Heat Acclimation in Females Does Not Limit Aerobic Exercise Training Outcomes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. Fitness Assessments
2.3. Temperature Tolerance Trials
2.4. Daily Aerobic Exercise Training
2.5. Muscle Biopsies
2.6. Acute and Chronic mRNA Quantification
2.7. Statistical Analyses
3. Results
3.1. Fitness Assessments
3.2. Temperature Tolerance Trials
3.3. Daily Aerobic Exercise Training
3.4. Acute and Chronic Exercise mRNA Responses to 33 °C and 20 °C
3.5. Resting mRNA Responses to Training in 33 °C and 20 °C
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
Reference Genes | Primer 1 | Primer 2 | Probe |
---|---|---|---|
ACTB | AAGTCAGTGTACAGGTAAGCC | GTCCCCCAACTGAGATGTATGT | CTGCCTCCACCCACTCCCA |
B2M | ACCTCCATGATGCTGCTTAC | GGACTGGTCTTTCTATCTCTTGT | CCTGCCGTGTGAACCATGTGACT |
CYC | TCTTTCACTTTGCCAAACACC | CATCCTAAAGCATACGGGTCC | TGCTTGCCATCCAACCACTCAGTC |
GAPDH | TGTAGTTGAGGTCAATGAAGGG | ACATCGCTCAGACACCATG | AAGGTCGGAGTCAACGGATTTGGTC |
RSP18 | GTCAATGTCTGCTTTCCTCAAC | GTTCCAGCATATTTTGCGAGT | TCTTCGGCCCACACCCTTAATGG |
Mitochondrial Biogenesis | |||
PGC-1α | GCAATCCGTCTTCATCCACA | CCAATCAGTACAACAATGAGCCT | AGCAGTCCTCACAGAGACACTAGACAG |
NRF1 | GTCATCTCACCTCCCTGTAAC | GATGCTTCAGAATTGCCAACC | ATGGAGAGGTGGAACAAAATTGGGC |
GABPA (NRF2) | TGTAGTCTTGGTTCTAGCAGTTTC | TGGAACAGAGAAAGCAGAGTG | TGGTTCATTGATGTCTATGGCCTGGC |
VEGF | GCGCTGATAGACATCCATGA | CCATGAACTTTCTGCTGTCTTG | TGCTCTACCTCCACCATGCCAAG |
TFAM | GCCAAGACAGATGAAAACCAC | TGGGAAGGTCTGGAGCA | CGCTCCCCCTTCAGTTTTGTGTATTT |
ESRRa | TCTCCGCTTGGTGATCTCA | CTATGGTGTGCATCCTGTG | TGGTCCTCTTGAAGAAGGCTTTGCA |
Mitophagy | |||
PINK1 | GTTGCTTGGGACCTCTCTTG | TGAACACAATGAGCCAGGAG | TGTAAGTGACTGCTCCATACTCCCCA |
PARK2 | GCTTGGTGGTTTTCTTGATGG | TTGAAGCCTCAGGAACAACT | CCTGCTCGGCGGCTCTTTCA |
BNIP3 | CCACTAACGAACCAAGTCAGAC | CATCTCTGCTGCTCTCTCAT | AAAGGTGCTGGTGGAGGTTGTCA |
BNIP3-L | CAAACATGATCTGCCCATCTTC | TCCTCATCCTCCATCCACAA | TCTCACTGTGACAGCCCTTCGC |
Metabolic Enzymes | |||
CS | GTAGCAGTTTCTGGCATTCAG | ACTGTGGACATGATGTATGGTG | TGAGAGGCATGAAGGGATTGGTCTATGA |
COX4I1 (COX4) | AGTCTTCGCTCTTCACAACA | GCAGTGGCGGCAGAATG | AGGTGGAAATTGCTCGCTTGCC |
HADH (BHAD) | CAAGTTTCATGACAGGCACTG | AAGGCTGGACAAGTTTGCT | CCACCAGACAAGACCGATTCGCT |
References
- Garber, C.E.; Blissmer, B.; Deschenes, M.R.; Franklin, B.A.; Lamonte, M.J.; Lee, I.M.; Nieman, D.C.; Swain, D.P.; American College of Sports Medicine American College of Sports Medicine position stand. Quantity and quality of exercise for developing and maintaining cardiorespiratory, musculoskeletal, and neuromotor fitness in apparently healthy adults: Guidance for prescribing exercise. Med. Sci. Sports Exerc. 2011, 43, 1334–1359. [Google Scholar] [CrossRef] [PubMed]
