Next Article in Journal
Comparison of Different Near-Infrared Technologies to Detect Sentinel Lymph Node in Uterine Cancer: A Prospective Comparative Cohort Study
Previous Article in Journal
The Challenges of Implementing Comprehensive Clinical Data Warehouses in Hospitals
Previous Article in Special Issue
Management Options for Ixodes ricinus-Associated Pathogens: A Review of Prevention Strategies
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJERPH
Volume 19
Issue 12
10.3390/ijerph19127378
ijerph-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Abundance of Ixodes ricinus Ticks (Acari: Ixodidae) and the Diversity of Borrelia Species in Northeastern Poland

by
Katarzyna Kubiak
1,*,
Hanna Szymańska
1,
Małgorzata Dmitryjuk
2 and
Ewa Dzika
1
1
Department of Medical Biology, Collegium Medicum, School of Public Health, University of Warmia and Mazury in Olsztyn, Zolnierska 14c, 10-561 Olsztyn, Poland
2
Department of Biochemistry, Faculty of Biology and Biotechnology, University of Warmia and Mazury in Olsztyn, Oczapowskiego 1A, 10-719 Olsztyn, Poland
*
Author to whom correspondence should be addressed.
Int. J. Environ. Res. Public Health 2022, 19(12), 7378; https://doi.org/10.3390/ijerph19127378
Submission received: 11 May 2022 / Revised: 11 June 2022 / Accepted: 14 June 2022 / Published: 16 June 2022
(This article belongs to the Special Issue Ticks and Tick Vectored Diseases—Biology to Society)
Browse Figures
Versions Notes

Abstract

:
Monitoring the abundance of ticks and the prevalence of pathogens in ticks is an important activity in assessing the risk of tick-borne diseases and helps to develop preventive measures. This study aimed to estimate the density of Ixodes ricinus, the prevalence of Borrelia species, and their diversity in northeastern Poland. The overall mean I. ricinus density was 9.7 ticks/100 m2. There were no differences between years, subregions, or habitats of study. The Borrelia infection rate was higher in females (22.6%) and males (14.3%) than in nymphs 5.5% (MIR). The most infected ticks came from the eastern subregion (10.1%) where the incidence of borreliosis among the inhabitants was over 20% higher than in the other subregions. In the infected ticks, B. afzelii (38.3%) and B. garinii (34.5%) were predominant. B. bavariensis was confirmed in I. ricinus in Poland for the first time. The most polymorphic was B. garinii. B. miyamotoi (belonged to the European type) was identified as a mono-infection in 0.9% of ticks and in 1.5% as a co-infection with B. afzelii and with B. garinii. Besides the risk of borreliosis and co-infections with different Borrelia species, physicians should also be aware of B. miyamotoi infections among patients.

1. Introduction

Significant ecological changes in climate and habitat caused by human population growth, such as urbanisation and agricultural intensification, contribute to the increase in the (re-) emergence of infectious diseases (EIDs) [1,2]. According to the World Health Organization (WHO), 75% of emerging infectious diseases that have affected people over the past three decades have originated from animals [3]. Among zoonosis, 22% of them are vector-borne and transmitted mainly by mosquitoes and ticks [4,5]. The most commonly diagnosed disease transmitted to humans by ticks of the genus Ixodes in the northern hemisphere, including the United States and Europe [6,7], is Lyme borreliosis (LB). LB is considered the prototype of a tick-borne emerging infectious disease [7]. Since 1983, when the association of infection with Borrelia spirochetes with clinical symptoms in humans was first documented, the worldwide burden of LB has increased and extended into regions and countries where the disease was not previously reported [8,9]. In Europe, the number of cases has increased steadily, with more than 360,000 cases reported over the last two decades. Every year over 85,000 LB cases are recorded, with the highest incidence in Central Europe (Czech Republic, Estonia, Lithuania, Slovakia, and Poland) [10,11].
The etiological agents of LB are the spirochetes of the Borrelia burgdorferi sensu lato (s.l.) complex, which is comprised of 21 species [12]. Six of them (B. burgdorferi sensu stricto (s.s.), B. afzelii, B. garinii, B. bavariensis, B. lusitaniae, and B. spielmanii) are regarded as human pathogens [7,12]. However, the DNA of B. valaisiana and B. bissettii has also been detected in tissues of symptomatic patients, so the pathogenicity of these species is not excluded, but still unclear [13,14,15,16,17]. The participation of Ixodes ticks was also confirmed in the transmission of B. miyamotoi, a species closely related to LB spirochetes, which is included in the tick-borne relapsing fever (TBRF) group [18,19,20,21]. Since 2011, when the first symptomatic case of human infection was recorded in Russia, B. miyamotoi has been classified as a human pathogen [22]. Further cases of human infection were reported in the USA [23,24], Europe (the Netherlands, Germany, Poland, Sweden, and France) [25,26,27,28], and Asia [29,30,31].
The genetic differentiation of Borrelia spirochetes at the inter- and intraspecies levels is associated with a wide range of non-specific clinical symptoms, making infection difficult to diagnose, treat, and produce effective preparations for immunoprophylaxis [8,32]. There were also differences noted in the geographical distribution of individual Borrelia species and changes in their prevalence over time [11,33], which is directly influenced by the occurrence of vectors (ticks) and reservoirs (vertebrates) of Borrelia spp. spirochetes. This depends on the conditions in local ecosystems and global environmental and socio-economic changes resulting from human activity [34]. Therefore, monitoring the distribution of ticks in the environment and tick infection rate with pathogenic, non-pathogenic/conditionally pathogenic, or new species (e.g., B. miyamotoi) is one of the main activities in assessing the risk of tick-borne diseases [33,35]. It is also an important contribution to understanding LB epidemiology and helps to diagnose and develop preventive measures.
Northeastern Poland (the Warmia and Mazury region) is particularly rich in habitats that are favourable to ticks and reservoir species for Borrelia spp. This region could be classified as an LB “hotspot” since, among the inhabitants of this region, the incidence of LB is nearly two times greater than in the rest of Poland [36] (Figure 1). Despite this fact, the data on the diversity and prevalence of Borrelia species in I. ricinus in northeastern Poland are historical and, due to the methods used, they concern only three pathogenic Borrelia species (B. burgdorferi s.s., B. garinii, and B. afzelii) [37,38] and do not cover the entire region [39,40,41].
The aims of the study were: (1) to assess the tick density and infection rate of Borrelia spirochetes in the population of I. ricinus ticks in northeastern Poland, (2) to identify the species and intraspecies diversity of the genus Borrelia in the study area, (3) to study the influence of conditions connected with the subregion, the biotope, and the year on tick density and the differences in the Borrelia species composition in I. ricinus, and (4) to determine the prevalence and intraspecific genetic diversity of B. miyamotoi in I. ricinus ticks in the study area.

2. Materials and Methods

2.1. Study Area and Tick Collection

Tick sampling was conducted at 15 sites near recreational areas, forest parking lots and picnic areas, and forest paths in six region districts of Warmia and Mazury in northeastern Poland (Figure 1, Table S1). The tick collection sites (surfaces of 400–500 m2) represented the western, central, and eastern parts of the region and two types of habitats: (a) forest landscapes (mature mixed and deciduous forests) and (b) ecotones (zones between grassy and forested areas such as paths near forest borders) (Table S1). At each site, questing I. ricinus ticks were collected during the springtime activity of ticks (April–June) of 2016 and 2017. Collections were performed twice per month in each year of the study during the daytime between 9 a.m. and 4 p.m. by two persons for at least 30 min using the standard flagging method. Ticks were not collected during and shortly after rainfall or on very sunny and hot days. Collected ticks were preserved in 70% ethanol. In the laboratory, specimens were identified by species, sex, and life stage using a taxonomic key [42] and were preserved individually (adults) or in pools (nymphs) at −80 °C for further molecular analysis.

2.2. DNA Extraction

The extraction of genomic DNA from ticks was carried out by universal kit Sherlock AX (A&A Biotechnology, Gdynia, Poland) according to the manufacturer’s instructions. DNA was isolated from individual specimens of adults and pools of five nymphs. Before DNA extraction, the ticks were air-dried for several minutes and then cut and crushed with a sterile scalpel. Extracted DNA was eluted in 40 μL of TE buffer and stored at −80 °C for further analysis.

2.3. Borrelia Spirochaete DNA Detection

The presence of Borrelia spirochaetes in tick genomic DNA isolates was confirmed by the amplification of different loci: (a) 16S rRNA gene (357 bp) with primers LDF/LDR [43], (b) outer surface protein A (ospA) gene (307 bp) with primers SL1/SL2 [44], and (c) the flagellin (flaB) gene with the primers BFL1/BFL2 [45,46] (422 bp) in conventional PCR and two sets of primers: outer—132f/905r (774 bp) and inner—220f/823r (604 bp) in nested PCR (nPCR) [47] (Table 1). All amplifications were performed with a total volume of 25 µL of PCR mixture containing 12.5 µL of 2 × PCR Master Mix Plus (0.1 U/µL of Taq polymerase supplied in a PCR buffer, 4 mM of MgCl2, and 0.5 mM of each dNTPs) (A&A Biotechnology, Gdynia, Poland), 0.5 µL of each primer (10 µM), 5 µL of template DNA (in nPCR—1 µL of template DNA or 1 µL of the outer PCR product), and an appropriate amount of sterile nuclease-free water. DNA isolated from a B. afzelii-positive I. ricinus tick (confirmed by sequencing in an earlier study) and nuclease-free water were run in each PCR as positive and negative controls, respectively. PCR amplicons were visualised on 1.5% agarose gels stained with Midori Green Stain (Nippon Genetics Europe, Düren, Germany) using GelDocXR (Bio-Rad, Hercules, CA, USA). Each DNA sample was considered Borrelia-positive when fragments of the 16S rRNA/ospA gene and fragment flaB gene were amplified.
Among Borrelia-positive samples in nPCR, B. miyamotoi DNA was also detected with specific primers BmF/BmR for the flaB marker [40]. All isolates positive for B. miyamotoi based on the flaB gene were confirmed by amplifying the fragment of the glycerophosphodiester phosphodiesterase (glpQ) gene (700bp) that is specific for relapsing fever Borrelia spp. [48] (Table 1).

