA-G. Available online: https://www.anthonynolan.org/ (accessed on 9 September 2018).
- Rizzo, R.; Andersen, A.S.; Lassen, M.R.; Sorensen, H.C.; Bergholt, T.; Larsen, M.H.; Melchiorri, L.; Stignani, M.; Baricordi, O.R.; Hviid, T.V. Soluble human leukocyte antigen-G isoforms in maternal plasma in early and late pregnancy. Am. J. Reprod. Immunol. 2009, 62, 320–338. [Google Scholar] [CrossRef]
- Steinborn, A.; Rebmann, V.; Scharf, A.; Sohn, C.; Grosse-Wilde, H. Placental abruption is associated with decreased maternal plasma levels of soluble HLA-G. J. Clin. Immunol. 2003, 23, 307–314. [Google Scholar] [CrossRef]
- Zhu, X.; Han, T.; Yin, G.; Wang, X.; Yao, Y. Expression of human leukocyte antigen-G during normal placentation and in preeclamptic pregnancies. Hypertens. Pregn. 2012, 31, 252–260. [Google Scholar] [CrossRef]
- Zidi, I.; Rizzo, R.; Bouaziz, A.; Laaribi, A.B.; Zidi, N.; Di Luca, D.; Tlili, H.; Bortolotti, D. sHLA-G1 and HLA-G5 levels are decreased in Tunisian women with multiple abortion. Hum. Immunol. 2016, 77, 342–345. [Google Scholar] [CrossRef]
- Roberts, J.M.; Cooper, D.W. Pathogenesis and genetics of pre-eclampsia. Lancet 2001, 357, 53–56. [Google Scholar] [CrossRef]
- Akolelar, R.; Syngelaki, A.; Sarquis, R.; Zvanca, M.; Nicolaides, K.H. Prediction of early, intermediate and late preeclampsia from maternal factors, biophysical and biochemical markers at 11–13 weeks. Prenat. Diagn. 2011, 31, 66–74. [Google Scholar] [CrossRef]
- Sipak-Szmigiel, O.; Cybulski, C.; Ronin-Walknowska, E.; Lubiński, J. HLA-G alleles and risk of early pregnancy loss. Ann. Acad. Medicae Stetin. 2008, 54, 60–64. [Google Scholar]
- Abbas, A.; Tripathi, P.; Naik, S.; Agrawal, S. Analysis of human leukocyte antigen (HLA)-G polymorphism in normal women and in women with recurrent spontaneous abortions. Eur. J. Immunogenet. 2004, 31, 275–278. [Google Scholar] [CrossRef]
- Durmanova, V.; Drobny, J.; Shawkatova, I.; Dlhopolcek, J.; Bucova, M. Analysis of HLA-G gene polymorphisms in Slovak women with pre-eclampsia. Bratisl. Lek. Listy 2017, 118, 517–522. [Google Scholar] [CrossRef] [Green Version]
- Rokhafrooz, S.; Ghadiri, A.; Ghandil, P.; Ghafourian, M.; Hossaini, S.H.; Daraei, N.; Najafian, M.; Rouhizadeh, A. Association between HLA-G 14bp Gene Polymorphism and Serum sHLA-G Protein Concentrations in Preeclamptic Patients and Normal Pregnant Women. Immunol. Investig. 2018, 47, 558–568. [Google Scholar] [CrossRef]
- Ferreira, L.C.; Lopes, T.P.B.; Guimarães, T.B.; Gomes, C.E.M.; Jeronimo, S.M.B. The maternal 14 bp Ins/Del polymorphism in HLA-G is not associated with preeclampsia risk. Int. J. Immunogenet. 2017, 44, 350–355. [Google Scholar] [CrossRef]
- Aldrich, C.; Verp, M.S.; Walker, M.A.; Ober, C. A null mutation in HLA-G is not associated with preeclampsia or intrauterine growth retardation. J. Reprod. Immunol. 2000, 47, 41–48. [Google Scholar] [CrossRef]