- Waldron, M.; Fowler, R.; Heffernan, S.; Tallent, J.; Kilduff, L.; Jeffries, O. Effects of Heat Acclimation and Acclimatisation on Maximal Aerobic Capacity Compared to Exercise Alone in Both Thermoneutral and Hot Environments: A Meta-Analysis and Meta-Regression. Sports Med. 2021, 51, 1509–1525. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, B.; Hales, J.R.; Strange, S.; Christensen, N.J.; Warberg, J.; Saltin, B. Human circulatory and thermoregulatory adaptations with heat acclimation and exercise in a hot, dry environment. J. Physiol. 1993, 460, 467–485. [Google Scholar] [CrossRef] [PubMed]
- Galloway, S.D.; Maughan, R.J. Effects of ambient temperature on the capacity to perform prolonged cycle exercise in man. Med. Sci. Sports Exerc. 1997, 29, 1240–1249. [Google Scholar] [CrossRef]
- Bass, D.E.; Buskirk, E.R.; Iampietro, P.F.; Mager, M. Comparison of blood volume during physical conditioning, heat acclimatization and sedentary living. J. Appl. Physiol. 1958, 12, 186–188. [Google Scholar] [CrossRef]
- Wyndham, C.H.; Benade, A.J.; Williams, C.G.; Strydom, N.B.; Goldin, A.; Heyns, A.J. Changes in central circulation and body fluid spaces during acclimatization to heat. J. Appl. Physiol. 1968, 25, 586–593. [Google Scholar] [CrossRef]
- Senay, L.C.; Fortney, S. Untrained females: Effects of submaximal exercise and heat on body fluids. J. Appl. Physiol. 1975, 39, 643–647. [Google Scholar] [CrossRef]
- Senay, L.C.; Mitchell, D.; Wyndham, C.H. Acclimatization in a hot, humid environment: Body fluid adjustments. J. Appl. Physiol. 1976, 40, 786–796. [Google Scholar] [CrossRef]
- Lorenzo, S.; Halliwill, J.R.; Sawka, M.N.; Minson, C.T. Heat acclimation improves exercise performance. J. Appl. Physiol. 2010, 109, 1140–1147. [Google Scholar] [CrossRef] [Green Version]
- Nielsen, B.; Strange, S.; Christensen, N.J.; Warberg, J.; Saltin, B. Acute and adaptive responses in humans to exercise in a warm, humid environment. Pflug. Arch. 1997, 434, 49–56. [Google Scholar] [CrossRef]
- Slivka, D.; Shute, R.; Hailes, W.; Marshall, K.; Opichka, M.; Schnitzler, H.; Ruby, B. Exercise in the heat blunts improvements in aerobic power. Eur. J. Appl. Physiol. 2021. [Google Scholar] [CrossRef] [PubMed]
- Sawka, M.N.; Young, A.J.; Cadarette, B.S.; Levine, L.; Pandolf, K.B. Influence of heat stress and acclimation on maximal aerobic power. Eur. J. Appl. Physiol. Occup. Physiol. 1985, 53, 294–298. [Google Scholar] [CrossRef] [PubMed]
- Karlsen, A.; Racinais, S.; Jensen, M.V.; Nørgaard, S.J.; Bonne, T.; Nybo, L. Heat acclimatization does not improve VO2max or cycling performance in a cool climate in trained cyclists. Scand. J. Med. Sci. Sports 2015, 25, 269–276. [Google Scholar] [CrossRef] [PubMed]
- Alkemade, P.; Gerrett, N.; Eijsvogels, T.M.H.; Daanen, H.A.M. Individual characteristics associated with the magnitude of heat acclimation adaptations. Eur. J. Appl. Physiol. 2021, 121, 1593–1606. [Google Scholar] [CrossRef] [PubMed]
- Shapiro, Y.; Pandolf, K.B.; Avellini, B.A.; Pimental, N.A.; Goldman, R.F. Physiological responses of men and women to humid and dry heat. J. Appl. Physiol. 1980, 49, 1–8. [Google Scholar] [CrossRef]