2.4. Borrelia Species Identification by the PCR-RFLP Method

The restriction fragment length polymorphism (RFLP) method was used to identify Borrelia species. The characteristic patterns of DNA fragments were obtained by the digestion of amplicons of the flaB gene with a length of approximately 422 bp (amplified with BFL1/BFL2) and 604 bp (amplified with 220f/823r) by using the restriction enzymes Tsp 509I (TasI) and HpyF3I (DdeI) (ThermoFisher Scientific, Waltham, MA, USA), respectively. The digestions were performed according to the manufacturer’s instructions. Restriction fragments were separated on 3% agarose gel stained with Midori Green Stain (Nippon Genetics Europe, Düren, Germany) and visualised using GelDocXR (Bio-Rad, Hercules, CA, USA). The RFLP patterns obtained by using HpyF3I enzyme enabled the identification of nine Borrelia species: B. afzelii, B. garinii/B. bavariensis, B. burgdorferi sensu stricto (s.s.), B. lusitaniae, B. valaisiana, B. bissetti, B. spielmanii, and B. miyamotoi, which were included in the relapsing fever group of Borrelia [47,49]. The Tsp 509I enzyme allows for distinguishing B. garinii and B. afzelii from the group of other species of the B. burgdorferi s.l. complex: B. burgdorferi s.s., B. lusitaniae, B. valaisiana, B. bissetti, B. spielmanii, B. finlandensis, and B. carolinensis [46].

2.5. Borrelia Species Identification by DNA Sequencing

To confirm the typing of Borrelia species, 258 flaB genes and 9 glpQ gene-positive PCR products were purified using the CleanUp purification kit (A&A Biotechnology, Gdynia, Poland) according to the manufacturer’s protocol and sequenced bi-directionally with 220f/823r, BFL1/BFL2, BmF/BmR, or GLPQF/GLPQR primers (Macrogen Europe, Amsterdam, The Netherlands). The obtained nucleotide sequences were edited in BioEdit v. 7.2 software [50] (https://bioedit.software.informer.com, accessed on 20 March 2021) and compared with data registered in the GenBank database (http://www.ncbi.nih.gov/Genbank/index.html, accessed on 23 March 2021) using the BLAST-NCBI program (http://www.ncbi.nlm.nih.gov/BLAST/, accessed on 23 March 2021). Consensus sequences of the Borrelia flaB gene and B. miyamotoi glpQ gene were deposited in the GenBank database and registered under the accession numbers MW963151-MW963173.

2.6. Phylogenetic Analysis

The phylogenetic analysis used B. miyamotoi and B. bavariensis flaB gene sequences that were obtained from the collected I. ricinus ticks and the most similar chosen reference sequences from GenBank. The phylogram was constructed using the Maximum Likelihood method based on the Kimura 2-parameter model. The topology of the phylogenetic tree was evaluated using the bootstrap method with 1000 replicates. Phylogenetic analysis was conducted using MEGA X software [51] (https://www.megasoftware.net, accessed on 30 April 2021).

2.7. Statistical Analysis

The density of I. ricinus ticks for each collection site was estimated by determining the number of ticks per 100 m2 for each flagging event. Differences in mean tick densities were evaluated by ANOVA with normal errors. The General Linear Model (GLM) of One Variable was used to test the main effects of Year (2016, 2017), Region (West, Central, East), and Habitat (forest landscape, ecotone) on the density of I. ricinus ticks (nymphs, females, males, total). A chi-square test or Fisher’s exact test (when the expected frequency was < 5 in at least one of the cells of the contingency table) and 95% confidence intervals (95% CI) were used to compare the differences in the prevalence of Borrelia spirochaetes in the tested population and the distribution of Borrelia species in infected ticks between developmental stages of ticks, years, regions, and habitats. Borrelia infection in nymphs (tested in pools of five) was presented as the Minimum Infection Rate (MIR) and estimated as the ratio of the number of positive pools to the total number of tested samples, assuming only one infected tick specimen in a positive pool.
The analysis was conducted using the software package SPSS version 27.0 for Windows (SPSS Inc., Chicago, IL, USA). In all analyses, p-values below 0.05 were considered statistically significant.

3. Results

3.1. Tick Density

In 2016 and 2017, during the springtime activity of ticks, a total of 4334 I. ricinus were collected, which was comprised of 3473 nymphs and 861 adults (399 females, 462 males). The overall mean density was 9.7 ticks per 100 m2 (Table 2). There were no differences between the years, regions, or habitats of the study (Table 2, Figure 2, Table S2); only the interaction between year and region had significant effects on the total tick density (Year × Region: F2,89 = 3.5, p = 0.036). In 2016, the I. ricinus mean density was significantly higher in the western subregion (11.7 ticks/100 m2) in comparison to the central (8.9 ticks/100 m2) subregion (Table 2, Table S2).
During the study, the highest mean density was noted for nymphs (7.8/100 m2). The year of study had a significant effect on the mean nymph density (Year: F1,89 = 11.7, p = 0.001). The presence of nymphs was 8.8 and 6.8 ticks per 100 m2 in 2016 and 2017, respectively. The mean nymph density also differed between regions (Region: F2,89 = 5.7, p = 0.005). In the western subregion, nymph density was significantly higher (9.2/100 m2) than in the central (7.6 ticks/100 m2) and eastern (6.6 ticks/100 m2) subregions (Table 2, Table S2).
The mean density of adults was similar, i.e., 0.9 and 1.0 ticks per 100 m2, for females and males, respectively. The mean density of females was significantly different between regions (Region: F2,89 = 3.8, p = 0.027) (Table 2, Table S2). In males, the year of study had a significant effect on the mean density (Year: F1,89 = 6.0, p = 0.016) (Table 2, Table S2).

3.2. Prevalence of Borrelia Spirochaetes

For the presence of Borrelia DNA, a total of 4281 I. ricinus ticks were tested, including 861 specimens of adults (399 females, 462 males) and 3420 nymphs (tested in 684 pools, 53 nymphs did not form complete pools from a given flagging event and collection site). In 2016–2017, the overall natural tick infection rate was 8.1% (345/4281) and differed significantly between the developmental stages of ticks (χ2 = 166.96, p < 0.001) (Table 3). Borrelia DNA was detected in 22.6% (90/399) of the females and 14.3% (66/462) of the males. Among nymphs, the MIR was 5.5% (189/3420). There were significant differences in Borrelia spp. infection in I. ricinus between the year of the study (χ2 = 10.24, p < 0.001) (Table 3). Borrelia DNA was confirmed in 6.8% and 9.5% of the tested DNA samples in 2016 and 2017, respectively. The lowest Borrelia spp. prevalence in I. ricinus ticks was recorded in the western subregions of Warmia and Mazury (5.7%, 89/1559) compared to the central (8.7%, 118/1351) and eastern (10.1%, 138/1371) subregions (χ2 = 19.90, p < 0.001) (Table 3). The type of habitat did not affect the Borrelia infection rate (χ2 = 2.96, p = 0.085) (Table 3). In the population of ticks from forest areas, the level of infection was 8.8% (172/1945) and 7.4% (173/2336) in the ecotones.

3.3. Borrelia Species Distribution

Among the Borrelia-positive samples, six species from the B. burgdorferi s.l. group (B. afzelii, B. garinii, B. burgdorferi s.s., B. valaisiana, B. lusitaniae, and B. bavariensis) and B. miyamotoi (from the group of spirochetes causing TBRF) were identified by PCR-RFLP and/or sequencing (Figure 3). In 91.6% (316/345, 95% CI: 89–95%) of samples, Borrelia species occurred as mono-infections. Species typing revealed the domination of single infections that are pathogenic for humans: B. afzelii (38.3%, 132/345), B. garinii (34.5%, 119/345), and B. lusitaniae (10.7%, 37/345). The remaining species occurred as single infections in about 8% of Borrelia-positive samples (Figure 3).
Co-infections were identified in 8.4% (29/345, 95% CI: 5–11%) of the tested DNA samples. Two different Borrelia species were detected in 5.9% (20/345), and three were detected in 2.6% (9/345) of positive samples. Double infections included B. afzelii/B. garinii, B. afzelii/B. burgdorferi s.s., B. garinii/B. burgdorferi s.s., and B. garinii/B. valaisiana, and triple infections included B. afzelii/B. garinii/B. lusitaniae, B. afzelii/B. garinii/B. burgdorferi s.s., and B. afzelii/B. burgdorferi s.s./B. lusitaniae (Figure 3 and Figure 4).
B. miyamotoi was identified as a mono-infection in three Borrelia-positive samples (3/345, 0.9%) and in four Borrelia-positive samples as a co-infection with B. afzelii, as well as in one with B. garinii (5/345, 1.5%) (Figure 3, Table 4). All co-infections of B. miyamotoi occurred in DNA samples isolated from pools of nymphs.
The distribution of Borrelia species showed significant differences between I. ricinus stages (χ2 = 56.57, p = 0.002) (Table 4). Mono-infections were the most common in females and males, with 92.2% and 93.9%, respectively. Adult ticks were more frequently infected with B. afzelii (42.2% for females, 40.9% for males). In nymphs, B. garinii dominated (MIR: 78/189, 41.3%) (Table 4). About 62% (18/29) of co-infections were detected in nymphs. However, the analysis of co-infections in nymphs is not justified because the DNA was extracted from pooled tick samples. In adult I. ricinus, co-infections were more frequent in females than males (Table 4). Females carried only double infections of Borrelia spp., and none were infected with three species. In males, double and triple infections of Borrelia species appeared in equal proportions (Table 4).
The year of study and the biotope did not affect the Borrelia species composition (Table 4). Significant differences were only found between subregions (χ2 = 46.96, p < 0.05) (Table 4). B. garinii dominated in the western subregion of Warmia and Mazury and constituted 42.7% (38/89) of all positive samples in this region. In the central subregion, B. afzelii was most frequently identified (50.8%, 60/118), while in the eastern subregion, both species were found in comparable proportions, with 34.1% (47/138) and 32.6% (45/138) of positive samples, respectively. B. miyamotoi as a mono-infection occurred with equal frequency in each subregion, while it occurred as a co-infection with B. afzelii in the western subregion of Warmia and Mazury. Co-infection of B. miyamotoi and B. garinii was identified in the eastern subregion (Table 4).