- Hylenius, S.; Andersen, A.M.; Melbye, M.; Hviid, T.V. Association between HLA-G genotype and risk of pre-eclampsia: A case-control study using family triads. Mol. Hum. Reprod. 2004, 10, 237–246. [Google Scholar] [CrossRef]
- Moreau, P.; Contu, L.; Alba, F.; Lai, S.; Simoes, R.; Orrù, S.; Carcassi, C.; Roger, M.; Rabreau, M.; Carosella, E.D. HLA-G gene polymorphism in human placentas: Possible association of G*0106 allele with preeclampsia and miscarriage. Biol. Reprod. 2008, 79, 459–467. [Google Scholar] [CrossRef]
- Tan, C.Y.; Ho, J.F.; Chong, Y.S.; Loganath, A.; Chan, Y.H.; Ravichandran, J.; Lee, C.G.; Chong, S.S. Paternal contribution of HLA-G*0106 significantly increases risk for pre-eclampsia in multigravid pregnancies. Mol. Hum. Reprod. 2008, 14, 317–324. [Google Scholar] [CrossRef] [Green Version]
- Yie, S.M.; Li, L.H.; Xiao, R.; Librach, C.L. A single base-pair mutation in the 3′-untranslated region of HLA-G mRNA is associated with pre-eclampsia. Mol. Hum. Reprod. 2008, 14, 649–653. [Google Scholar] [CrossRef]
- Hashemi, M.; Mokhtari, M.; Khazaeian, S.; Bahari, G.; Rezaei, M.; Nakhaee, A.; Taheri, M. Evaluation of HLA-G 14-bp ins/del and +3142G>C polymorphisms with susceptibility to recurrent spontaneous abortion. Taiwan J. Obstet. Gynecol. 2017, 56, 276–280. [Google Scholar] [CrossRef]
- Koc, A.; Kirbiyik, O.; Kutbay, Y.B.; Ozyilmaz, B.; Ozdemir, T.R.; Kaya, O.O.; Kubat, G.; Koc, Z.P. Fetal HLA-G alleles and their effect on miscarriage. Adv. Clin. Exp. Med. 2018, 29. [Google Scholar] [CrossRef]
- Yazdani, N.; Shekari Khaniani, M.; Bastami, M.; Ghasemnejad, T.; Afkhami, F.; Mansoori Derakhshan, S. HLA-G regulatory variants and haplotypes with susceptibility to recurrent pregnancy loss. Int. J. Immunogenet. 2018, 45, 181–189. [Google Scholar] [CrossRef]
- Hernán, M.A.; Hernández-Díaz, S.; Werler, M.M.; Mitchell, A.A. Causal Knowledge as a Prerequisite for Confounding Evaluation: An Application to Birth Defects Epidemiology. Am. J. Epidemiol. 2002, 155, 176–184. [Google Scholar] [CrossRef] [Green Version]
No. | Group | Number of Patients | Diagnostic Criteria |
---|---|---|---|
1 | The group with antiphospholipid syndrome (APS) | 70 women and their 54 partners | The syndrome was diagnosed on the basis of clinical criteria (the patient’s obstetric history, and/or experience of embolic/thrombotic complications, and/or autoimmune diseases), and laboratory criteria. The criteria for inclusion in the group were [10]: (1) Thrombosis—one or more episodes of arterial thrombosis, venous thrombosis (except for superficial venous thrombosis, SVT), or capillary thrombosis within any tissue or organ, confirmed by imaging, Doppler, or histological examination; (2) obstetric failure, i.e., at least one death of a morphologically normal fetus after the 10th week of pregnancy, or at least one premature birth of the morphologically normal