- Baker, F.C.; Siboza, F.; Fuller, A. Temperature regulation in women: Effects of the menstrual cycle. Temperature 2020, 7, 226–262. [Google Scholar] [CrossRef]
- Gagnon, D.; Dorman, L.E.; Jay, O.; Hardcastle, S.; Kenny, G.P. Core temperature differences between males and females during intermittent exercise: Physical considerations. Eur. J. Appl. Physiol. 2009, 105, 453–461. [Google Scholar] [CrossRef]
- Giersch, G.E.W.; Morrissey, M.C.; Katch, R.K.; Colburn, A.T.; Sims, S.T.; Stachenfeld, N.S.; Casa, D.J. Menstrual cycle and thermoregulation during exercise in the heat: A systematic review and meta-analysis. J. Sci. Med. Sport 2020, 23, 1134–1140. [Google Scholar] [CrossRef]
- Gagnon, D.; Kenny, G.P. Sex modulates whole-body sudomotor thermosensitivity during exercise. J. Physiol. 2011, 589, 6205–6217. [Google Scholar] [CrossRef]
- Avellini, B.A.; Kamon, E.; Krajewski, J.T. Physiological responses of physically fit men and women to acclimation to humid heat. J. Appl. Physiol. 1980, 49, 254–261. [Google Scholar] [CrossRef] [Green Version]
- Mee, J.A.; Gibson, O.R.; Doust, J.; Maxwell, N.S. A comparison of males and females’ temporal patterning to short- and long-term heat acclimation. Scand. J. Med. Sci. Sports 2015, 25 (Suppl. S1), 250–258. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heesch, M.W.; Shute, R.J.; Kreiling, J.L.; Slivka, D.R. Transcriptional control, but not subcellular location, of PGC-1α is altered following exercise in a hot environment. J. Appl. Physiol. 2016, 121, 741–749. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zak, R.B.; Shute, R.J.; Heesch, M.W.; La Salle, D.T.; Bubak, M.P.; Dinan, N.E.; Laursen, T.L.; Slivka, D.R. Impact of hot and cold exposure on human skeletal muscle gene expression. Appl. Physiol. Nutr. Metab. 2017, 42, 319–325. [Google Scholar] [CrossRef] [PubMed]
- Slivka, D.R.; Dumke, C.L.; Tucker, T.J.; Cuddy, J.S.; Ruby, B. Human mRNA response to exercise and temperature. Int. J. Sports Med. 2012, 33, 94–100. [Google Scholar] [CrossRef]
- Wu, Z.; Puigserver, P.; Andersson, U.; Zhang, C.; Adelmant, G.; Mootha, V.; Troy, A.; Cinti, S.; Lowell, B.; Scarpulla, R.C.; et al. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 1999, 98, 115–124. [Google Scholar] [CrossRef] [Green Version]
- Borg, G.A.V. Psychophysical bases of perceived exertion. Med. Sci. Sports Exerc. 1982, 14, 377–381. [Google Scholar] [CrossRef]
- Shute, R.; Marshall, K.; Opichka, M.; Schnitzler, H.; Ruby, B.; Slivka, D. Effects of 7 °C environmental temperature acclimation during a 3-week training period. J. Appl. Physiol. 2020, 128, 768–777. [Google Scholar] [CrossRef]
- Siri, W.E. Body composition from fluid spaces and density: Analysis of methods. 1961. Nutrition 1993, 9, 480–491, discussion 480, 492. [Google Scholar]
- Bergström, J. Muscle electrolytes in man determined by neutron activation analysis on needle biopsy specimens. Scand. J. Clin. Lab. Investig. 1962, 14 (Suppl. S68), 7–110. Available online: https://www.osti.gov/biblio/4636890 (accessed on 5 February 2022).