3.4. Genetic Diversity in flaB Gene in Borrelia Species

To confirm Borrelia species identification based on RFLP of the flaB gene, 58 (44%) PCR amplicons were typed as B. afzelii, and all 184 were typed as other Borrelia species from a total of 316 mono-infected samples that were sequenced. All obtained chromatograms were checked manually, and 114 sequences with good quality obtained in nPCRs (~604 bp) were used for genetic diversity analysis.
Overall, 21 variants of the flaB gene were identified (Table S3). The most polymorphic species was B. garinii. Among the 37 sequenced samples, 11 flaB gene variants were recognised. Nine of them were previously identified in I. ricinus ticks questing and feeding on the hosts in Poland and other European countries and in the tissues of wild mice of the genus Apodemus, which were considered to be reservoir species for Borrelia spp. (Table S3). Two variants, i.e., BgV4 (n = 4) and BgV10 (n = 1) (Table S3), were unique and displayed 99.6% and 99.8% nucleotide identity to sequences detected in I. ricinus from different parts of Poland and the Czech Republic (GenBank: MK604255, KF990320, JN828685).
In B. lusitaniae, the second-most polymorphic species among 23 sequenced samples, four flaB gene variants were identified (Table S3). Two of them (BlV1 and BlV3) showed 100% nucleotide identity with sequences obtained from I. ricinus from Poland, Romania, and Turkey, as well as from the spleens of Apodemus mice from Poland. Variants BlV2 and BlV4 were not deposited previously in GenBank and showed 99.8% and 99.6% identity to sequences detected in I. ricinus from central (GenBank: MF150075) and western (GenBank: KF422804) Poland and Romania (GenBank: MW272741) (Table S3).
Only two variants were recognised among 40 flaB gene sequences of B. afzelii. Variant BaV1, which was detected in 38 sequenced samples, showed 100% identity to the strains BO23 (GenBank: CP018262) and K78 (GenBank: CP009058) that were detected in symptomatic patients with borreliosis in Germany and Austria (Table S3). This pathogenic variant also occurred in I. ricinus from another part of Poland (GenBank: MK604271). The second variant of B. afzelii BaV2 was identified in only two sequenced samples and displayed the highest similarity with sequences from questing I. ricinus from Poland and the Czech Republic (GenBank: KR782215, KF422856, JN828691).
No diversity of the flaB gene was detected among sequenced samples of B. burgdorferi s.s. and B. valaisiana (Table S3). The B. burgdorferi s.s. variant (n = 5) showed 100% nucleotide identity to sequences that occurred in patients from the Czech Republic (GenBank: FJ231335) and in ticks from Poland and Germany. The variant of B. valaisiana (n = 5) was also previously identified in I. ricinus from Poland and Lithuania and I. persulcatus in Siberia (Russia) (Table S3).
The single B. bavariensis sequence detected in an I. ricinus male from the central subregion of Warmia and Mazury was identical with sequences of Pbi strain isolated from a human sample in Germany (GenBank: CP028872) and a I. ricinus tick from Iran (GenBank: MN958342) (Figure 5, Table S3).
In B. miyamotoi, positive ticks from all three sequences of the flaB gene fragments (from mono-infected isolates) (GenBank: MW963151) were monomorphic and showed 100% nucleotide identity to the sequences of B. miyamotoi strains obtained from naturally infected I. ricinus ticks from the Czech Republic, the Netherlands, northern Poland, and Russia (European type) (Figure 5). Belonging to the European type of B. miyamotoi, a lack of polymorphism was also confirmed based on the sequence analysis of a fragment of the glpQ gene detected in nine isolates from mono- and co-infected samples (GenBank: MW963173).

4. Discussion

The authors’ long-term monitoring of tick prevalence in northeastern Poland revealed that I. ricinus, a vector of human-pathogenic Borrelia spirochaetes, is the most abundant tick (with mean density 9.7 ticks per 100 m2) in northeastern Poland. In the central and eastern subregions of Warmia and Mazury (especially in open landscapes), the presence of Dermacentor reticulatus ticks was also confirmed, but with a much lower mean density (1.9 and 2.7 ticks per 100 m2 in natural and urban areas, respectively) [53]. In the studied population of I. ricinus ticks, a higher mean density of nymphs (7.8 ticks per 100 m2) than adult ticks was noted. The higher density of nymphs compared to adult ticks is consistent with the fact that most reported tick bites on humans are from nymphs [54,55,56,57]. Nymphs are therefore considered the most important life stage involved in transmitting Borrelia spirochetes to humans.
The density of I. ricinus in natural biotopes of this region is almost five times higher than in green recreational areas in Olsztyn, the capital of the Warmia and Mazury region [41]. Such disproportions in the average tick population density between urban and natural ecotypes have been confirmed in other areas [40,58,59,60]. Many studies have indicated that tick density in a given area depends on the local properties of the habitat, which affects the differences between regions, biotopes, and years of the study [40,60,61]. However, in northeastern Poland, tick density seems to be constant with a comparable level in subsequent years, subregions, and biotopes, both in forest landscapes and ecotones. This is probably due to the relative homogeneity of the area in terms of the shape of the surface and natural features and the mosaic structure with complexes of forests, lakes, peat bogs, used meadows, pastures, agricultural land, and relatively low human interference [62]. This ensures the optimal structure of vegetation and microclimate for ticks at the studied sites and access to mammalian hosts (rodents, deer) [63,64], which affects the reproduction of ticks and the maintenance of their population.
The landscape of the Warmia and Mazury region, with a high degree of forest cover and many lakes, allows and encourages residents to engage in outdoor activities (walking, picking berries and mushrooms, etc.) and is conducive to the development of tourism [65]. Such patterns of human behaviour bring people into contact with habitats populated by ticks and increase the risk of tick-borne infections [65,66,67].
The revealed average frequency (8.1%) of Borrelia spirochetes in I. ricinus in northeastern Poland is in the range of 0.25–12.4%, which was recorded in other regions of the country [68,69]. It is also in concordance with results from northeastern Poland over the last twenty years [38,70,71,72]. The overall level of infection in the I. ricinus population in northeastern Poland was identical to that noted in the current study, despite the use by Stańczak et al. (1999) [71] of a less sensitive method (indirect immunofluorescence assay) of spirochaete detection. The proportions of infected I. ricinus adults and nymphs examined by Pawełczyk and Siński (2004) [39] two decades ago were also similar. It is assumed that the risk of being bitten by an infected tick has not radically changed. The relatively constant prevalence of B. burgdorferi s.l. in the questing ticks over the past two decades has been confirmed by two meta-analyses [11,73] and a revisited study conducted in Hanover (Germany) [74] and in Ireland [75]. A higher prevalence of Borrelia spp. in I. ricinus in northeastern Poland was recorded to date only in the green areas of Olsztyn—the largest city of Warmia and Mazury—both in questing ticks (27%) [41] and feeding on dogs (35.7%) [76]. A lower level of Borrelia infection was noted in I. ricinus feeding on deer (5.4%) from northeastern Poland, which is associated with a confirmed elimination of Borrelia infection in ticks feeding on roe deer and other wild ungulates, possibly due to the bacteriolytic complement pathway in ungulate blood [64].
The level of Borrelia spp. infection in I. ricinus in northeastern Poland is more than two times lower than the calculated projection in a meta-analysis (19.3%) based on the results of studies from 2010–2016 on ticks from Central European countries [11]. This is undoubtedly due to the limitation of the current study resulting from the pooling of nymphs and using the minimum infection rate (MIR) to estimate the prevalence of Borrelia spp. and assuming that one nymph in the pool is infected. This reduced the overall mean incidence of spirochetes in I. ricinus ticks. The level of infection in adult ticks individually examined by us was similar to the infection rate reported by Strnad et al. (2017) [11] (18% vs 21.6%, respectively), but in nymphs tested in pools (MIR 5.5%) it was three times lower than the level of infection in nymphs tested individually (16.7%). This is also confirmed by a higher level of co-infection in nymphs than in adults, which have a much greater chance of acquiring Borrelia spirochetes than nymphs. However, the current data confirm the general trend that the level of infection in adult ticks is much higher than in nymphs [11,68]. In contrast to I. ricinus density, the Borrelia spirochete infection rate was significantly different between the years of the study and the subregions. The most Borrelia spp. infected region was the eastern subregion of Warmia and Mazury, where the incidence of LB among the inhabitants is over 20% higher than in the other subregions (Figure 1). The results from previous studies [77,78] indicate differences in the prevalence of Borrelia spp. in ticks from habitats (e.g., fragmented forest plots, continuous forests, ecotones) with a different biodiversity of vertebrates (hosts of ticks). However, the risk of acquiring LB in northeastern Poland seems to be similar in both study habitats forest and ecotones.
In the population of I. ricinus ticks in northeastern Poland, the richness of the spirochaete species was recorded. To date, among the twelve species of the B. burgdorferi s.l. complex identified in Europe [55], six were detected in northeastern Poland. Most of them have been confirmed as pathogenic to humans. In concordance with the meta-analysis results of data from 2010–2016 concerning the species composition of Borrelia spirochaetes in ticks from 23 European countries [11], B. afzelii and B. garinii species were also predominant in I. ricinus in this study. Those two species were identified in 75% of ticks. Despite the highest frequency, both species show extremely different genetic diversity within the partial sequence of the flaB gene; B. garinii was the most polymorphic of the identified species. Among 21 of the recognised variants in the flaB gene, over 50% occurred in B. garinii. In contrast, B. afzelii was the least diverse species, which was represented by only two variants of the flaB marker. A greater diversity of flaB markers within B. garinii was also recognised by Kowalec et al. (2017) [40] in natural ecotypes in eastern Poland, which can be explained by the high rates of avian host migration with which B. garinii is associated [68].
In I. ricinus of the Warmia and Mazury region, the current study did not confirm the occurrence of the pathogenic B. spielmanii previously detected in I. ricinus in Poland in the forested city areas of Warsaw [40] or in I. ricinus removed from humans [54]. However, B. bavariensis (formerly B. garinii OspA serotype 4) [79] was identified in I. ricinus males from the central subregion of Warmia and Mazury. As far as it is known, this species has not been previously recorded in ticks in Poland [68] and is not considered a public health issue in Poland, although antibodies against the p18 protein of B. bavariensis are present in 5% of foresters and 3% of farmers in southeastern Poland [80]. Recently, B. bavariensis has become of great interest due its isolation from LB patients in Europe, although detection in questing I. ricinus is very rare in Europe [11,81,82,83,84] and reports are mostly from Asia [52].
The genetic diversity of the Borrelia spirochetes is involved with differences in the clinical presentation and invasiveness of LB in humans. B. afzelii is most frequently associated with skin manifestations (erythrema migrans, acrodermatitis chronica atrophicans, or borrelial lymphocytoma), while B. garinii and B. bavariensis are most often associated with neuroborreliosis. In contrast, the pathogenicity of B. burgdorferi s.s. is related to neuroborreliosis and arthritis symptoms. Some species, such as B. lusitaniae, have only occasionally been associated with human disease [32,68]. The current finding of B. miyamotoi in I. ricinus in northeastern Poland as a mono-infection and co-infection with B. afzelii and B. garinii may also change the clinical picture of LB and its severity and make diagnosis and treatment difficult. It has been observed that B. miyamotoi is constantly circulating in European populations of questing I. ricinus, although its prevalence is low and ranges between 0.2% and 8.9%, depending on the region and the developmental stage of ticks [20]. A relatively high B. miyamotoi prevalence was detected in I. ricinus ticks removed from humans in Poland (8.4%) [54] and Germany (7.3%) [55]. In Poland, B. miyamotoi was also identified in I. ricinus in recreational areas in Szczecin [47] and Warsaw [40], and in natural habitats of Lower Silesia [85] and eastern Poland [40], with a prevalence ranging from 0.5–3.9%. In the Warmia and Mazury region, B. miyamotoi was identified in questing I. ricinus in green urban areas [41] and ticks feeding on deer [64]. Despite suggesting the presence of a genetically specific Polish strain of B. miyamotoi [40], the genetic analysis in the current study revealed a lack of polymorphism in the flaB gene and glpQ gene sequences and full nucleotide identity to the European type of B. miyamotoi. Despite the low prevalence of B. miyamotoi in I. ricinus in northeastern Poland, the authors strongly agree with the conclusion [40,54,55] that B. miyamotoi disease (BMD) should not be underestimated. The number of confirmed symptomatic and asymptomatic cases of BMD in Europe is steadily increasing and has been diagnosed so far in 50 patients, including one patient in Poland [20,26]. Therefore, physicians should be aware of B. miyamotoi infections among patients with unspecific feverish illness or with neurological symptoms that do not meet the criteria for neuroborreliosis (anti-Borrelia antibodies detected only in serum) [86].
Due to the lack of effective and commercially available human vaccines against LB, its control is limited to reducing the risk of contamination in the environment and encouraging the public to take preventive measures to avoid exposure to ticks [66,87]. Although human behaviour may affect the risk of tick exposure, space-time estimates of tick density and pathogen prevalence are necessary for these measures to be effective. It seems that research on local prevalence has a very limited value in terms of epidemiological risk assessment [11]. However, the integration of data from studies based on similar methodologies allows for the analysis (models, meta-analysis) of spatial and temporal changes and trends in determining human tick-borne disease incidence, including LB [11,35,66,73,88,89]. Moreover, for a disease of growing public health importance, and which is likely to affect increasing numbers of people, local government and healthcare professionals need to understand the current burden in their region [89,90,91,92].