fetus before the 34th week of pregnancy due to preeclampsia, eclampsia, or severe placental insufficiency, or at least three spontaneous miscarriages before the 10th week of pregnancy with the exclusion of anatomical causes and hormonal disorders in the mother, and chromosomal disorders in both parents; (3) laboratory criteria—the presence of lupus anticoagulant in plasma detected on at least two occasions minimum 12 weeks apart, using methods recommended by the International Society on Thrombosis and Haemostasis; mean or high levels of IgG or IgM class anticardiolipin antibodies (>40 GPL or MPL or <99th percentile) detected on at least two occasions minimum 12 weeks apart by a standardized ELISA method; anti-β2-glycoprotein I antibodies in serum or plasma (>99th percentile) detected on at least two occasions minimum 12 weeks apart. |
2 | The group with preeclampsia (PE) | 48 women and their 43 partners | The criteria for a diagnosis of severe preeclampsia were [11,12]: (1) Increased blood pressure and proteinuria after the end of the 20th week of pregnancy (with the exception of gestational trophoblastic disease (GTD) and multifetal pregnancy); (2) the lack of proteinuria if the following occurred for the first time after the 20th week of pregnancy: Thrombocytopenia (a blood platelet count <100,000/µL), liver disease (two-fold higher transaminase activity than normal), impaired renal function (level of creatinine >1.1 mg/dL or a two-fold increase in the creatinine level without kidney disease in the patient’s medical history), pulmonary edema, central nervous system disorders, or vision disorders. The mean BMI of the pregnant women with preeclampsia was 28.1 (25.6–37.1); the mean birth weight of the infants was 2838.7 ± 514 g; 11 pregnant women were diagnosed with chronic hypertension. The patients after in vitro fertilization were not included in the study. |
3 | The group with intrauterine growth restriction (IUGR) | 35 women and their 34 partners | In this group, a fetal weight was below the 10th percentile for the gestational age according to the first ultrasound performed in pregnancy, and the causes of intrauterine growth restriction—such as genetic determinants, diabetes, hypertension, preeclampsia, infections, renal disease, fetal developmental malformations, smoking, alcohol consumption, uterine abnormalities, taking medicines, autoimmune disease, etc.—were excluded. |
4 | The group with recurrent spontaneous abortion (RSA) | 58 women and their 58 partners | The women in this group had at least three spontaneous miscarriages in the first trimester of pregnancy; other causes of miscarriages were excluded. In all pairs, a normal karyotype was confirmed and health problems, such as diabetes, thyroid and adrenal gland disease, anatomic abnormalities, TORCH infections (toxoplasmosis, other (syphilis, HIV, varicella), rubella, cytomegaloviral disease, herpes), other infections, and autoimmune disease (the presence of anticardiolipin antibodies, lupus anticoagulant, and antinuclear antibodies) were excluded. |
