Gestational Exercise Antagonises the Impact of Maternal High-Fat High-Sucrose Diet on Liver Mitochondrial Alterations and Quality Control Signalling in Male Offspring
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Model
2.2. Animal Sacrifice and Tissue Sampling
2.3. Glycogen Content Determination
2.4. Western Blotting
2.5. Real-Time PCR analysis
2.6. Quantification of Mitochondrial DNA Copy Number
2.7. Statistical Analysis
3. Results
3.1. Regulators of Glucose/Lipid Metabolism
3.2. Mitochondrial Biogenesis End Points
3.3. Mitochondrial Dynamics
3.4. Estrogen Receptor-α Protein Expression
3.5. Auto(mito)phagy Signalling
3.6. Apoptotic Signalling
3.7. Expression of miR-122, miR-34a, miR-130b, and miR-494 in the Liver
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Langley-Evans, S.C.; McMullen, S. Developmental origins of adult disease. Med. Princ. Pract. 2010, 19, 87–98. [Google Scholar] [CrossRef] [PubMed]
- Bianco, M.E.; Josefson, J.L. Hyperglycemia During Pregnancy and Long-Term Offspring Outcomes. Curr. Diab. Rep. 2019, 19, 143. [Google Scholar] [CrossRef] [PubMed]
- Gonçalves, I.O.; Passos, E.; Diogo, C.V.; Rocha-Rodrigues, S.; Santos-Alves, E.; Oliveira, P.J.; Ascensão, A.; Magalhães, J. Exercise mitigates mitochondrial permeability transition pore and quality control mechanisms alterations in nonalcoholic steatohepatitis. Appl. Physiol. Nutr. Metab. 2016, 41, 298–306. [Google Scholar] [CrossRef] [PubMed]
- Szendroedi, J.; Phielix, E.; Roden, M. The role of mitochondria in insulin resistance and type 2 diabetes mellitus. Nat. Rev. Endocrinol. 2011, 8, 92–103. [Google Scholar] [CrossRef] [PubMed]
- Parakatselaki, M.E.; Ladoukakis, E.D. mtDNA Heteroplasmy: Origin, Detection, Significance, and Evolutionary Consequences. Life 2021, 11, 633. [Google Scholar] [CrossRef]
- Committee on Practice Bulletins-Obstetrics. ACOG Practice Bulletin No. 190 Summary: Gestational Diabetes Mellitus. Obstet. Gynecol. 2018, 131, e49–e64. [Google Scholar] [CrossRef]
- Kalaki-Jouybari, F.; Shanaki, M.; Delfan, M.; Gorgani-Firouzjae, S.; Khakdan, S. High-intensity interval training (HIIT) alleviated NAFLD feature via miR-122 induction in liver of high-fat high-fructose diet induced diabetic rats. Arch. Physiol. Biochem. 2020, 126, 242–249. [Google Scholar] [CrossRef]
- Yan, Z.; Lira, V.A.; Greene, N.P. Exercise training-induced regulation of mitochondrial quality. Exerc. Sport Sci. Rev. 2012, 40, 159–164. [Google Scholar] [CrossRef] [Green Version]
- Stevanović-Silva, J.; Beleza, J.; Coxito, P.; Pereira, S.; Rocha, H.; Gaspar, T.B.; Gärtner, F.; Correia, R.; Martins, M.J.; Guimarães, T.; et al. Maternal high-fat high-sucrose diet and gestational exercise modulate hepatic fat accumulation and liver mitochondrial respiratory capacity in mothers and male offspring. Metabolism 2021, 116, 154704. [Google Scholar] [CrossRef]
- Tennessen, J.M.; Barry, W.E.; Cox, J.; Thummel, C.S. Methods for studying metabolism in Drosophila. Methods 2014, 68, 105–115. [Google Scholar] [CrossRef]