5. Conclusions

The density of ticks in northeastern Poland is constant, regardless of the subregion, habitat, or year of study. Nevertheless, the risk of developing LB is high due to the prevalence and richness of the Borrelia species. Most of the Borrelia species identified in the I. ricinus population in northeastern Poland are human pathogens. An analysis of their frequency suggests a high probability of skin symptoms of LB caused by B. afzelii infection and cases of neuroborreliosis caused by B. garinii. Co-infection with several species of Borrelia spp. or infection/co-infection with B. miyamotoi may change the clinical picture of LB. Therefore, physicians should be aware of this and consider it when diagnosing patients suspected of having a tick-borne disease.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijerph19127378/s1, Table S1: Characteristics of I. ricinus tick collection localities in north-eastern Poland; Table S2: Statistical table of ANOVA (GLM) analysis of I. ricinus tick density in north-eastern Poland; Table S3: Variants of flaB gene in spirochaetes species from B. burgdorferi s.l complex identified in questing I. ricinus in north-eastern Poland.

Author Contributions

Conceptualization, K.K.; methodology, K.K.; formal analysis, K.K., H.S., M.D.; investigation, K.K., H.S.; writing—original draft preparation, K.K.; writing—review and editing, K.K., H.S., M.D.; visualization, K.K.; funding acquisition K.K., H.S., E.D. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Polish National Science Centre, grant MINIATURA3 No. 2019/03/X/NZ6/00431 and internal funding from the Collegium Medicum, University of Warmia and Mazury in Olsztyn. The funders had no role in study design, data collection and analysis, decision to publish or manuscript preparation.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors would like to thank Tański A. (Department of Medical Biology, UWM in Olsztyn) for drawing the map (Figure 1).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Clow, K.M.; Leighton, P.A.; Pearl, D.L.; Jardine, C.M. A Framework for Adaptive Surveillance of Emerging Tick-Borne Zoonoses. One Health 2019, 7, 100083. [Google Scholar] [CrossRef] [PubMed]
  2. Jones, K.E.; Patel, N.G.; Levy, M.A.; Storeygard, A.; Balk, D.; Gittleman, J.L.; Daszak, P. Global Trends in Emerging Infectious Diseases. Nature 2008, 451, 990–993. [Google Scholar] [CrossRef] [PubMed]
  3. World Health Organization. A Brief Guide to Emerging Infectious Diseases and Zoonoses; WHO Regional Office for South-East Asia: New Delhi, India, 2014.
  4. McArthur, D.B. Emerging Infectious Diseases. Nurs. Clin. N. Am. 2019, 54, 297–311. [Google Scholar] [CrossRef] [PubMed]
  5. Taylor, L.H.; Latham, S.M.; Woolhouse, M.E.J. Risk Factors for Human Disease Emergence. Philos. Trans. R. Soc. B Biol. Sci. 2001, 356, 983–989. [Google Scholar] [CrossRef]
  6. Stanek, G.; Wormser, G.P.; Gray, J.; Strle, F. Lyme Borreliosis. Lancet 2012, 379, 461–473. [Google Scholar] [CrossRef]
  7. Radolf, J.D.; Strle, K.; Lemieux, J.E.; Strle, F. Lyme Disease in Humans. Curr. Issues Mol. Biol. 2020, 42, 333–384. [Google Scholar] [CrossRef]
  8. Steere, A.C.; Strle, F.; Wormser, G.P.; Hu, L.T.; Branda, J.A.; Hovius, J.W.R.; Li, X.; Mead, P.S. Lyme Borreliosis. Nat. Rev. Dis. Prim. 2016, 2, 16090. [Google Scholar] [CrossRef] [Green Version]
  9. Stone, B.L.; Tourand, Y.; Brissette, C.A. Brave New Worlds: The Expanding Universe of Lyme Disease. Vector-Borne Zoonotic Dis. 2017, 17, 619–629. [Google Scholar] [CrossRef]
  10. Pritt, B.S.; Mead, P.S.; Johnson, D.K.H.; Neitzel, D.F.; Respicio-Kingry, L.B.; Davis, J.P.; Schiffman, E.; Sloan, L.M.; Schriefer, M.E.; Replogle, A.J.; et al. Identification of a Novel Pathogenic Borrelia Species Causing Lyme Borreliosis with Unusually High Spirochaetaemia: A Descriptive Study. Lancet Infect. Dis. 2016, 16, 556–564. [Google Scholar] [CrossRef] [Green Version]
  11. Strnad, M.; Hönig, V.; Růžek, D.; Grubhoffer, L.; Rego, R.O.M. Europe-Wide Meta-Analysis of Borrelia Burgdorferi Sensu Lato Prevalence in Questing Ixodes Ricinus Ticks. Appl. Environ. Microbiol. 2017, 83, e0069-17. [Google Scholar] [CrossRef] [Green Version]
  12. Eisen, L. Vector Competence Studies with Hard Ticks and Borrelia Burgdorferi Sensu Lato Spirochetes: A Review. Ticks Tick. Borne Dis. 2020, 11, 101359. [Google Scholar] [CrossRef] [PubMed]
  13. Diza, E.; Papa, A.; Vezyri, E.; Tsounis, S.; Milonas, I.; Antoniadis, A. Borrelia Valaisiana in Cerebrospinal Fluid. Emerg. Infect. Dis. 2004, 10, 1692–1693. [Google Scholar] [CrossRef] [PubMed]
  14. Derdáková, M.; Lenčáková, D. Association of Genetic Variability within the Borrelia Burgdorferi Sensu Lato with the Ecology, Epidemiology of Lyme Borreliosis in Europe. Ann. Agric. Environ. Med. 2005, 12, 165–172. [Google Scholar] [CrossRef]
  15. Jungnick, S.; Margos, G.; Rieger, M.; Dzaferovic, E.; Bent, S.J.; Overzier, E.; Silaghi, C.; Walder, G.; Wex, F.; Koloczek, J.; et al. Borrelia Burgdorferi Sensu Stricto and Borrelia Afzelii: Population Structure and Differential Pathogenicity. Int. J. Med. Microbiol. 2015, 305, 673–681. [Google Scholar] [CrossRef] [PubMed]
  16. Margos, G.; Sing, A.; Fingerle, V. Published Data Do Not Support the Notion That Borrelia Valaisiana Is Human Pathogenic. Infection 2017, 45, 567–569. [Google Scholar] [CrossRef] [PubMed]
  17. Stanek, G.; Reiter, M. The Expanding Lyme Borrelia Complex—Clinical Significance of Genomic Species? Clin. Microbiol. Infect. 2011, 17, 487–493. [Google Scholar] [CrossRef] [Green Version]
  18. Fukunaga, M.; Takahashi, Y.; Tsuruta, Y.; Matsushita, O.; Ralph, D.; McClelland, M.; Nakao, M. Genetic and Phenotypic Analysis of Borrelia Miyamotoi Sp. Nov., Isolated from the Ixodid Tick Ixodes Persulcatus, the Vector for Lyme Disease in Japan. Int. J. Syst. Bacteriol. 1995, 45, 804–810. [Google Scholar] [CrossRef] [Green Version]
  19. Cutler, S.J.; Vayssier-Taussat, M.; Estrada-Peña, A.; Potkonjak, A.; Mihalca, A.D.; Zeller, H. A New Borrelia on the Block: Borrelia Miyamotoi—A Human Health Risk? Eurosurveillance 2019, 24, 1. [Google Scholar] [CrossRef] [Green Version]
  20. Kubiak, K.; Szczotko, M.; Dmitryjuk, M. Borrelia Miyamotoi—An Emerging Human Tick-Borne Pathogen in Europe. Microorganisms 2021, 9, 154. [Google Scholar] [CrossRef] [PubMed]
  21. Siński, E.; Welc-Falęciak, R.; Zajkowska, J. Borrelia Miyamotoi: A Human Tick-Borne Relapsing Fever Spirochete in Europe and Its Potential Impact on Public Health. Adv. Med. Sci. 2016, 61, 255–260. [Google Scholar] [CrossRef]
  22. Platonov, A.E.; Karan, L.S.; Kolyasnikova, N.M.; Makhneva, N.A.; Toporkova, M.G.; Maleev, V.V.; Fish, D.; Krause, P.J. Humans Infected with Relapsing Fever Spirochete Borrelia Miyamotoi, Russia. Emerg. Infect. Dis. 2011, 17, 1816–1823. [Google Scholar] [CrossRef] [PubMed]
  23. Krause, P.J.; Narasimhan, S.; Wormser, G.P.; Rollend, L.; Fikrig, E.; Lepore, T.; Barbour, A.; Fish, D. Human Borrelia Miyamotoi Infection in the United States. N. Engl. J. Med. 2013, 368, 291–293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Molloy, P.J.; Telford, S.R.; Chowdri, H.R.; Lepore, T.J.; Gugliotta, J.L.; Weeks, K.E.; Hewins, M.E.; Goethert, H.K.; Berardi, V.P. Borrelia Miyamotoi Disease in the Northeastern United States a Case Series. Ann. Intern. Med. 2015, 163, 91–98. [Google Scholar] [CrossRef] [PubMed]