5 | The control group (C) | 89 healthy women and their 86 partners | The women in this group had no significant perinatal history, had given birth at least twice, and their pregnancies were uncomplicated. In these women, embolic/thrombotic complications and concomitant autoimmune diseases were excluded. |
EXON | Sequence 5′→ 3′ |
---|---|
EXON 2 | F GGGTCGGGCGGGTCTCAA R TCCGTGGGGCATGGAGGT |
EXON 3 | F GGGGCTGACCGGGGGT R GCTAGGCCAGGCTGGGA |
EXON 4 | F CCATGAGAGATGCAAAGTGCT R TGCTTTCCCTAACAGACATGAT |
HLA-G Allele | Study Group | Control Group | Total | |||
---|---|---|---|---|---|---|
n | % | n | % | n | % | |
105N | 13 | 1.63 | 6 | 1.71 | 19 | 1.65 |
103 | 5 | 0.63 | 0 | 0.00 | 5 | 0.43 |
106 | 40 | 5.00 | 11 | 3.14 | 51 | 4.43 |
10101 | 371 | 46.38 | 175 | 50.00 | 546 | 47.48 |
10102 | 202 | 25.25 | 89 | 25.43 | 291 | 25.30 |
10103 | 38 | 4.75 | 23 | 6.57 | 61 | 5.30 |
10104 | 1 | 0.13 | 0 | 0.00 | 1 | 0.09 |
10105 | 2 | 0.25 | 1 | 0.29 | 3 | 0.26 |
10106 | 9 | 1.13 | 7 | 2.00 | 16 | 1.39 |
10107 | 1 | 0.13 | 2 | 0.57 | 3 | 0.26 |
10108 | 59 | 7.38 | 14 | 4.00 | 73 | 6.35 |
10109 | 1 | 0.13 | 0 | 0.00 | 1 | 0.09 |
10110 | 12 | 1.50 | 2 | 0.57 | 14 | 1.22 |
10401 | 38 | 4.75 | 18 | 5.14 | 56 | 4.87 |
10402 | 0 | 0.00 | 1 | 0.29 | 1 | 0.09 |
10403 | 8 | 1.00 | 1 | 0.29 | 9 | 0.78 |
Total | 800 | 100 | 350 | 100 | 1150 | 100 |
HLA-G Allele | APS | PE | IUGR | RSA | C | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Women n = 70 | Men n = 54 | Women n = 48 | Men n = 43 | Women n = 35 | Men n = 34 | Women n = 58 | Men n = 58 | Women n = 89 | Men n = 86 | |||||||||||
n | % | n | % | n | % | n | % | n | % | n | % | n | % | n | % | n | % | n | % | |
105N | 2 | 1.43 | 3 | 2.78 | 2 | 2.08 | 0 | 0.00 | 1 | 1.47 | 0 | 0.00 | 4 | 3.45 | 1 | 0.86 | 3 | 1.69 | 3 | 1.74 |
103 | 0 | 0.00 | 1 | 0.93 | 0 | 0.00 | 0 | 0.00 | 1 | 1.47 | 0 | 0.00 | 2 | 1.72 | 1 | 0.86 | 0 | 0.00 | 0 | 0.00 |
106 | 10 | 7.14 | 7 | 6.48 | 1 | 1.04 | 7 | 8.14 | 2 | 2.94 | 4 | 5.71 | 4 | 3.45 | 5 | 4.31 | 5 | 2.81 | 6 | 3.49 |
10101 | 50 | 35.71 | 49 | 45.37 | 43 | 44.79 | 41 | 47.67 | 39 | 57.35 | 33 | 47.14 | 61 | 52.59 | 55 | 47.41 | 86 | 48.31 | 89 | 51.74 |
10102 | 38 | 27.14 | 25 | 23.15 | 26 | 27.08 | 22 | 25.58 | 13 | 19.12 | 23 | 32.86 | 25 | 21.55 | 30 | 25.86 | 50 | 28.09 | 39 | 22.67 |
10103 | 7 | 5.00 | 5 | 4.63 | 4 | 4.17 | 2 | 2.33 | 4 | 5.88 | 3 | 4.29 | 5 | 4.31 | 8 | 6.90 | 11 | 6.18 | 12 | 6.98 |
10104 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 1 | 0.86 | 0 | 0.00 | 0 | 0.00 |
10105 | 0 | 0.00 | 0 | 0.00 | 1 | 1.04 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 1 | 0.86 | 0 | 0.00 | 1 | 0.58 |