- Leick, L.; Plomgaard, P.; Pilegaard, H.; Leick, L.; Wojtaszewski, J.; AlAbaiji, F.; Grønløkke, L. Endurance exercise induces mRNA expression of oxidative enzymes in human skeletal muscle late in recovery. Scand. J. Med. Sci. Sports 2010, 20, 593–599. [Google Scholar] [CrossRef]
- Livak, K.J.; Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real Time Quantitative PCR and the 2-DCT. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Andersen, C.; Jensen, J.; Andersen, C.; Ørntoft, T. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Perry, C.G.; Lally, J.; Holloway, G.P.; Heigenhauser, G.J.; Bonen, A.; Spriet, L.L. Repeated transient mRNA bursts precede increases in transcriptional and mitochondrial proteins during training in human skeletal muscle. J. Physiol. 2010, 588, 4795–4810. [Google Scholar] [CrossRef] [PubMed]
- Gavin, T.P.; Robinson, C.B.; Yeager, R.C.; England, J.A.; Nifong, L.W.; Hickner, R.C. Angiogenic growth factor response to acute systemic exercise in human skeletal muscle. J. Appl. Physiol. 2004, 96, 19–24. [Google Scholar] [CrossRef] [Green Version]
- Baldelli, S.; Aquilano, K.; Ciriolo, M.R. Punctum on two different transcription factors regulated by PGC-1α: Nuclear factor erythroid-derived 2-like 2 and nuclear respiratory factor 2. Biochim. Biophys. Acta 2013, 1830, 4137–4146. [Google Scholar] [CrossRef]
- Lei, T.H.; Stannard, S.R.; Perry, B.G.; Schlader, Z.J.; Cotter, J.D.; Mündel, T. Influence of menstrual phase and arid vs. humid heat stress on autonomic and behavioural thermoregulation during exercise in trained but unacclimated women. J. Physiol. 2017, 595, 2823–2837. [Google Scholar] [CrossRef] [Green Version]
Day | −3 | 1 * | 2–21 | 22 * | 25 |
---|---|---|---|---|---|
Trial | Fitness Assessment | Temperature Tolerance Trial | RPE-based Cycle Training | Temperature Tolerance Trial | Fitness Assessment |
Day –3 (Pre-Trained) | Day 25 (Post-Trained) | |||||
---|---|---|---|---|---|---|
20 °C Group (n = 12) | 33 °C Group (n = 10) | Combined (n = 22) | 20 °C Group (n = 12) | 33 °C Group (n = 10) | Combined (n = 22) | |
Body mass (kg) | 65.4 ± 11.9 | 66.8 ± 6.9 | 66.0 ± 9.8 | 65.5 ± 11.7 | 66.4 ± 7.2 | 65.9 ± 9.7 |