  25. Franck, M.; Ghozzi, R.; Pajaud, J.; Lawson-Hogban, N.E.; Mas, M.; Lacout, A.; Perronne, C. Borrelia Miyamotoi: 43 Cases Diagnosed in France by Real-Time PCR in Patients With Persistent Polymorphic Signs and Symptoms. Front. Med. 2020, 7, 55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Fiecek, B.; Lewandowska, G.; Roguska, U.; Rozej-Bielicka, W.; Tylewska-Wierzbanowska, S.; Chmielewski, T. Borrelia Miyamotoi DNA in a Patient Suspected of Lyme Borreliosis. Available online: https://assets.researchsquare.com/files/rs-5981/v2/manuscript.pdf (accessed on 11 January 2021). [CrossRef] [Green Version]
  27. Hovius, J.W.R.; De Wever, B.; Sohne, M.; Brouwer, M.C.; Coumou, J.; Wagemakers, A.; Oei, A.; Knol, H.; Narasimhan, S.; Hodiamont, C.J.; et al. A Case of Meningoencephalitis by the Relapsing Fever Spirochaete Borrelia Miyamotoi in Europe. Lancet 2013, 382, 658. [Google Scholar] [CrossRef] [Green Version]
  28. Tobudic, S.; Burgmann, H.; Stanek, G.; Winkler, S.; Schtta, A.M.; Obermller, M.; Markowicz, M.; Lagler, H. Human Borrelia Miyamotoi Infection, Austria. Emerg. Infect. Dis. 2020, 26, 2201–2204. [Google Scholar] [CrossRef]
  29. Sato, K.; Takano, A.; Konnai, S.; Nakao, M.; Ito, T.; Koyama, K.; Kaneko, M.; Ohnishi, M.; Kawabata, H. Human Infections with Borrelia Miyamotoi, Japan. Emerg. Infect. Dis. 2014, 20, 1391–1393. [Google Scholar] [CrossRef]
  30. Jiang, B.G.; Jia, N.; Jiang, J.F.; Zheng, Y.C.; Chu, Y.L.; Jiang, R.R.; Wang, Y.W.; Liu, H.B.; Wei, R.; Zhang, W.H.; et al. Borrelia Miyamotoi Infections in Humans and Ticks, Northeastern China. Emerg. Infect. Dis. 2018, 24, 236–241. [Google Scholar] [CrossRef] [Green Version]
  31. Gao, Y.; Lv, X.L.; Han, S.Z.; Wang, W.; Liu, Q.; Song, M. First Detection of Borrelia Miyamotoi Infections in Ticks and Humans from the Northeast of Inner Mongolia, China. Acta Trop. 2021, 217, 105857. [Google Scholar] [CrossRef]
  32. Strnad, M.; Grubhoffer, L.; Rego, R.O.M. Novel Targets and Strategies to Combat Borreliosis. Appl. Microbiol. Biotechnol. 2020, 104, 1915–1925. [Google Scholar] [CrossRef]
  33. Blazejak, K.; Raulf, M.K.; Janecek, E.; Jordan, D.; Fingerle, V.; Strube, C. Shifts in Borrelia Burgdorferi (s.l.) Geno-Species Infections in Ixodes Ricinus over a 10-Year Surveillance Period in the City of Hanover (Germany) and Borrelia Miyamotoi-Specific Reverse Line Blot Detection. Parasites Vectors 2018, 11, 304. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Estrada-Peña, A.; De La Fuente, J. The Ecology of Ticks and Epidemiology of Tick-Borne Viral Diseases. Antiviral Res. 2014, 108, 104–128. [Google Scholar] [CrossRef] [PubMed]
  35. Vu Hai, V.; Almeras, L.; Socolovschi, C.; Raoult, D.; Parola, P.; Pages, F. Monitoring Human Tick-Borne Disease Risk and Tick Bite Exposure in Europe: Available Tools and Promising Future Methods. Ticks Tick. Borne. Dis. 2014, 5, 607–619. [Google Scholar] [CrossRef] [PubMed]
  36. National Institute of Public Health–National Institute of Hygiene–Department of Epidemiology Infectious Diseases and Poisonings in Poland. Available online: http://www.pzh.gov.pl/oldpage/epimeld/index_p.htm (accessed on 11 January 2021).
  37. Wegner, Z.; Stańczak, J.; Racewicz, M.; Kruminis-Lozowska, W.; Kubica-Biernat, B. Occurrence of Borrelia Spirochaetes in Ticks (Acari, Ixodidae) Collected in the Forest Areas in Olsztyn Province (North Central Poland). Bull. Inst. Marit. Trop. Med. Gdynia 1993, 44–45, 51–59. [Google Scholar]
  38. Stańczak, J.; Kubica-Biernat, B. Prevalence of Borrelia Burgdorferi in Ixodes Ricinus Ticks from Different Areas of Poland. Proc. Zent. Bakteriol. 1999, 289, 704–705. [Google Scholar] [CrossRef]
  39. Pawełczyk, A.; Siński, E. Prevalence of Ixodes Ricinus Infection with Borrelia Burgdorferi s.l.: Seasonal and Annual Variations. Wiad Parazytol. 2004, 50, 253–258. [Google Scholar]
  40. Kowalec, M.; Szewczyk, T.; Welc-Falęciak, R.; Siński, E.; Karbowiak, G.; Bajer, A. Ticks and the City—Are There Any Differences between City Parks and Natural Forests in Terms of Tick Abundance and Prevalence of Spirochaetes? Parasites Vectors 2017, 10, 573. [Google Scholar] [CrossRef]
  41. Kubiak, K.; Dziekońska-Rynko, J.; Szymańska, H.; Kubiak, D.; Dmitryjuk, M.; Dzika, E. Questing Ixodes Ricinus Ticks (Acari, Ixodidae) as a Vector of Borrelia Burgdorferi Sensu Lato and Borrelia Miyamotoi in an Urban Area of North-Eastern Poland. Exp. Appl. Acarol. 2019, 78, 113–126. [Google Scholar] [CrossRef] [Green Version]
  42. Nowak-Chmura, M. Fauna Kleszczy (Ixodida) Europy Środkowej; Wydawnictwo Naukowe Uniwersytetu Pedagogicznego: Krakow, Poland, 2013. [Google Scholar]
  43. Marconi, R.T.; Garon, C.F. Erratum: Development of Polymerase Chain Reaction Primer Sets for Diagnosis of Lyme Disease and for Species-Specific Identification of Lyme Disease Isolates by 16S RRNA Signature Nucleotide Analysis (Journal of Clinical Microbiology 30:11 (2831)). J. Clin. Microbiol. 1993, 31, 1026. [Google Scholar]
  44. Demaerschalck, I.; Ben Messaoud, A.; De Kesel, M.; Hoyois, B.; Lobet, Y.; Hoet, P.; Bigaignon, G.; Bollen, A.; Godfroid, E. Simultaneous Presence of Different Borrelia Burgdorferi Genospecies in Biological Fluids of Lyme Disease Patients. J. Clin. Microbiol. 1995, 33, 602–608. [Google Scholar] [CrossRef] [Green Version]
  45. Stańczak, J.; Kubica-Biernat, B.; Burkiewicz, A.; Racewicz, M.; Kruminis-Łozowska, W.; Kur, J. Preliminary Studies of the Use of Polymerase Chain Reaction (PCR) for the Detection of Borrelia Burgdorferi Sensu in Ticks Ixodes Ricinus (Acari, Ixodidae). Probl. Hig. I Epidemiol. 1997, 54, 122–126. [Google Scholar]
  46. Strzelczyk, J.K.; Gaździcka, J.; Cuber, P.; Asman, M.; Trapp, G.; Gołąbek, K.; Zalewska-Ziob, M.; Nowak-Chmura, M.; Siuda, K.; Wiczkowski, A.; et al. Prevalence of Borrelia Burgdorferi Sensu Lato in Ixodes Ricinus Ticks Collected from Southern Poland. Acta Parasitol. 2015, 60, 666–674. [Google Scholar] [CrossRef] [PubMed]
  47. Wodecka, B.; Leońska, A.; Skotarczak, B. A Comparative Analysis of Molecular Markers for the Detection and Identification of Borrelia Spirochaetes in Ixodes Ricinus. J. Med. Microbiol. 2010, 59, 309–314. [Google Scholar] [CrossRef]
  48. Wagemakers, A.; Jahfari, S.; de Wever, B.; Spanjaard, L.; Starink, M.V.; de Vries, H.J.C.; Sprong, H.; Hovius, J.W. Borrelia Miyamotoi in Vectors and Hosts in The Netherlands. Ticks Tick. Borne Dis. 2017, 8, 370–374. [Google Scholar] [CrossRef] [PubMed]
  49. Wodecka, B. FlaB Gene as a Molecular Marker for Distinct Identification of Borrelia Species in Environmental Samples by the PCR-Restriction Fragment Length Polymorphism Method. Appl. Environ. Microbiol. 2011, 77, 7088–7092. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  51. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  52. Becker, N.S.; Rollins, R.E.; Nosenko, K.; Paulus, A.; Martin, S.; Krebs, S.; Takano, A.; Sato, K.; Kovalev, S.Y.; Kawabata, H.; et al. High Conservation Combined with High Plasticity: Genomics and Evolution of Borrelia Bavariensis. BMC Genom. 2020, 21, 702. [Google Scholar] [CrossRef]