- Romero-Calvo, I.; Ocón, B.; Martínez-Moya, P.; Suárez, M.D.; Zarzuelo, A.; Martínez-Augustin, O.; de Medina, F.S. Reversible Ponceau staining as a loading control alternative to actin in Western blots. Anal. Biochem. 2010, 401, 318–320. [Google Scholar] [CrossRef] [PubMed]
- Carabelli, J.; Burgueño, A.L.; Rosselli, M.S.; Gianotti, T.F.; Lago, N.R.; Pirola, C.J.; Sookoian, S. High fat diet-induced liver steatosis promotes an increase in liver mitochondrial biogenesis in response to hypoxia. J. Cell Mol. Med. 2011, 15, 1329–1338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Winn, N.C.; Jurrissen, T.J.; Grunewald, Z.I.; Cunningham, R.P.; Woodford, M.L.; Kanaley, J.A.; Lubahn, D.B.; Manrique-Acevedo, C.; Rector, R.S.; Vieira-Potter, V.J.; et al. Estrogen receptor-α signaling maintains immunometabolic function in males and is obligatory for exercise-induced amelioration of nonalcoholic fatty liver. Am. J. Physiol. Endocrinol. Metab. 2019, 316, E156–E167. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.Q.; Cammarata, P.R.; Baines, C.P.; Yager, J.D. Regulation of mitochondrial respiratory chain biogenesis by estrogens/estrogen receptors and physiological, pathological and pharmacological implications. Biochim. Biophys. Acta 2009, 1793, 1540–1570. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.; Padhye, A.; Sharma, A.; Song, G.; Miao, J.; Mo, Y.Y.; Wang, L.; Kemper, J.K. A pathway involving farnesoid X receptor and small heterodimer partner positively regulates hepatic sirtuin 1 levels via microRNA-34a inhibition. J. Biol. Chem. 2010, 285, 12604–12611. [Google Scholar] [CrossRef] [Green Version]
- Yamamoto, H.; Morino, K.; Nishio, Y.; Ugi, S.; Yoshizaki, T.; Kashiwagi, A.; Maegawa, H. MicroRNA-494 regulates mitochondrial biogenesis in skeletal muscle through mitochondrial transcription factor A and Forkhead box j3. Am. J. Physiol. Endocrinol. Metab. 2012, 303, E1419–E1427. [Google Scholar] [CrossRef] [Green Version]
- Sheldon, R.D.; Nicole Blaize, A.; Fletcher, J.A.; Pearson, K.J.; Donkin, S.S.; Newcomer, S.C.; Rector, R.S. Gestational exercise protects adult male offspring from high-fat diet-induced hepatic steatosis. J. Hepatol. 2016, 64, 171–178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ruiz, R.; Jideonwo, V.; Ahn, M.; Surendran, S.; Tagliabracci, V.S.; Hou, Y.; Gamble, A.; Kerner, J.; Irimia-Dominguez, J.M.; Puchowicz, M.A.; et al. Sterol regulatory element-binding protein-1 (SREBP-1) is required to regulate glycogen synthesis and gluconeogenic gene expression in mouse liver. J. Biol. Chem. 2014, 289, 5510–5517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Linden, A.G.; Li, S.; Choi, H.Y.; Fang, F.; Fukasawa, M.; Uyeda, K.; Hammer, R.E.; Horton, J.D.; Engelking, L.J.; Liang, G. Interplay between ChREBP and SREBP-1c coordinates postprandial glycolysis and lipogenesis in livers of mice. J. Lipid. Res. 2018, 59, 475–487. [Google Scholar] [CrossRef] [Green Version]
- Shimomura, I.; Matsuda, M.; Hammer, R.E.; Bashmakov, Y.; Brown, M.S.; Goldstein, J.L. Decreased IRS-2 and increased SREBP-1c lead to mixed insulin resistance and sensitivity in livers of lipodystrophic and ob/ob mice. Mol. Cell 2000, 6, 77–86. [Google Scholar] [CrossRef]