Body fat (%) | 25.5 ± 7.6 | 26.0 ± 8.1 | 25.7 ± 7.6 | 25.4 ± 8.0 | 25.5 ± 8.1 | 25.5 ± 7.9 |
Fat mass (kg) | 17.3 ± 8.3 | 17.8 ± 6.9 | 17.5 ± 7.5 | 17.3 ± 8.6 | 17.4 ± 6.6 | 17.4 ± 7.6 |
Fat free mass (kg) | 48.0 ± 5.2 | 48.9 ± 3.3 | 48.5 ± 4.3 | 48.1 ± 4.5 | 49.0 ± 3.8 | 48.5 ± 4.1 |
VO2peak (L·min−1) | 2.56 ± 0.35 | 2.57 ± 0.34 | 2.57 ± 0.34 | 2.74 ± 0.34 | 2.62 ± 0.28 | 2.69 ± 0.31 * |
VO2peak (mL·kg−1·min−1) | 40.1 ± 7.0 | 38.8 ± 6.2 | 39.5 ± 6.5 | 42.8 ± 7.0 | 39.8 ± 4.9 | 41.5 ± 6.2 * |
Peak power (Wpeak) | 191 ± 29 | 190 ± 39 | 191 ± 33 | 207 ± 22 | 205 ± 33 | 206 ± 27 * |
Day 1 (Pre-Trained) | Day 22 (Post-Trained) | |||||
---|---|---|---|---|---|---|
20 °C Group (n = 12) | 33 °C Group (n = 10) | Combined (n = 22) | 20 °C Group (n = 12) | 33 °C Group (n = 10) | Combined (n = 22) | |
Heart rate (beat·min−1) | 148 ± 14 | 156 ± 16 | 152 ± 16 | 138 ± 13 | 142 ± 12 | 140 ± 13 * |
Core temperature ( °C) | 37.86 ± 0.92 | 39.37 ± 0.46 † | 38.55 ± 1.06 | 37.99 ± 0.78 | 39.13 ± 0.47 † | 38.50 ± 0.87 |
Skin temperature ( °C) | 34.44 ± 2.38 | 35.61 ± 0.89 † | 34.97 ± 1.91 | 33.12 ± 1.52 | 35.26 ± 0.88 † | 34.09 ± 1.65 * |
Sweat rate (mL·h−1) | 469 ± 185 | 692 ± 296 † | 571 ± 261 | 423 ± 269 | 662 ± 192 † | 532 ± 262 |
Day 1 (Pre-Trained) | Day 22 (Post-Trained) | |||||
---|---|---|---|---|---|---|
20 °C Group (n = 12) | 33 °C Group (n = 10) | Combined (n = 22) | 20 °C Group (n = 12) | 33 °C Group (n = 10) | Combined (n = 22) | |
Mito. Biogenesis | ||||||
PGC-1α | 4.77 ± 2.44 | 5.92 ± 0.70 | 5.29 ± 3.29 * | 3.07 ± 1.09 | 2.23 ± 0.77 | 2.69 ± 1.03 *† |
NRF1 | 0.86 ± 0.49 | 0.87 ± 0.41 | 0.86 ± 0.45 * | 0.94 ± 0.37 | 0.79 ± 0.36 | 0.87 ± 0.37 * |
GABPA (NRF2) | 0.94 ± 0.51 | 0.99 ± 0.29 | 0.96 ± 0.42 | 0.94 ± 0.29 | 0.73 ± 0.29 | 0.84 ± 0.31 * |
VEGF | 3.02 ± 1.54 | 3.93 ± 2.85 | 3.44 ± 2.22 * | 1.94 ± 0.97 | 1.65 ± 1.23 | 1.81 ± 0.23 *† |
TFAM | 1.10 ± 0.49 | 1.16 ± 0.61 | 1.13 ± 0.53 | 0.96 ± 0.44 | 0.81 ± 0.01 | 0.89 ± 0.33 |
ESRRa | 0.86 ± 0.32 | 1.29 ± 1.08 | 1.06 ± 0.77 | 0.92 ± 0.35 | 0.87 ± 0.35 | 0.89 ± 0.35 |
Mitophagy | ||||||
PINK1 | 0.87 ± 0.72 | 1.57 ± 1.60 | 1.19 ± 1.23 | 1.20 ± 0.71 | 0.86 ± 0.44 | 1.05 ± 0.62 |
PARK2 | 1.22 ± 1.17 | 2.12 ± 2.34 | 1.63 ± 1.81 | 0.85 ± 0.50 | 1.06 ± 0.66 | 0.94 ± 0.57 |
BNIP3 | 1.05 ± 0.60 | 1.37 ± 1.18 | 1.19 ± 0.90 | 1.06 ± 0.73 | 0.85 ± 0.30 | 0.97 ± 0.57 |
BNIP3-L | 0.96 ± 0.59 | 0.94 ± 0.61 | 0.95 ± 0.59 | 1.56 ± 1.02 | 1.30 ± 1.81 | 1.44 ± 1.08 † |
Metabolic | ||||||
CS | 0.92 ± 0.55 | 1.23 ± 1.06 | 1.06 ± 0.81 | 0.90 ± 0.39 | 0.84 ± 0.26 | 0.87 ± 0.33 |
COX4I1(COX4) | 1.01 ± 0.28 | 1.22 ± 0.86 | 1.11 ± 0.61 | 0.93 ± 0.31 | 0.75 ± 0.18 | 0.85 ± 0.27 * |
HADH(BHAD) | 0.82 ± 0.35 | 1.08 ± 0.81 | 0.94 ± 0.60 | 0.95 ± 0.61 | 0.75 ± 0.24 | 0.86 ± 0.48 * |
20 °C Group (n = 12) | 33 °C Group (n = 10) | Combined (n = 22) | |
---|---|---|---|
Mito. Biogenesis | |||
PGC-1α | 1.12 ± 0.19 | 1.71 ± 0.28 | 1.39 ± 0.17 |
NRF1 | 0.80 ± 0.08 * | 1.37 ± 0.21 | 1.06 ± 0.12 |
GABPA (NRF2) | 0.87 ± 0.09 * | 1.67 ± 0.26 | 1.24 ± 0.15 |
VEGF | 1.14 ± 0.11 | 3.95 ± 2.37 | 2.42 ± 1.09 * |
TFAM | 1.10 ± 0.20 | 1.53 ± 0.28 | 1.30 ± 0.17 |
ESRRa | 0.89 ± 0.07 | 1.52 ± 0.41 | 1.18 ± 0.19 |
Mitophagy | |||
PINK1 | 1.45 ± 0.37 | 3.52 ± 2.18 | 2.39 ± 1.01 |
PARK2 | 1.10 ± 0.24 | 2.72 ± 1.86 | 1.84 ± 0.85 |
BNIP3 | 1.08 ± 0.10 | 2.22 ± 0.79 | 1.60 ± 0.38 |
BNIP3-L | 0.81 ± 0.14 | 1.13 ± 0.30 | 0.95 ± 0.16 |
Metabolic | |||
CS | 1.17 ± 0.12 | 1.91 ± 0.60 | 1.51 ± 0.28 * |
COX4I1(COX4) | 1.51 ± 0.16 | 3.02 ± 1.17 | 2.20 ± 0.55 * |
HADH(BHAD) | 1.13 ± 0.12 | 1.73 ± 0.52 | 1.40 ± 0.24 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
McGlynn, M.L.; Collins, C.; Hailes, W.; Ruby, B.; Slivka, D. Heat Acclimation in Females Does Not Limit Aerobic Exercise Training Outcomes. Int. J. Environ. Res. Public Health 2022, 19, 5554. https://doi.org/10.3390/ijerph19095554
McGlynn ML, Collins C, Hailes W, Ruby B, Slivka D. Heat Acclimation in Females Does Not Limit Aerobic Exercise Training Outcomes. International Journal of Environmental Research and Public Health. 2022; 19(9):5554. https://doi.org/10.3390/ijerph19095554
Chicago/Turabian StyleMcGlynn, Mark L., Christopher Collins, Walter Hailes, Brent Ruby, and Dustin Slivka. 2022. "Heat Acclimation in Females Does Not Limit Aerobic Exercise Training Outcomes" International Journal of Environmental Research and Public Health 19, no. 9: 5554. https://doi.org/10.3390/ijerph19095554