  53. Kubiak, K.; Sielawa, H.; Dziekońska-Rynko, J.; Kubiak, D.; Rydzewska, M.; Dzika, E. Dermacentor Reticulatus Ticks (Acari: Ixodidae) Distribution in North-Eastern Poland: An Endemic Area of Tick-Borne Diseases. Exp. Appl. Acarol. 2018, 75, 289–298. [Google Scholar] [CrossRef] [Green Version]
  54. Pawełczyk, A.; Bednarska, M.; Hamera, A.; Religa, E.; Poryszewska, M.; Mierzejewska, E.J.; Welc-Falęciak, R. Long-Term Study of Borrelia and Babesia Prevalence and Co-Infection in Ixodes Ricinus and Dermacentor Recticulatus Ticks Removed from Humans in Poland, 2016–2019. Parasites Vectors 2021, 14, 348. [Google Scholar] [CrossRef]
  55. Springer, A.; Raulf, M.K.; Fingerle, V.; Strube, C. Borrelia Prevalence and Species Distribution in Ticks Removed from Humans in Germany, 2013–2017. Ticks Tick. Borne Dis. 2020, 11, 101363. [Google Scholar] [CrossRef] [PubMed]
  56. Lernout, T.; De Regge, N.; Tersago, K.; Fonville, M.; Suin, V.; Sprong, H. Prevalence of Pathogens in Ticks Collected from Humans through Citizen Science in Belgium. Parasites Vectors 2019, 12, 550. [Google Scholar] [CrossRef] [PubMed]
  57. Kalmár, Z.; Dumitrache, M.; D’Amico, G.; Matei, I.A.; Ionică, A.M.; Gherman, C.M.; Lupșe, M.; Mihalca, A.D. Multiple Tick-borne Pathogens in Ixodes Ricinus Ticks Collected from Humans in Romania. Pathogens 2020, 9, 390. [Google Scholar] [CrossRef] [PubMed]
  58. Kubiak, K.; Dziekońska-Rynko, J. Seasonal Activity of the Common European Tick, Ixodes Ricinus (Linnaeus, 1758), in the Forested Areas of the City of Olsztyn and Its Surroundings. Wiadomości. Parazytol. 2006, 52, 59–64. [Google Scholar]
  59. Hamšíková, Z.; Coipan, C.; Mahríková, L.; Minichová, L.; Sprong, H.; Kazimírová, M. Borrelia Miyamotoi and Co-Infection with Borrelia Afzelii in Ixodes Ricinus Ticks and Rodents from Slovakia. Microb. Ecol. 2017, 73, 1000–1008. [Google Scholar] [CrossRef]
  60. Dobson, A.D.M.; Taylor, J.L.; Randolph, S.E. Tick (Ixodes Ricinus) Abundance and Seasonality at Recreational Sites in the UK: Hazards in Relation to Fine-Scale Habitat Types Revealed by Complementary Sampling Methods. Ticks Tick. Borne. Dis. 2011, 2, 67–74. [Google Scholar] [CrossRef]
  61. Estrada-Peña, A. Understanding the Relationships between Landscape Connectivity and Abundance of Ixodes Ricinus Ticks. Exp. App. Acarol. 2002, 28, 239–248. [Google Scholar] [CrossRef]
  62. Zarząd Województwa Warmińsko-Mazurskie. Program Ochrony Środowiska Województwa Warmińsko-Mazurskiego Do Roku 2020. Available online: https://bip.warmia.mazury.pl (accessed on 15 April 2021).
  63. Siński, E.; Pawełczyk, A.; Bajer, A.; Behnke, J.M. Abundance of Wild Rodents, Ticks and Environmental Risk of Lyme Borreliosis: A Longitudinal Study in an Area of Mazury Lakes District of Poland. Ann. Agric. Environ. Med. 2006, 13, 295–300. [Google Scholar]
  64. Michalski, M.M.; Kubiak, K.; Szczotko, M.; Dmitryjuk, M. Tick-Borne Pathogens in Ticks Collected from Wild Ungulates in North-Eastern Poland. Pathogens 2021, 10, 587. [Google Scholar] [CrossRef]
  65. Rizzoli, A.; Silaghi, C.; Obiegala, A.; Rudolf, I.; Hubálek, Z.; Földvári, G.; Plantard, O.; Vayssier-Taussat, M.; Bonnet, S.; Špitalská, E.; et al. Ixodes Ricinus and Its Transmitted Pathogens in Urban and Peri-Urban Areas in Europe: New Hazards and Relevance for Public Health. Front. Public Health 2014, 2, 251. [Google Scholar] [CrossRef]
  66. Kilpatrick, A.M.; Dobson, A.D.M.; Levi, T.; Salkeld, D.J.; Swei, A.; Ginsberg, H.S.; Kjemtrup, A.; Padgett, K.A.; Jensen, P.M.; Fish, D.; et al. Lyme Disease Ecology in a Changing World: Consensus, Uncertainty and Critical Gaps for Improving Control. Philos. Trans. R. Soc. B Biol. Sci. 2017, 372, 20160117. [Google Scholar] [CrossRef] [PubMed]
  67. Randolph, S.E. EDEN-TBD sub-project team Human Activities Predominate in Determining Changing Incidence of Tick-Borne Encephalitis in Europe. Euro Surveill. 2010, 15, 24–31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Karbowiak, G.; Biernat, B.; Stańczak, J.; Werszko, J.; Szewczyk, T.; Sytykiewicz, H. The Role of Particular Ticks Developmental Stages in the Circulation of Tick-Borne Pathogens in Central Europe. 5. Borreliaceae. Ann. Parasitol. 2018, 64, 151–171. [Google Scholar] [CrossRef] [PubMed]
  69. Asman, M.; Witecka, J.; Korbecki, J.; Solarz, K. The Potential Risk of Exposure to Borrelia Garinii, Anaplasma Phagocytophilum and Babesia Microti in the Wolinski National Park (North-Western Poland). Sci. Rep. 2021, 11, 4860. [Google Scholar] [CrossRef]
  70. Stańczak, J.; Kubica-Biernat, B.; Racewicz, M.; Kruminis-Łozowska, W.; Kur, J. Detection of Three Genospecies of Borrelia Burgdorferi Sensu Lato in Ixodes Ricinus Ticks Collected in Different Regions of Poland. Int. J. Med. Microbiol. 2000, 290, 559–566. [Google Scholar] [CrossRef]
  71. Stańczak, J.; Racewicz, M.; Kubica-Biernat, B.; Kruminis-Łozowska, W.; Dabrowski, J.; Adamczyk, A.; Markowska, M. Prevalence of Borrelia Burgdorferi Sensu Lato in Ixodes Ricinus Ticks (Acari, Ixodidae) in Different Polish Woodlands. Ann. Agric. Environ. Med. 1999, 6, 127–132. [Google Scholar]
  72. Pawelczyk, A.; Sinski, E. Co-Infection of Borrelia Garinii and B. Afzelii in a Population of Wild Rodents from Woodland. Wiad Parazytol. 2001, 47, 741–746. [Google Scholar]
  73. Rauter, C.; Hartung, T. Prevalence of Borrelia Burgdorferi Sensu Lato Genospecies in Ixodes Ricinus Ticks in Europe: A Metaanalysis. Appl. Environ. Microbiol. 2005, 71, 7203–7216. [Google Scholar] [CrossRef] [Green Version]
  74. Tappe, J.; Jordan, D.; Janecek, E.; Fingerle, V.; Strube, C. Revisited: Borrelia Burgdorferi Sensu Lato Infections in Hard Ticks (Ixodes Ricinus) in the City of Hanover (Germany). Parasit. Vectors 2014, 7, 441. [Google Scholar] [CrossRef] [Green Version]
  75. Zintl, A.; Zaid, T.; McKiernan, F.; Naranjo-Lucena, A.; Gray, J.; Brosnan, S.; Browne, J.; O’Connor, J.; Mee, J.; Good, B.; et al. Update on the Presence of Ixodes Ricinus at the Western Limit of Its Range and the Prevalence of Borrelia Burgdorferi Sensu Lato. Ticks Tick. Borne. Dis. 2020, 11, 101518. [Google Scholar] [CrossRef]
  76. Michalski, M.M.; Kubiak, K.; Szczotko, M.; Chajęcka, M.; Dmitryjuk, M. Molecular Detection of Borrelia Burgdorferi Sensu Lato and Anaplasma Phagocytophilum in Ticks Collected from Dogs in Urban Areas of North-Eastern Poland. Pathogens 2020, 9, 455. [Google Scholar] [CrossRef] [PubMed]
  77. Ehrmann, S.; Ruyts, S.C.; Scherer-Lorenzen, M.; Bauhus, J.; Brunet, J.; Cousins, S.A.O.; Deconchat, M.; Decocq, G.; De Frenne, P.; De Smedt, P.; et al. Habitat Properties Are Key Drivers of Borrelia Burgdorferi (s.l.) Prevalence in Ixodes Ricinus Populations of Deciduous Forest Fragments. Parasites Vectors 2018, 11, 23. [Google Scholar] [CrossRef] [PubMed]
  78. Rollins, R.E.; Yeyin, Z.; Wyczanska, M.; Alig, N.; Hepner, S.; Fingerle, V.; Margos, G.; Becker, N.S. Spatial Variability in Prevalence and Genospecies Distributions of Borrelia Burgdorferi Sensu Lato from Ixodid Ticks Collected in Southern Germany. Ticks Tick. Borne Dis. 2021, 12, 101589. [Google Scholar] [CrossRef] [PubMed]