10106 | 0 | 0.00 | 2 | 1.85 | 1 | 1.04 | 1 | 1.16 | 1 | 1.47 | 2 | 2.86 | 1 | 0.86 | 1 | 0.86 | 6 | 3.37 | 1 | 0.58 |
10107 | 1 | 0.71 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 2 | 1.16 |
10108 | 12 | 8.57 | 5 | 4.63 | 14 | 14.58 | 9 | 10.47 | 4 | 5.88 | 2 | 2.86 | 8 | 6.90 | 5 | 4.31 | 5 | 2.81 | 9 | 5.23 |
10109 | 1 | 0.71 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 |
10110 | 3 | 2.14 | 3 | 2.78 | 2 | 2.08 | 0 | 0.00 | 0 | 0.00 | 2 | 2.86 | 1 | 0.86 | 1 | 0.86 | 1 | 0.56 | 1 | 0.58 |
10401 | 13 | 9.29 | 5 | 4.63 | 2 | 2.08 | 4 | 4.65 | 2 | 2.94 | 0 | 0.00 | 5 | 4.31 | 7 | 6.03 | 9 | 5.06 | 9 | 5.23 |
10402 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 1 | 0.56 | 0 | 0.00 |
10403 | 3 | 2.14 | 3 | 2.78 | 0 | 0.00 | 0 | 0.00 | 1 | 1.47 | 1 | 1.43 | 0 | 0.00 | 0 | 0.00 | 1 | 0.56 | 0 | 0.00 |
Total | 140 | 100 | 108 | 100 | 96 | 100 | 86 | 100 | 68 | 100 | 70 | 100 | 116 | 100 | 116 | 100 | 178 | 100 | 172 | 100 |
HLA-G Allele | APS vs. C | PE vs. C | ||||||||||
Women | Men | Women | Men | |||||||||
OR | (95% Cl) | p | OR | (95% Cl) | p | OR | (95% Cl) | p | OR | (95% Cl) | p | |
105N | 0.85 | 0.00–4.30 | 1.000 | 1.61 | 0.36–7.11 | 0.679 | 1.24 | 0.00–6.34 | 1.000 | 0.00 | 0.00–2.56 | 0.553 |
106 | 2.66 | 0.93–7.62 | 0.108 | 1.92 | 0.66–5.60 | 0.258 | 0.36 | 0.00–2.40 | 0.669 | 2.45 | 0.83–7.20 | 0.133 |
10101 | 0.50 | 0.38–0.93 | 0.03 | 0.77 | 0.48–1.25 | 0.327 | 0.87 | 0.53–1.34 | 0.613 | 0.85 | 0.51–1.42 | 0.598 |
10102 | 0.95 | 0.58–1.56 | 0.9 | 1.03 | 0.58–1.81 | 1.000 | 0.95 | 0.55–1.65 | 0.889 | 1.17 | 0.65–2.13 | 0.642 |
10103 | 0.80 | 0.31–2.06 | 0.808 | 0.65 | 0.23–1.82 | 0.608 | 0.66 | 0.22–2.03 | 0.586 | 0.32 | 0.00–1.30 | 0.152 |
10106 | 0.21 | 0.00–0.80 | 0.037 | 3.23 | 0.42– | 0.561 | 0.3 | 0.00–1.95 | 0.427 | 2.01 | 0.00– | 1.000 |
10108 | 3.24 | 1.16–9.05 | 0.042 | 0.88 | 0.30–2.58 | 1.000 | 5.91 | 2.13–16.29 | 0.001 | 2.12 | 0.83–5.39 | 0.128 |
10110 | 3.88 | 0.55– | 0.324 | 4.89 | 0.69– | 0.162 | 3.77 | 0.49– | 0.282 | 0.99 | 0.00– | 1.000 |
10401 | 1.92 | 0.81–4.53 | 0.182 | 0.88 | 0.30–2.58 | 1.000 | 0.4 | 0.00–1.68 | 0.339 | 0.88 | 0.28–2.88 | 1.000 |
HLA-G Allele | IUGR vs. C | RSA vs. C | ||||||||||
Women | Men | Women | Men | |||||||||
OR | (95% Cl) | p | OR | (95% Cl) | p | OR | (95% Cl) | p | OR | (95% Cl) | p | |
105N | 0.87 | 0.00–6.23 | 1.000 | 0.82 | 0.00–3.15 | 0.559 | 2.08 | 0.51–8.48 | 0.44 | 0.49 | 0.00–3.48 | 0.651 |
106 | 1.05 | 0.00–4.83 | 1 | 1.68 | 0.49–5.73 | 0.481 | 1.24 | 0.35–4.35 | 0.743 | 1.25 | 0.39–3.95 | 0.761 |
10101 | 1.44 | 0.82–2.52 | 0.254 | 0.83 | 0.48–1.45 | 0.572 | 1.19 | 0.74–1.89 | 0.551 | 0.84 | 0.53–1.35 | 0.548 |
10102 | 0.61 | 0.31–1.19 | 0.191 | 1.67 | 0.91–3.07 | 0.107 | 0.7 | 0.41–1.22 | 0.221 | 1.19 | 0.69–2.05 | 0.575 |
10103 | 0.95 | 0.31–2.94 | 1.000 | 0.6 | 0.18–2.04 | 0.564 | 0.68 | 0.24–1.94 | 0.604 | 0.99 | 0.40–2.44 | 1.000 |
10106 | 0.43 | 0.00–2.78 | 0.677 | 5.03 | 0.65– | 0.202 | 0.25 | 0.00–1.16 | 0.251 | 1.49 | 0.00– | 1.000 |