- Benatti, R.O.; Melo, A.M.; Borges, F.O.; Ignacio-Souza, L.M.; Simino, L.A.; Milanski, M.; Velloso, L.A.; Torsoni, M.A.; Torsoni, A.S. Maternal high-fat diet consumption modulates hepatic lipid metabolism and microRNA-122 (miR-122) and microRNA-370 (miR-370) expression in offspring. Br. J. Nutr. 2014, 111, 2112–2122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fornes, D.; Heinecke, F.; Roberti, S.L.; White, V.; Capobianco, E.; Jawerbaum, A. Proinflammation in maternal and fetal livers and circulating miR-122 dysregulation in a GDM rat model induced by intrauterine programming. Mol. Cell Endocrinol. 2020, 510, 110824. [Google Scholar] [CrossRef]
- McDaniel, K.; Herrera, L.; Zhou, T.; Francis, H.; Han, Y.; Levine, P.; Lin, E.; Glaser, S.; Alpini, G.; Meng, F. The functional role of microRNAs in alcoholic liver injury. J. Cell Mol. Med. 2014, 18, 197–207. [Google Scholar] [CrossRef]
- Pogribny, I.P.; Starlard-Davenport, A.; Tryndyak, V.P.; Han, T.; Ross, S.A.; Rusyn, I.; Beland, F.A. Difference in expression of hepatic microRNAs miR-29c, miR-34a, miR-155, and miR-200b is associated with strain-specific susceptibility to dietary nonalcoholic steatohepatitis in mice. Lab. Investig. 2010, 90, 1437–1446. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheung, O.; Puri, P.; Eicken, C.; Contos, M.J.; Mirshahi, F.; Maher, J.W.; Kellum, J.M.; Min, H.; Luketic, V.A.; Sanyal, A.J. Nonalcoholic steatohepatitis is associated with altered hepatic MicroRNA expression. Hepatology 2008, 48, 1810–1820. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kou, X.; Li, J.; Liu, X.; Chang, J.; Zhao, Q.; Jia, S.; Fan, J.; Chen, N. Swimming attenuates d-galactose-induced brain aging via suppressing miR-34a-mediated autophagy impairment and abnormal mitochondrial dynamics. J. Appl. Physiol. 2017, 122, 1462–1469. [Google Scholar] [CrossRef] [Green Version]
- Heydari, H.; Ghiasi, R.; Hamidian, G.; Ghaderpour, S.; Keyhanmanesh, R. Voluntary exercise improves sperm parameters in high fat diet receiving rats through alteration in testicular oxidative stress, mir-34a/SIRT1/p53 and apoptosis. Horm. Mol. Biol. Clin. Investig. 2021, 42, 253–263. [Google Scholar] [CrossRef]
- Chang, S.P.; Chen, Y.H.; Chang, W.C.; Liu, I.M.; Cheng, J.T. Merit of physical exercise to reverse the higher gene expression of hepatic phosphoenolpyruvate carboxykinase in obese Zucker rats. Life Sci. 2006, 79, 240–246. [Google Scholar] [CrossRef] [PubMed]
- Barthel, A.; Schmoll, D. Novel concepts in insulin regulation of hepatic gluconeogenesis. Am. J. Physiol. Endocrinol. Metab. 2003, 285, E685–E692. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Butte, N.F. Carbohydrate and lipid metabolism in pregnancy: Normal compared with gestational diabetes mellitus. Am. J. Clin. Nutr. 2000, 71, 1256s–1261s. [Google Scholar] [CrossRef]