  79. Margos, G.; Vollmer, S.A.; Cornet, M.; Garnier, M.; Fingerle, V.; Wilske, B.; Bormane, A.; Vitorino, L.; Collares-Pereira, M.; Drancourt, M.; et al. A New Borrelia Species Defined by Multilocus Sequence Analysis of Housekeeping Genes. Appl. Environ. Microbiol. 2009, 75, 5410–5416. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  80. Tokarska-Rodak, M.; Plewik, D.; Kozioł-Montewka, M.; Szepeluk, A.; Paszkiewicz, J. Ryzyko Zakażeń Zawodowych Borrelia Burgdorferi u Pracowników Leśnictwa i Rolników. Med. Pr. 2014, 65, 109–117. [Google Scholar] [CrossRef]
  81. Szekeres, S.; Lügner, J.; Fingerle, V.; Margos, G.; Földvári, G. Prevalence of Borrelia Miyamotoi and Borrelia Burgdorferi Sensu Lato in Questing Ticks from a Recreational Coniferous Forest of East Saxony, Germany. Ticks Tick. Borne. Dis. 2017, 8, 922–927. [Google Scholar] [CrossRef]
  82. Ćakić, S.; Veinović, G.; Cerar, T.; Mihaljica, D.; Sukara, R.; Ružić-Sabljić, E.; Tomanović, S. Diversity of Lyme Borreliosis Spirochetes Isolated from Ticks in Serbia. Med. Vet. Entomol. 2019, 33, 512–520. [Google Scholar] [CrossRef]
  83. Gern, L.; Douet, V.; López, Z.; Rais, O.; Cadenas, F.M. Diversity of Borrelia Genospecies in Ixodes Ricinus Ticks in a Lyme Borreliosis Endemic Area in Switzerland Identified by Using New Probes for Reverse Line Blotting. Ticks Tick. Borne. Dis. 2010, 1, 23–29. [Google Scholar] [CrossRef]
  84. Glatz, M.; Muellegger, R.R.; Hizo-Teufel, C.; Fingerle, V. Low Prevalence of Borrelia Bavariensis in Ixodes Ricinus Ticks in Southeastern Austria. Ticks Tick. Borne Dis. 2014, 5, 649–650. [Google Scholar] [CrossRef]
  85. Kiewra, D.; Stańczak, J.; Richter, M. Ixodes Ricinus Ticks (Acari, Ixodidae) as a Vector of Borrelia Burgdorferi Sensu Lato and Borrelia Miyamotoi in Lower Silesia, Poland—Preliminary Study. Ticks Tick. Borne Dis. 2014, 5, 892–897. [Google Scholar] [CrossRef]
  86. Fiecek, B.; Chmielewski, T. Borrelia Miyamotoi—New Etiologic Agent Of Neuroborreliosis? Przegl. Epidemiol. 2017, 71, 531–538. [Google Scholar] [PubMed]
  87. O’bier, N.S.; Hatke, A.L.; Camire, A.C.; Marconi, R.T. Human and Veterinary Vaccines for Lyme Disease. Curr. Issues Mol. Biol. 2021, 42, 191–222. [Google Scholar] [CrossRef] [PubMed]
  88. Grochowska, A.; Milewski, R.; Pancewicz, S.; Dunaj, J.; Czupryna, P.; Milewska, A.J.; Róg-Makal, M.; Grygorczuk, S.; Moniuszko-Malinowska, A. Comparison of Tick-Borne Pathogen Prevalence in Ixodes Ricinus Ticks Collected in Urban Areas of Europe. Sci. Rep. 2020, 10, 6975. [Google Scholar] [CrossRef] [PubMed]
  89. Sykes, R.A.; Makiello, P. An Estimate of Lyme Borreliosis Incidence InWestern Europe. J. Public Health (Oxf.) 2017, 39, 74–81. [Google Scholar] [CrossRef] [Green Version]
  90. Remesar, S.; Díaz, P.; Venzal, J.M.; Prieto, A.; Estrada-Peña, A.; López, C.M.; Panadero, R.; Fernández, G.; Díez-Baños, P.; Morrondo, P. Longitudinal Study of Infection with Borrelia Spp. in Questing Ticks from North-Western Spain. Vector-Borne Zoonotic Dis. 2019, 19, 785–792. [Google Scholar] [CrossRef] [Green Version]
  91. Mathews-Martin, L.; Namèche, M.; Vourc’h, G.; Gasser, S.; Lebert, I.; Poux, V.; Barry, S.; Bord, S.; Jachacz, J.; Chalvet-Monfray, K.; et al. Questing Tick Abundance in Urban and Peri-Urban Parks in the French City of Lyon. Parasites Vectors 2020, 13, 576. [Google Scholar] [CrossRef]
  92. Hansford, K.M.; Fonville, M.; Gillingham, E.L.; Coipan, E.C.; Pietzsch, M.E.; Krawczyk, A.I.; Vaux, A.G.C.; Cull, B.; Sprong, H.; Medlock, J.M. Ticks and Borrelia in Urban and Peri-Urban Green Space Habitats in a City in Southern England. Ticks Tick. Borne Dis. 2017, 8, 353–361. [Google Scholar] [CrossRef]
Ijerph 19 07378 g001 550
Figure 1. Tick collection sites located in western, central, and eastern subregions of northeastern Poland. Bars show the mean incidence of Lyme borreliosis in subregions, the Warmia and Mazury region, and in Poland for 2010–2015 (data obtained from the annual reports of selected infectious diseases (document MZ-57) registered in the Warmia and Mazury province by the Department of Epidemiology of the Voivodeship Sanitary-Epidemiological Station in Olsztyn and listed in the annual reports of the NIPH-NIH, Poland). The map was designed in CorelDRAWX5 based on Google Maps (https://www.google.pl/maps, accessed on 20 May 2020).
Figure 1. Tick collection sites located in western, central, and eastern subregions of northeastern Poland. Bars show the mean incidence of Lyme borreliosis in subregions, the Warmia and Mazury region, and in Poland for 2010–2015 (data obtained from the annual reports of selected infectious diseases (document MZ-57) registered in the Warmia and Mazury province by the Department of Epidemiology of the Voivodeship Sanitary-Epidemiological Station in Olsztyn and listed in the annual reports of the NIPH-NIH, Poland). The map was designed in CorelDRAWX5 based on Google Maps (https://www.google.pl/maps, accessed on 20 May 2020).
Ijerph 19 07378 g001
Ijerph 19 07378 g002 550
Figure 2. Comparison of Ixodes ricinus mean density (ticks per 100 m2) according to habitats in northeastern Poland (ANOVA, GLM, p < 0.05).
Figure 2. Comparison of Ixodes ricinus mean density (ticks per 100 m2) according to habitats in northeastern Poland (ANOVA, GLM, p < 0.05).
Ijerph 19 07378 g002
Ijerph 19 07378 g003 550
Figure 3. Species distribution (%) among Borrelia-positive Ixodes ricinus ticks, northeastern Poland (abbreviation: B.a—B. afzelii, B.g—B. garinii, B.ss—B. burgdorferi s.s., B.v—B. valaisiana, B.l—B. lusitaniae, B.bav—B. bavariensis, B.m—B. miyamotoi).
Figure 3. Species distribution (%) among Borrelia-positive Ixodes ricinus ticks, northeastern Poland (abbreviation: B.a—B. afzelii, B.g—B. garinii, B.ss—B. burgdorferi s.s., B.v—B. valaisiana, B.l—B. lusitaniae, B.bav—B. bavariensis, B.m—B. miyamotoi).
Ijerph 19 07378 g003
Ijerph 19 07378 g004 550
Figure 4. HpyF3I restriction patterns of the amplified fragment of flaB gene (604 bp) of Borrelia species. MM—DNA marker. Samples 1—B. garinii/B. valaisiana coinfection, 2, 3, 6, 7, 9—B. afzelii, 4, 8, 10, 12—B. garinii, 5—B. lusitaniae, 11—B. afzelii/B. garinii/B. lusitaniae coinfection.
Figure 4. HpyF3I restriction patterns of the amplified fragment of flaB gene (604 bp) of Borrelia species. MM—DNA marker. Samples 1—B. garinii/B. valaisiana coinfection, 2, 3, 6, 7, 9—B. afzelii, 4, 8, 10, 12—B. garinii, 5—B. lusitaniae, 11—B. afzelii/B. garinii/B. lusitaniae coinfection.
Ijerph 19 07378 g004
Ijerph 19 07378 g005 550
Figure 5. The molecular relationship between Borrelia miyamotoi and Borrelia bavariensis is based on the sequences of the flaB gene identified in the study. The phylogram was constructed using the Maximum Likelihood method and Kimura 2-parameter method as a distance method. The percentage of replicate trees in which the associated taxa are clustered together in the bootstrap test (1000 replicates) is shown next to the branches. The tree is drawn to scale, with branch lengths measured in the number of base substitutions per site. The analyses and phylogram construction were conducted in MEGA X software (https://www.megasoftware.net (accessed on 30 April 2021)). The sequences obtained in the study are labelled with black symbols. Abbreviation: B.m—B. miyamotoi, B.g—B. garinii, B.bav—B. bavariensis. * according to Becker et al. (2020) [52].