10108 | 2.16 | 0.61–7.70 | 0.266 | 0.53 | 0.00–2.26 | 0.518 | 2.56 | 0.86–7.64 | 0.144 | 0.82 | 0.28–2.39 | 0.787 |
10110 | 0.00 | 0.00– | 1.000 | 5.03 | 0.65– | 0.202 | 1.54 | 0.00–12.61 | 1.000 | 1.49 | 0.00– | 1.000 |
10401 | 0.57 | 0.00–2.41 | 0.732 | 0.26 | 0.00–1.01 | 0.063 | 0.85 | 0.29–2.48 | 1.000 | 1.16 | 0.44–3.11 | 0.797 |
14-bp ins/del Genotype | ||||||||||
Polymorphism in Women | APS n = 70 | PE n = 48 | IUGR n = 35 | RSA n = 58 | C n = 89 | |||||
n | % | n | % | n | % | n | % | n | % | |
ins/del | 24 | 34.29 | 19 | 39.58 | 15 | 44.12 | 22 | 37.93 | 33 | 37.08 |
del/del | 31 | 44.29 | 21 | 43.75 | 16 | 47.06 | 27 | 46.55 | 42 | 47.19 |
ins/ins | 15 | 21.43 | 8 | 16.67 | 3 | 8.82 | 9 | 15.52 | 14 | 15.73 |
Polymorphism in Men | APS n = 54 | PE n = 43 | IUGR n = 34 | RSA n = 58 | C n = 86 | |||||
n | % | n | % | n | % | n | % | n | % | |
ins/del | 17 | 31.48 | 13 | 30.23 | 11 | 31.43 | 23 | 39.66 | 34 | 39.53 |
del/del | 30 | 55.56 | 23 | 53.49 | 18 | 51.43 | 27 | 46.55 | 41 | 47.67 |
ins/ins | 7 | 12.96 | 7 | 16.28 | 6 | 17.14 | 8 | 13.79 | 11 | 12.79 |
Allele | Allele Common for Partners | APS n = 53 | PE n = 39 | IUGR n = 32 | RSA n = 58 | C n = 80 | |||||
---|---|---|---|---|---|---|---|---|---|---|---|
n | % | n | % | n | % | n | % | n | % | ||
HLA-G | none | 21 | 39.62 | 19 | 15.00 | 15 | 11.00 | 22 | 37.93 | 10 | 17.54 |
one | 27 | 50.94 | 21 | 18.00 | 16 | 18.00 | 27 | 46.55 | 44 | 77.19 | |
both | 5 | 9.43 | 8 | 6.00 | 3 | 3.00 | 9 | 15.52 | 3 | 5.26 | |
14-bp ins | none | 12 | 22.64 | 6 | 15.38 | 4 | 12.50 | 9 | 15.52 | 12 | 15.00 |
one | 21 | 39.62 | 19 | 48.72 | 13 | 40.63 | 29 | 50.00 | 46 | 57.50 | |
both | 20 | 37.74 | 14 | 35.90 | 15 | 46.88 | 20 | 34.48 | 22 | 27.50 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sipak, O.; Rył, A.; Grzywacz, A.; Laszczyńska, M.; Szymański, S.; Karakiewicz, B.; Rotter, I.; Cybulski, C. Molecular Analysis of HLA-G in Women with High-Risk Pregnancy and Their Partners with Regard to Possible Complications. Int. J. Environ. Res. Public Health 2019, 16, 982. https://doi.org/10.3390/ijerph16060982
Sipak O, Rył A, Grzywacz A, Laszczyńska M, Szymański S, Karakiewicz B, Rotter I, Cybulski C. Molecular Analysis of HLA-G in Women with High-Risk Pregnancy and Their Partners with Regard to Possible Complications. International Journal of Environmental Research and Public Health. 2019; 16(6):982. https://doi.org/10.3390/ijerph16060982
Chicago/Turabian StyleSipak, Olimpia, Aleksandra Rył, Anna Grzywacz, Maria Laszczyńska, Sławomir Szymański, Beata Karakiewicz, Iwona Rotter, and Cezary Cybulski. 2019. "Molecular Analysis of HLA-G in Women with High-Risk Pregnancy and Their Partners with Regard to Possible Complications" International Journal of Environmental Research and Public Health 16, no. 6: 982. https://doi.org/10.3390/ijerph16060982