- Fu, T.; Choi, S.E.; Kim, D.H.; Seok, S.; Suino-Powell, K.M.; Xu, H.E.; Kemper, J.K. Aberrantly elevated microRNA-34a in obesity attenuates hepatic responses to FGF19 by targeting a membrane coreceptor β-Klotho. Proc. Natl. Acad. Sci. USA 2012, 109, 16137–16142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fu, T.; Seok, S.; Choi, S.; Huang, Z.; Suino-Powell, K.; Xu, H.E.; Kemper, B.; Kemper, J.K. MicroRNA 34a inhibits beige and brown fat formation in obesity in part by suppressing adipocyte fibroblast growth factor 21 signaling and SIRT1 function. Mol. Cell Biol. 2014, 34, 4130–4142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kir, S.; Beddow, S.A.; Samuel, V.T.; Miller, P.; Previs, S.F.; Suino-Powell, K.; Xu, H.E.; Shulman, G.I.; Kliewer, S.A.; Mangelsdorf, D.J. FGF19 as a postprandial, insulin-independent activator of hepatic protein and glycogen synthesis. Science 2011, 331, 1621–1624. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Lei, T.; Huang, J.F.; Wang, S.B.; Zhou, L.L.; Yang, Z.Q.; Chen, X.D. The link between fibroblast growth factor 21 and sterol regulatory element binding protein 1c during lipogenesis in hepatocytes. Mol. Cell Endocrinol. 2011, 342, 41–47. [Google Scholar] [CrossRef] [PubMed]
- Kong, L.J.; Feng, W.; Wright, M.; Chen, Y.; Dallas-yang, Q.; Zhou, Y.P.; Berger, J.P. FGF21 suppresses hepatic glucose production through the activation of atypical protein kinase Cι/λ. Eur. J. Pharmacol. 2013, 702, 302–308. [Google Scholar] [CrossRef]
- Yamamoto, T.; Shimano, H.; Nakagawa, Y.; Ide, T.; Yahagi, N.; Matsuzaka, T.; Nakakuki, M.; Takahashi, A.; Suzuki, H.; Sone, H.; et al. SREBP-1 interacts with hepatocyte nuclear factor-4 alpha and interferes with PGC-1 recruitment to suppress hepatic gluconeogenic genes. J. Biol. Chem. 2004, 279, 12027–12035. [Google Scholar] [CrossRef] [Green Version]
- Aharoni-Simon, M.; Hann-Obercyger, M.; Pen, S.; Madar, Z.; Tirosh, O. Fatty liver is associated with impaired activity of PPARγ-coactivator 1α (PGC1α) and mitochondrial biogenesis in mice. Lab. Investig. 2011, 91, 1018–1028. [Google Scholar] [CrossRef] [Green Version]
- Patti, M.E.; Butte, A.J.; Crunkhorn, S.; Cusi, K.; Berria, R.; Kashyap, S.; Miyazaki, Y.; Kohane, I.; Costello, M.; Saccone, R.; et al. Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: Potential role of PGC1 and NRF1. Proc. Natl. Acad. Sci. USA 2003, 100, 8466–8471. [Google Scholar] [CrossRef] [Green Version]
- Hernández-Alvarez, M.I.; Thabit, H.; Burns, N.; Shah, S.; Brema, I.; Hatunic, M.; Finucane, F.; Liesa, M.; Chiellini, C.; Naon, D.; et al. Subjects with early-onset type 2 diabetes show defective activation of the skeletal muscle PGC-1{alpha}/Mitofusin-2 regulatory pathway in response to physical activity. Diabetes Care 2010, 33, 645–651. [Google Scholar] [CrossRef] [Green Version]
- Jiang, S.; Teague, A.M.; Tryggestad, J.B.; Aston, C.E.; Lyons, T.; Chernausek, S.D. Effects of maternal diabetes and fetal sex on human placenta mitochondrial biogenesis. Placenta 2017, 57, 26–32. [Google Scholar] [CrossRef]
- Morris, E.M.; Jackman, M.R.; Meers, G.M.; Johnson, G.C.; Lopez, J.L.; MacLean, P.S.; Thyfault, J.P. Reduced hepatic mitochondrial respiration following acute high-fat diet is prevented by PGC-1α overexpression. Am. J. Physiol. Gastrointest Liver. Physiol. 2013, 305, G868–G880. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bell, M.R. Comparing Postnatal Development of Gonadal Hormones and Associated Social Behaviors in Rats, Mice, and Humans. Endocrinology 2018, 159, 2596–2613. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.; Teague, A.M.; Tryggestad, J.B.; Chernausek, S.D. Role of microRNA-130b in placental PGC-1α/TFAM mitochondrial biogenesis pathway. Biochem. Biophys. Res. Commun. 2017, 487, 607–612. [Google Scholar] [CrossRef]
- Chen, Z.; Luo, J.; Ma, L.; Wang, H.; Cao, W.; Xu, H.; Zhu, J.; Sun, Y.; Li, J.; Yao, D.; et al. MiR130b-Regulation of PPARγ Coactivator- 1α Suppresses Fat Metabolism in Goat Mammary Epithelial Cells. PLoS ONE 2015, 10, e0142809. [Google Scholar] [CrossRef] [PubMed]
- Makarova, J.A.; Maltseva, D.V.; Galatenko, V.V.; Abbasi, A.; Maximenko, D.G.; Grigoriev, A.I.; Tonevitsky, A.G.; Northoff, H. Exercise immunology meets MiRNAs. Exerc. Immunol. Rev. 2014, 20, 135–164. [Google Scholar]
- He, Y.; Bai, J.; Liu, P.; Dong, J.; Tang, Y.; Zhou, J.; Han, P.; Xing, J.; Chen, Y.; Yu, X. miR-494 protects pancreatic β-cell function by targeting PTEN in gestational diabetes mellitus. Excli. J. 2017, 16, 1297–1307. [Google Scholar] [CrossRef]
- Lahera, V.; de Las Heras, N.; López-Farré, A.; Manucha, W.; Ferder, L. Role of Mitochondrial Dysfunction in Hypertension and Obesity. Curr. Hypertens. Rep. 2017, 19, 11. [Google Scholar] [CrossRef]
- Bonnard, C.; Durand, A.; Peyrol, S.; Chanseaume, E.; Chauvin, M.A.; Morio, B.; Vidal, H.; Rieusset, J. Mitochondrial dysfunction results from oxidative stress in the skeletal muscle of diet-induced insulin-resistant mice. J. Clin. Investig. 2008, 118, 789–800. [Google Scholar] [CrossRef]
- Liesa, M.; Palacín, M.; Zorzano, A. Mitochondrial dynamics in mammalian health and disease. Physiol. Rev. 2009, 89, 799–845. [Google Scholar] [CrossRef] [Green Version]
- Pang, W.; Zhang, Y.; Zhao, N.; Darwiche, S.S.; Fu, X.; Xiang, W. Low expression of Mfn2 is associated with mitochondrial damage and apoptosis in the placental villi of early unexplained miscarriage. Placenta 2013, 34, 613–618. [Google Scholar] [CrossRef]
- Chen, H.; Detmer, S.A.; Ewald, A.J.; Griffin, E.E.; Fraser, S.E.; Chan, D.C. Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J. Cell Biol. 2003, 160, 189–200. [Google Scholar] [CrossRef] [PubMed]
- Srinivasan, S.; Guha, M.; Kashina, A.; Avadhani, N.G. Mitochondrial dysfunction and mitochondrial dynamics-The cancer connection. Biochim. Biophys. Acta Bioenerg. 2017, 1858, 602–614. [Google Scholar] [CrossRef] [PubMed]
- Mishra, P.; Carelli, V.; Manfredi, G.; Chan, D.C. Proteolytic cleavage of Opa1 stimulates mitochondrial inner membrane fusion and couples fusion to oxidative phosphorylation. Cell Metab. 2014, 19, 630–641. [Google Scholar] [CrossRef] [Green Version]
- Kushnareva, Y.E.; Gerencser, A.A.; Bossy, B.; Ju, W.K.; White, A.D.; Waggoner, J.; Ellisman, M.H.; Perkins, G.; Bossy-Wetzel, E. Loss of OPA1 disturbs cellular calcium homeostasis and sensitizes for excitotoxicity. Cell Death Differ. 2013, 20, 353–365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pryde, K.R.; Smith, H.L.; Chau, K.Y.; Schapira, A.H. PINK1 disables the anti-fission machinery to segregate damaged mitochondria for mitophagy. J. Cell Biol. 2016, 213, 163–171. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Wang, Z.H.; Liu, Y.; Chen, Y.; Sun, N.; Gucek, M.; Zhang, F.; Xu, H. PINK1 Inhibits Local Protein Synthesis to Limit Transmission of Deleterious Mitochondrial DNA Mutations. Mol. Cell 2019, 73, 1127–1137.e1125. [Google Scholar] [CrossRef] [Green Version]
- Frank, S.; Gaume, B.; Bergmann-Leitner, E.S.; Leitner, W.W.; Robert, E.G.; Catez, F.; Smith, C.L.; Youle, R.J. The role of dynamin-related protein 1, a mediator of mitochondrial fission, in apoptosis. Dev. Cell 2001, 1, 515–525. [Google Scholar] [CrossRef] [Green Version]
- Breckenridge, D.G.; Stojanovic, M.; Marcellus, R.C.; Shore, G.C. Caspase cleavage product of BAP31 induces mitochondrial fission through endoplasmic reticulum calcium signals, enhancing cytochrome c release to the cytosol. J. Cell Biol. 2003, 160, 1115–1127. [Google Scholar] [CrossRef]
- Arnoult, D.; Grodet, A.; Lee, Y.J.; Estaquier, J.; Blackstone, C. Release of OPA1 during apoptosis participates in the rapid and complete release of cytochrome c and subsequent mitochondrial fragmentation. J. Biol. Chem. 2005, 280, 35742–35750. [Google Scholar] [CrossRef]
Gene | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
---|---|---|
Pgc-1α | AAAAGCTTGACTGGCGTCAT | TCAGGAAGATCTGGGCAAAG |
Tfam | GCTAAACACCCAGATGCAAAA | CGAGGTCTTTTTGGTTTTCC |
Mfn1 | TGGTCACACAACCAACTGCT | GGGCCAAAATACGTGCACAA |
Mfn2 | GTGACGTGTTGGGTGTGAT | GGACATCTCGTTTCTAGCTGGT |
Drp1 | CCAGGAATGACCAAGGTCCC | CCTCGTCCATCAGGTCCAAC |
18S rRNA | CATTCGAACGTCTGCCCTAT | GTTTCTCAGGCTCCCTCTCC |
GAPDH (nuclear DNA) [12] | GGAAAGACAGGTGTTTTGCA | AGGTCAGAGTGAGCAGGACA |
Rnr2 (mitochondrial DNA) [12] | AGCTATTAATGGTTCGTTTGT | AGGAGGCTCCATTTCTCTTGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stevanović-Silva, J.; Beleza, J.; Coxito, P.; Oliveira, P.J.; Ascensão, A.; Magalhães, J. Gestational Exercise Antagonises the Impact of Maternal High-Fat High-Sucrose Diet on Liver Mitochondrial Alterations and Quality Control Signalling in Male Offspring. Int. J. Environ. Res. Public Health 2023, 20, 1388. https://doi.org/10.3390/ijerph20021388
Stevanović-Silva J, Beleza J, Coxito P, Oliveira PJ, Ascensão A, Magalhães J. Gestational Exercise Antagonises the Impact of Maternal High-Fat High-Sucrose Diet on Liver Mitochondrial Alterations and Quality Control Signalling in Male Offspring. International Journal of Environmental Research and Public Health. 2023; 20(2):1388. https://doi.org/10.3390/ijerph20021388
Chicago/Turabian StyleStevanović-Silva, Jelena, Jorge Beleza, Pedro Coxito, Paulo J. Oliveira, António Ascensão, and José Magalhães. 2023. "Gestational Exercise Antagonises the Impact of Maternal High-Fat High-Sucrose Diet on Liver Mitochondrial Alterations and Quality Control Signalling in Male Offspring" International Journal of Environmental Research and Public Health 20, no. 2: 1388. https://doi.org/10.3390/ijerph20021388