Figure 5. The molecular relationship between Borrelia miyamotoi and Borrelia bavariensis is based on the sequences of the flaB gene identified in the study. The phylogram was constructed using the Maximum Likelihood method and Kimura 2-parameter method as a distance method. The percentage of replicate trees in which the associated taxa are clustered together in the bootstrap test (1000 replicates) is shown next to the branches. The tree is drawn to scale, with branch lengths measured in the number of base substitutions per site. The analyses and phylogram construction were conducted in MEGA X software (https://www.megasoftware.net (accessed on 30 April 2021)). The sequences obtained in the study are labelled with black symbols. Abbreviation: B.m—B. miyamotoi, B.g—B. garinii, B.bav—B. bavariensis. * according to Becker et al. (2020) [52].
Ijerph 19 07378 g005
Table
Table 1. Primers and conditions of annealing step of PCRs used for detection of Borrelia spp.
Table 1. Primers and conditions of annealing step of PCRs used for detection of Borrelia spp.
LocusPrimer NamePrimer Sequence 5′-3′Product Size [bp]ReferenceAnnealing Step in PCR
Borrelia spp.
16S rRNALDFATGCACACTTGGTGTTAACTA357[43]53 °C/30 s
LDRGACTTATCACCGGCAGTCTTA
ospASL1AATAGGTCTAATAATAGCCTTAATAGC307[44]65 °C/90 s
SL2CTAGTGTTTTGCCATCTTCTTTGAAAA
flaBBFL1GCTCAATATAACCAAATGCACATG422[45,46]58 °C/45 s
BFL2CAAGTCTATTTTGGAAAGCACCTAA
132fTGGTATGGGAGTTCTGG774[47]52 °C/30 s
905rTCTGTCATTGTAGCATCTTT
220fCAGACAACAGAGGGAAAT60454 °C/20 s
823rTCAAGTCTATTTTGGAAAGCACC
B. miyamotoi
flaBBmFAACTTGCTGTTCAGTCTGGT424[40]54 °C/20 s
BmRTTAACTCCACCTTGAACTGG
glpQforwardATGGGTTCAAACAAAAAGTCACC700[48]53 °C/30 s
reverseCCAGGGTCCAATTTCATCAGAATATTGTGCAAC
Table
Table 2. Mean Ixodes ricinus density (ticks per 100 m2) according to subregion and year of the study in northeastern Poland.
Table 2. Mean Ixodes ricinus density (ticks per 100 m2) according to subregion and year of the study in northeastern Poland.
YearSubregionMean ± SD
WestCentralEast
Nymphs201610.6 ± 3.25 a7.6 ± 2.37 b8.3 ± 2.91 a,b8.8 ± 3.08 a
20177.7 ± 2.84 a7.6 ± 2.84 a4.9 ± 2.10 b6.8 ± 2.87 b
Mean9.2 ± 3.33 a7.6 ± 2.56 b6.6 ± 3.03 b7.8 ± 3.14
Females20160.5 ± 0.45 a0.6 ± 0.78 a1.1 ± 1.31 a0.8 ± 0.94 a
20170.7 ± 0.65 a1.1 ± 0.77 a1.3 ± 0.86 a1.0 ± 0.79 a
Mean0.6 ± 0.56 a0.8 ± 0.79 a,b1.2 ± 1.10 b0.9 ± 0.87
Males20160.6 ± 0.53 a0.7 ± 0.84 a1.0 ± 1.18 a0.8 ± 0.89 a
20170.9 ± 1.07 a1.5 ± 1.21 a1.5 ± 1.12 a1.3 ± 1.14 b
Mean0.8 ± 0.85 a1.1 ± 1.09 a1.3 ± 1.15 a1.0 ± 1.05
Total201611.7 ± 3.25 a8.9 ± 2.49 b10.5 ± 3.39 a,b10.4 ± 3.22 a
20179.4 ± 3.22 a10.2 ± 2.89 a7.7 ± 2.64 a9.1 ± 3.04 a
Mean10.9 ± 4.40 a9.5 ± 2.73 a9.1 ± 3.30 a9.7 ± 3.2
a,b—different letters mean significant differences (post-hoc Bonferroni test, ANOVA, GLM).
Table
Table 3. Prevalence of Borrelia spp. in Ixodes ricinus ticks by life stage, year, subregion, and habitat in northeastern Poland.
Table 3. Prevalence of Borrelia spp. in Ixodes ricinus ticks by life stage, year, subregion, and habitat in northeastern Poland.
No. of Tested TicksBorrelia-Positive
n/% * (95% CI)		p-Value **
StageNymphs3420189/5.5 a (4.8–6.3)<0.001
Females39990/22.6 b (18.4–26.7)
Males46266/14.3 c (11.1–17.5)
Year20162313158/6.8 a (5.8–7.9)<0.001
20171968187/9.5 b (8.2–10.8)
SubregionWest155989/5.7 a (4.6–6.9)<0.001
Central1351118/8.7 b (7.2–10.2)
East1371138/10.1 b (8.5–11.7)
HabitatForest1945172/8.8 a (7.6–10.1)0.085
Ecotone2336173/7.4 a (6.3–8.5)
Total4281345/8.1 (7.2–8.9)
*—for nymphs Minimum Infection Rate (MIR) is given (5 nymphs per isolate); **—chi2 test, p < 0.05; a,b,c—different letters mean significant differences (post -hoc Bonferroni test).
Table
Table 4. Borrelia species distribution in positive Ixodes. ricinus ticks by life stage, year, subregion, and habitat in northeastern Poland.
Table 4. Borrelia species distribution in positive Ixodes. ricinus ticks by life stage, year, subregion, and habitat in northeastern Poland.
Stage (n/%)Year (n/%)Subregion (n/%)Habitat (n/%)
FMN *20162017WestCentralEastForestEcotone
mono-infectionB.a38 a/42.227 a/40.967 a/35.465 a/41.167 a/35.827b/30.360 a/50.845b/32.665 a/37.867 a/38.7
B.g27a.b/30.014b/21.278 a/41.351 a/32.368 a/36.438 a/42.734 a/28.847 a/34.160 a/34.959 a/34.1
B.l14 a/15.613 a/19.710 b/5.317 a/10.820 a/10.78 a,b/9.04 a/3.425b/18.114 a/8.123 a/13.3
B.v0 a/0.01 a/1.57 a/3.73 a/1.95 a/2.72 a/2.24 a/3.42 a/1.42 a/1.26 a/3.5
B.ss4 a/4.45 a/7.67 a/3.78 a/5.18 a/4.33 a/3.47 a/5.96 a/4.313 a/7.63 b/1.7
B.bav0 a/0.01 a/1.50 a/0.00 a/0.01 a/0.50 a/0.01 a/0.80 a/0.00 a/0.01 a/0.6
B.m0 a/0.01 a/1.52 a/1.11 a/0.62 a/1.11 a/1.11 a/0.81 a/0.71 a/0.62 a/1.2
Subtotal83 a/92.262 a/93.9171 a/90.5145 a/91.8171 a/91.479 a/88.8111 a/94.1126 a/91.3155 a/90.1161 a/93.1
co-infectionB.a/B.g1 a/1.10 a/0.03 a/1.61 a/0.63 a/1.60 a/0.01 a/0.83 a/2.22 a/1.22 a/1.2
B.a/B.ss4 a/4.42 a/3.00 b/0.00 a/0.06 b/3.21 a/1.12 a/1.73 a/2.24 a/2.32 a/1.2
B.a/B.m0 a/0.00 a/0.04 a/2.13 a/1.91 a/0.53 a/3.40 a/0.01 a/0.72 a/1.22 a/1.2
B.g/B.ss1 a/1.10 a/0.03 a/1.62 a/1.32 a/1.13 a/3.41 a/0.80 a/0.03 a/1.71 a/0.6
B.g/B.v1 a/1.10 a/0.00 a/0.01 a/0.60 a/0.00 a/0.00 a/0.01 a/0.71 a/0.60 a/0.0
B.g/B.m0 a/0.00 a/0.01 a/0.50 a/0.01 a/0.50 a/0.00 a/0.01 a/0.71 a/0.60 a/0.0
B.a/B.g/B.l0 a/0.00a/0.05 a/2.63 a/1.92 a/1.11 a/1.12 a/1.72 a/1.43 a/1.72 a/1.2
B.a/B.g/B.ss0 a/0.01 a/1.50 a/0.00 a/0.01 a/0.51 a/1.10 a/0.00 a/0.00 a/0.01 a/0.6
B.a/B.ss/B.l0 a/0.01 a/1.52 a/1.13 a/1.90 a/0.01 a/1.11 a/0.81 a/0.71 a/0.62 a/1.2
Subtotal7 a/7.84 a/6.118 a/9.513 a/8.216 a/8.610 a/11.27 a/5.912 a/8.717 a/9.912 a/6.9
p-value **0.0020.3550.0250.318
*—for nymphs Minimum Infection Rate (MIR) is given (5 nymphs per isolate); **—chi2 test, p < 0.05 (for Borrelia species distribution); a,b—different letters mean significant differences (post-hoc Bonferroni test); (abbreviation: F—females, M—males, N—nymphs; B.a—B. afzelii, B.g—B. garinii, B.ss—B. burgdorferi s.s., B.v—B. valaisiana, B.l—B. lusitaniae, B.bav—B. bavariensis, B.m—B. miyamotoi).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kubiak, K.; Szymańska, H.; Dmitryjuk, M.; Dzika, E. Abundance of Ixodes ricinus Ticks (Acari: Ixodidae) and the Diversity of Borrelia Species in Northeastern Poland. Int. J. Environ. Res. Public Health 2022, 19, 7378. https://doi.org/10.3390/ijerph19127378

AMA Style

Kubiak K, Szymańska H, Dmitryjuk M, Dzika E. Abundance of Ixodes ricinus Ticks (Acari: Ixodidae) and the Diversity of Borrelia Species in Northeastern Poland. International Journal of Environmental Research and Public Health. 2022; 19(12):7378. https://doi.org/10.3390/ijerph19127378

Chicago/Turabian Style

Kubiak, Katarzyna, Hanna Szymańska, Małgorzata Dmitryjuk, and Ewa Dzika. 2022. "Abundance of Ixodes ricinus Ticks (Acari: Ixodidae) and the Diversity of Borrelia Species in Northeastern Poland" International Journal of Environmental Research and Public Health 19, no. 12: 7378. https://doi.org/10.3390/ijerph19127378

APA Style

Kubiak, K., Szymańska, H., Dmitryjuk, M., & Dzika, E. (2022). Abundance of Ixodes ricinus Ticks (Acari: Ixodidae) and the Diversity of Borrelia Species in Northeastern Poland. International Journal of Environmental Research and Public Health, 19(12), 7378. https://doi.org/10.3390/ijerph19127378

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop