Clonal Fidelity and Genetic Diversity of Micropropagated Hancornia speciosa Gomes (Apocynaceae) as Evaluated by Molecular Markers
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. In Vitro Establishment and Propagation
2.3. DNA Extraction and Molecular Markers’ (SSR and ISSR) Amplifications
2.4. Data Analysis
3. Results
3.1. In Vitro Propagation
3.2. Analysis of Somaclonal Variation Using Molecular Markers
3.3. Genetic Diversity Analysis
4. Discussion
4.1. Analysis of Somaclonal Variation Using Molecular Markers
4.2. Genetic Diversity Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Costa, C.F.; Collevatti, R.G.; Chaves, L.J.; Lima, J.S.; Soares, T.N.; Telles, M.P.C. Genetic diversity and fine-scale genetic structure in Hancornia speciosa Gomes (Apocynaceae). Biochem. Syst. Ecol. 2017, 72, 63–67. [Google Scholar] [CrossRef]
- Silva, T.A.C.; Vasconcelos-Filho, S.C.; Rodrigues, A.A.; Rodrigues, D.A.; Moura, L.M.F.; Goncalves, I.A.; Costa, A.C.; Reis, E.L.; Carlos, L.; Muller, C. Tolerance of Hancornia speciosa Gomes (Apocynaceae) to potassium fluoride: Physiological and anatomical traits. Acta Physiol. Plant 2020, 42, 153. [Google Scholar] [CrossRef]
- Silva Junior, J.F.; Lédo, A.S. A cultura da mangaba; Embrapa Tabuleiros Costeiros: Aracajú, Brazil, 2006; pp. 1–84.
- Darrault, R.O.; Schlindwein, C. Polinização de Hancornia speciosa (Apocynaceae). In Simpósio Brasileiro sobre a Cultura da Mangaba; Embrapa Tabuleiros Costeiros: Aracaju, Brazil, 4 September 2003. [Google Scholar]
- Collevatti, R.G.; Olivatti, A.M.; Telles, M.P.C.; Chaves, L.J. Gene flow among Hancornia speciosa (Apocynaceae) varieties and hybrid fitness. Tree Genet. Genomes 2016, 12, 74. [Google Scholar] [CrossRef]
- Moura, N.F.; Chaves, L.J.; Venkovsky, R.; Naves, R.V.; Aguiar, A.V.; Moura, M.F. Genetic structure of mangaba (Hancornia speciosa Gomes) populations in the cerrado region of central Brazil. Biosci. J. 2011, 27, 473–481. [Google Scholar]
- Jimenez, H.J.; Martins, L.S.S.; Montarroyos, A.V.V.; Silva Júnior, J.F.; Alzate-Marin, A.L.; Moraes Filhos, R.M. Genetic diversity of the Neotropical tree Hancornia speciosa Gomes in natural populations in Northeastern Brazil. Genet. Mol. Res. 2015, 14, 17749–17757. [Google Scholar] [CrossRef] [PubMed]
- Pereira, A.C.; Pereira, A.B.D.; Moreira, C.C.L.; Botion, L.M.; Lemos, V.S.; Braga, F.C.; Cortes, S.F. Hancornia speciosa Gomes (Apocynaceae) as a potential anti-diabetic drug. J. Ethnopharmacol. 2015, 161, 30–35. [Google Scholar] [CrossRef]
- Medeiros, E.S.; Galiani, P.D.; Moreno, R.M.B.; Mattoso, L.H.C.; Malmonge, J.A. A comparative study of the non-isothermal degradation of natural rubber from Mangabeira (Hancornia speciosa Gomes) and Seringueira (Hevea brasiliensis). J. Therm. Anal. Calorim. 2010, 100, 1045–1050. [Google Scholar] [CrossRef]
- Almeida, L.M.; Floriano, J.F.; Ribeiro, T.P.; Magno, L.N.; Mota, L.S.L.S.; Peixoto, N.; Mrué, F.; Melo-Reis, P.; Junior, R.S.L.; Graeff, C.F.O. Hancornia speciosa latex for biomedical applications: Physical and chemical properties, biocompatibility assessment and angiogenic activity. J. Mater. Sci. Mater. Med. 2014, 25, 2153–2162. [Google Scholar] [CrossRef]
- Bastos, L.P.; Moreira-Souza, M.J.; Costa, M.A.P.C.; Rocha, M.C.; Hansen, D.S.; Silva, S.A.; Dantas, A.C.V.L.; Sousa, C.S. Cultivo in vitro de Mangabeira (Hancornia speciosa). Rer. Bras. Bioci. 2007, 5, 1122–1124. [Google Scholar]
- Soares, F.P.; Paiva, R.; Alvarenga, A.A.; Nogueira, R.C.; Emrich, E.B.; Martinotto, C. Organogênese direta em explantes caulinares de mangabeiras (Hancornia speciosa Gomes). Ciênc. Agrotec. 2007, 31, 1048–1053. [Google Scholar] [CrossRef]
- de Almeida, G.Q.; Chaves, L.J.; Vieira, M.C.; Ganga, R.M.D. Agronomic evaluation of a Hancornia speciosa Gomes germplasm collection from the Brazilian Cerrado. Crop. Breed. Appl. Biotechnol. 2019, 19, 8–14. [Google Scholar] [CrossRef]
- Oliveira, K.S.; Aloufa, M.A.I. Knowledge, use, and management of magaba (Hancornia speciosa Gomes) by extrativist communities on the coast of Rio Grande do Norte, Northeast Brazil. Acta Bot. Bras. 2021, 35, 276–289. [Google Scholar] [CrossRef]
- Nunes, V.V.; Silva-Mann, R.; Souza, J.L.; Calazans, C.C. Geno-phenotypic diversity in a natural population of Hancornia speciosa Gomes: Implications for conservation and improvement. Genet. Resour. Crop Evol. 2021, 68, 2869–2882. [Google Scholar] [CrossRef]
- Maia, A.K.S.; Terto, J.; de Oliveira, I.F.; do Nascimento, W.F.; Almeida, C.; da Silva, E.F. Genetic diversity and structure of Hancornia speciosa Gomes populations characterized by microsatellites markers. Crop. Breed. Appl. Biotechnol. 2022, 22, 1–8. [Google Scholar] [CrossRef]
- Dos Reis, R.M.; Rocha, A.E.; Carvalho, M.J.N.; da Silva, L.P.V.; Muniz, F.H.; Marques, G.E.C.; Mesquita, M.L.R. Characterization of vegetation structure in areas of natural occurrence of Hancornia speciosa Gomes. Aust. J. Crop Sci. 2021, 15, 156–163. [Google Scholar] [CrossRef]
- Luz, G.A.; Santos, J.A.; de Oliveira, K.P.; Martins, P.P.; Valente, S.E.S.; Maia, M.C.C.; Lima, P.S.C. Genetic diversity and population structure of mangabeira (Hancornia speciosa) estimated using ISSR markers. Acta Sci. Biol. Sci. 2020, 42, 1–10. [Google Scholar] [CrossRef]
- Sá, A.J.; Lédo, A.S.; Lédo, C.A.S. Conservação in vitro de mangabeira da região nordeste do Brasil. Rev. Ciênc. Rural. 2011, 41, 57–62. [Google Scholar] [CrossRef]
- Lédo, A.S.; Seca, G.S.V.; Barboza, S.B.S.C.; Silva Júnior, J.F. Crescimento inicial de mangabeira (Hancornia speciosa Gomes) em diferentes meios de germinação in vitro. Ciênc. Agrotec. 2007, 31, 989–993. [Google Scholar] [CrossRef]
- Oliveira, K.S.; Oliveira, M.S.; Pereira, E.C.; Lima, S.C.; Aloufa, M.A.I. Efeito de diferentes meios de cultura na germinação in vitro de sementes de mangabeira (Hancornia speciosa Gomes). Rev. Árvore. 2014, 38, 601–607. [Google Scholar] [CrossRef]
- Borthakur, M.; Hazarika, J.; Singh, R.S. A protocol for micropropagation of Alpinia galanga. Plant Cell Tissue Organ Cult. 1999, 55, 231–233. [Google Scholar] [CrossRef]
- Thorpe, T.A. History of plant tissue culture. Mol. Biotechnol. 2007, 37, 169–180. [Google Scholar] [CrossRef] [PubMed]
- Xavier, A.; Otoni, W.C. Aplicações da micropropagação na clonagem de Eucalyptus no Brasil. Agron. Costarric. 2009, 33, 303–307. [Google Scholar]
- Larkin, P.J.; Scowcroft, W.R. Somaclonal variation: A novel source of variability from cell cultures for plant improvement. Theor. Appl. Genet. 1981, 60, 197–214. [Google Scholar] [CrossRef] [PubMed]
- Nwauzoma, A.B.; Jaja, E.T. A review of somaclonal variation in plantain (Musa spp.): Mechanisms and applications. J. Appl. Biosci. 2013, 67, 5252–5260. [Google Scholar] [CrossRef]
- Etienne, H.; Bertrand, B.; Dechamp, E.; Maurel, P.; Georget, F.; Guyot, R.; Breitler, J.C. Are Genetic and Epigenetic Instabilities of Plant Embryogenic Cells a Fatality? The Experience of Coffee Somatic Embryogenesis. Hum. Genet. Embryol. 2016, 6, 136. [Google Scholar] [CrossRef]
- Bairu, M.W.; Aremu, A.O.; Staden, J.V. Somaclonal variation in plants: Causes and detection methods. Plant Growth Regul. 2011, 63, 147–173. [Google Scholar] [CrossRef]
- Krishna, H.; Alizadeh, M.; Singh, D.; Singh, U.; Chauhan, N.; Efetekhari, M.; Sadh, R.K. Somaclonal variations and their applications in horticultural crops improvement. 3 Biotech 2016, 6, 54. [Google Scholar] [CrossRef]
- Schellenbaum, P.; Mohler, V.; Wenzel, G.; Walter, B. Variation in DNA methylation patterns of grapevine somaclones (Vitis vinifera L.). BMC Plant Biol. 2008, 8, 78. [Google Scholar] [CrossRef]
- Landey, R.B.; Cenci, A.; Bertrand, B.; Georget, F.; Dechamp, E. Assessment of genetic and epigenetic changes during cell culture ageing in coffee and relations with somaclonal variation. Plant Cell Tissue Organ Cult. 2015, 3, 517–531. [Google Scholar] [CrossRef]
- Rathore, M.S.; Yadav, P.; Mastan, S.G.; Prakash, C.h.R.; Singh, A.; Agarwal, P.K. Evaluation of genetic homogeneity in tissue culture regenerates of Jatropha curcas L. using flow cytometer and DNA-based molecular markers. Appl. Biochem. Biotech. 2014, 172, 298–310. [Google Scholar] [CrossRef]
- Peng, X.; Zhang, T.T.; Zhang, J. Effect of subculture times on genetic fidelity, endogenous hormone level and pharmaceutical potential of Tetrastigma hemsleyanum callus. Plant Cell Tissue Organ Cult. 2015, 122, 67–77. [Google Scholar] [CrossRef]
- Saha, S.; Adhikari, S.; Dey, T.; Ghosh, P. RAPD and ISSR based evaluation of micropropagated plantlets of Morus alba L. variety S-1. Meta Gene 2016, 7, 7–15. [Google Scholar] [CrossRef] [PubMed]
- Soares, D.M.M.; Sattler, M.C.; Ferreira, M.F.S.; Praça-Fontes, M. Assessment of genetic stability in three generations of in vitro propagated Jatropha curcas L. plantlets using ISSR markers. Trop. Plant Biol. 2016, 9, 229–238. [Google Scholar] [CrossRef]
- Debnath, S.C. Thidiazuron in Micropropagation of Small Fruits. In Thidiazuron: From Urea Derivative to Plant Growth Regulator; Ahmad, N., Faisal, M., Eds.; Springer: Singapore, 2018; pp. 139–158. [Google Scholar]
- Faleiro, F.G. Marcadores Genético-Moleculares Aplicados a Programas de Conservação e uso de Recursos Genéticos; Embrapa Cerrados: Planaltina, Brazil, 2007; pp. 1–102. [Google Scholar]
- Cabral, J.S.R.; Alberto, P.S.; Pereira, F.D.; Souchie, E.L.; Silva, F.G. In vitro Cultivation of Hancornia speciosa Gomes: The Physical Constitution of the Culture Medium, Sucrose Concentrations and Growth Conditions. Plant Tissue Cult. Biotechnol. 2013, 23, 177–187. [Google Scholar] [CrossRef]
- Prudente, D.O.; Paiva, R.; Nery, F.C.; Máximo, W.P.F.; Silva, L.C. Indirect in vitro organogenesis of Hancornia speciosa Gomes. Biosci. J. 2016, 32, 721–729. [Google Scholar] [CrossRef]
- Santos, M.P.; Aguiar, R.A.; Brandão, D.C.; Pires, L.L.; Castro, Y.O.; Silva, F.G.; Neri, L.M.S.; Pereira, D.R.M.; Castro, J.R.; Seleguini, A. Effect of seed desiccation and sucrose concentration on the in vitro establishment of mangabeira (Hancornia speciosa Gomes var. Gardneri) seedlings. Afr. J. Agric. Res. 2017, 12, 348–353. [Google Scholar] [CrossRef][Green Version]
- Rai, M.K.; Phulwaria, M.; Gupta, A.K.; Shekhawat, N.S.; Jaiswal, U. Genetic homogeneity of guava plants derived from somatic embryogenesis using SSR and ISSR markers. Plant Cell Tissue Organ Cult. 2012, 111, 259–264. [Google Scholar] [CrossRef]
- Murashige, T.; Skoog, F. A Revised medium for rapid growth and biossays with tobacco tissue cultures. Physiol. Plantarum. 1962, 15, 473–479. [Google Scholar] [CrossRef]
- White, P.R. Nutrient deficiency studies and an improved inorganic nutrient medium for cultivation of excised tomato roots. Growth 1943, 7, 53–65. [Google Scholar]
- Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
- Rodrigues, A.J.L.; Yamaguishi, A.T.; Chaves, L.J.; Coelho, A.S.G.; Lima, J.S.; Telles, M.P.C. Development of microsatellite markers for Hancornia speciosa Gomes (Apocynaceae). Genet. Mol. Res. 2015, 14, 7274–7278. [Google Scholar] [CrossRef] [PubMed]
- Costa, D.F.; Vieira, F.A.; Fajardo, C.G.; Chagas, K.P.T. Diversidade genética e seleção de iniciadores ISSR em uma população natural de mangaba (Hancornia speciosa Gomes) (Apocynaceae). Rev. Bras. Frutic. 2015, 37, 970–976. [Google Scholar] [CrossRef]
- Soares, A.N.R.; Vitória, M.F.; Nascimento, A.L.S.; Lédo, A.S.; Rabbani, A.R.C.; Silva, A.V.C. Genetic diversity in natural populations of mangaba in Sergipe, the largest producer State in Brazil. Genet. Mol. Res. 2016, 15, 15038624. [Google Scholar] [CrossRef] [PubMed]
- Cruz, C.D. Genes Software—Extended and integrated with the R, Matlab and Selegen. Acta Sci-Agron. 2016, 38, 547–552. [Google Scholar] [CrossRef]
- Bridgen, M.P.; Houtven, W.V.; Eeckhaut, T. Plant tissue culture techniques for breeding. In Ornamental Crops; Van Huylenbroeck, J., Ed.; Springer: Cham, Switzerland, 2018; Volume 11, pp. 73–199. [Google Scholar]
- Gao, X.; Yang, D.; Cao, D.; Ao, M.; Sui, X.; Wang, Q.M.; Kimatu, J.N. In vitro micropropagation of Freesia hybrid and the assessment of genetic and epigenetic stability in regenerated plantlets. J. Plant Growth Regul. 2010, 29, 257–267. [Google Scholar] [CrossRef]
- Bairu, M.W.; Fennell, C.W.; Staden, J.V. The effect of plant growth regulators on somaclonal variation in Cavendish banana (Musa AAA cv. ‘Zelig’). Sci. Hortic. 2006, 108, 347–351. [Google Scholar] [CrossRef]
- Feuser, S.; Meler, K.; Daquinta, M.; Guerra, M.P.; Nodari, R.O. Genotypic fidelity of micropropagated pineapple (Ananas comosus) planlets assessed by isozyme and RAPD markers. Plant Cell Tissue Organ Cult. 2003, 72, 221–227. [Google Scholar] [CrossRef]
- Phillips, R.L.; Kaeppler, S.M.; Olhoft, P. Genetic instability of plant tissue cultures: Breakdown of normal controls. Proc. Natl. Acad. Sci. USA 1994, 91, 5222–5226. [Google Scholar] [CrossRef]
- Kamenická, A.; Rypák, M. The regeneration of Actinidia chinesis Pl. cultured in vitro. Polnohospodarvo 1989, 35, 811–818. [Google Scholar]
- Piola, F.; Rohr, R.; Heizmann, P. Rapid detection of genetic variation within and among i in vitro propagated cedar (Cedrus libani Loudon) clones. Plant Sci. 1999, 141, 159–163. [Google Scholar] [CrossRef]
- Soneji, J.R.; Rao, P.S.; Mhatre, M. Somaclonal variation in micropropagated dormant axillary buds of pineapple (Ananas comosus L., Merr.). J. Hortic. Sci. Biotech. 2002, 77, 28–32. [Google Scholar] [CrossRef]
- Karp, A. Somaclonal variation as a tool for crop improvement. Euphytica 1995, 85, 295–302. [Google Scholar] [CrossRef]
- Sharma, S.K.; Bryan, G.J.; Winfield, M.O.; Millam, S. Stability of potato (Solanum tuberosum L.) plants regenerated via somatic embryos, axillary bud proliferated shoots, microtubers and true potato seeds: A comparative phenotypic, cytogenetic and molecular assessment. Planta 2007, 226, 1449–1458. [Google Scholar] [CrossRef] [PubMed]
- Chuang, S.J.; Chen, C.L.; Chen, J.J.; Chou, W.Y.; Sung, J.M. Detection of somaclonal variation in micro-propagated Echinacea purpurea using AFLP marker. Sci. Hortic. 2009, 120, 121–126. [Google Scholar] [CrossRef]
- Giménez, C.; García, E.; Enrech, N.X.; Blanca, I. Somaclonal variation in banana: Cytogenetic and molecular characterization of the somaclonal variant cien BTA-03. In Vitro Cell Dev. Biol.-Plant 2001, 37, 217–222. [Google Scholar] [CrossRef]
- Nehra, N.S.; Kartha, K.K.; Stushnott, C.; Giles, K.L. The influence of plant growth regulator concentrations and callus age on somaclonal variation in callus culture regenerants of strawberry. Plant Cell Tissue Organ Cult. 1992, 29, 257–268. [Google Scholar] [CrossRef]
- Gesteira, A.S.; Otoni, W.C.; Barros, E.G.; Moreira, M.A. RAPD-based detection of genomic instability in soybean plants derived from somatic embryogenesis. Plant Breed. 2002, 121, 269–271. [Google Scholar] [CrossRef]
- Jin, S.; Mushke, R.; Zhu, H.; Tu, L.; Lin, Z.; Zhang, Y.; Zhang, X. Detection of somaclonal variation of cotton (Gossypium hirsutum) using cytogenetics, flow cytometry and molecular markers. Plant Cell Rep. 2008, 27, 1303–1316. [Google Scholar] [CrossRef]
- Hsie, B.S.; Brito, J.Z.; Vila Nova, M.X.; Boreges-Paluch, L.R.; Silva, M.V.; Donato, V.M.S.T. Determining the genetic stability of micropropagated sugarcane using inter-simple sequence repeat markers. Genet. Mol. Res. 2015, 14, 17651–17659. [Google Scholar] [CrossRef]
- Martins, M.; Sarmento, D.; Oliveira, M.M. Genetic stability of micropropagated almond plantlets as assessed by RAPD and ISSR markers. Plant Cell Rep. 2004, 23, 492–496. [Google Scholar] [CrossRef]
- Lakshmanan, V.; Venkataramareddy, S.R.; Neelwarne, B. Molecular analysis of genetic stability in long-term micropropagated shoots of banana using RAPD and ISSR markers. Electron. J. Biotechnol. 2007, 10, 106–113. [Google Scholar] [CrossRef]
- Thorat, A.S.; Sonone, N.A.; Choudhari, V.V.; Devarumath, R.M.; Babu, K.H. Plant regeneration from cell suspension culture in Saccharum officinarum L. and ascertaining of genetic fidelity through RAPD and ISSR markers. 3 Biotech 2017, 7, 16. [Google Scholar] [CrossRef] [PubMed]
- Weising, K.; Nybom, H.; Wolff, K.; Meyer, W. DNA Fingerprinting in Plants and Fungi; CRC Press: Boca Raton, FL, USA, 1995; pp. 44–59. [Google Scholar]
- Jain, R.; Srivastava, S.; Singh, J.; Gupta, P.S. Assessment of genetic purity of micropropagated plants of sugarcane by isozyme and RAPD analysis. Sugar Tech 2005, 7, 15–19. [Google Scholar] [CrossRef]
- Bathia, R.; Singh, K.P.; Jhang, T.; Sharma, T.R. Assessment of clonal fidelity of micropropagated gerbera plants by ISSR markers. Sci. Hortic. 2009, 119, 208–211. [Google Scholar] [CrossRef]
- Huang, W.J.; Ning, G.G.; Liu, G.F.; Bao, M.Z. Determination of genetic stability of long-term micropropagated plantlets of Platanus acerifolia using ISSR markers. Biol. Plantarum. 2009, 53, 159–163. [Google Scholar] [CrossRef]
- Kanwar, K.; Devi, V.; Sharma, S.; Soni, M.; Sharma, D. Effect of physiological age and growth regulators on micropropagation of Aloe vera followed by genetic stability assessment. Natl. Acad. Sci. Lett. 2015, 38, 29–35. [Google Scholar] [CrossRef]
- Martínez, O. Selection of molecular markers for the estimation of somaclonal variation. In Plant Cell Culture Protocols. Methods in Molecular Biology; Loyola-Vargas, V., Ochoa-Alejo, N., Eds.; Humana Press: New York, NY, USA, 2018; Volume 1815, pp. 227–278. [Google Scholar]
- Żabicki, P.; Sliwinska, E.; Mitka, J. Does somaclonal variation play advantageous role in conservation practice of endangered species?: Comprehensive genetic studies of in vitro propagated plantlets of Viola stagnina Kit. (Violaceae). Plant Cell Tissue Organ Cult. 2018, 136, 339–352. [Google Scholar] [CrossRef]
- Bogéa, E.; dos Santos, R.G.; Ramos, M.V.V.; de Menezes, I.P.P. High diversity and low genetic structure of remnants from Hancornia speciosa gomes in two savanic formations of the cerrado biome in the state park of serra de caldas novas—Goiás. Int. J. Conserv. Sci. 2021, 12, 599–612. [Google Scholar]
- Soares, A.N.R.; Clivati, D.; Melo, M.F.V.; Gitzendanner, M.; Soltis, P.; Soltis, D.; da Silva Júnior, J.F.; Ledo, A.S.; da Silva, A.V.C. Genetic diversity of accessions and first generation progeny of the mangaba genebank. Am. J. Plant Sci. 2018, 09, 1618–1629. [Google Scholar] [CrossRef][Green Version]
- Santos, P.S.; Freitas, L.S.; Santana, J.G.S.; Muniz, E.N.; Rabbani, A.R.C.; da Silva, A.V.C. Genetic diversity and the quality of Mangabeira tree fruits (Hancornia speciosa Gomes—Apocynaceae), a native species from Brazil. Sci. Hortic. 2017, 226, 372–378. [Google Scholar] [CrossRef]
- Darrault, R.O.; Schlindwein, C. Limited fruit production in Hancornia speciosa (Apocynaceae) and pollination by nocturnal and diurnal insects. Biotropica 2005, 37, 381–388. [Google Scholar] [CrossRef]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Silva, A.V.C.; Amorim, J.A.E.; Melo, M.F.V.; Ledo, A.S.; Rabbani, A.R.C. Genetic Diversity of Remaining Populations of Mangaba (Hancornia speciosa Gomes) in Restingas of Brazil. J. Agric. Sci. 2017, 9, 46–52. [Google Scholar] [CrossRef][Green Version]
- Bussab, W.O.; Miazak, E.S.; Andrade, D.F. Introdução à análise de agrupamentos; Associação Brasileira de Estatística: São Paulo, Brazil, 1990; pp. 1–105. [Google Scholar]
- Silva, A.V.C.; Amorim, J.A.E.; Vitória, M.F.; Ledo, A.S.; Rabbani, A.R.C. Characterization of trees, fruits and genetic diversity in natural populations of mangaba. Ciênc. Agrotec. 2017, 41, 255–262. [Google Scholar] [CrossRef]





| Primers | Sequences (5′–3′) | AT 1 | NB 2 | NPB 3 | P (%) 4 | PIC 5 |
|---|---|---|---|---|---|---|
| UBC 1 | ACACACACACACACACT | 50.0 | 5 | 3 | 60.0 | 0.281 |
| UBC 2 | GAGAGAGAGAGAGAGAT | 50.0 | 4 | 1 | 25.0 | 0.124 |
| UBC 808 | AGAGAGAGAGAGAGAGC | 52.4 | 4 | 1 | 25.0 | 0.117 |
| UBC 809 | AGA GAG AGA GAG AGA GG | 52.4 | 5 | 2 | 40.0 | 0.100 |
| UBC 810 | GAGAGAGAGAGAGAGAT | 50.0 | 3 | 1 | 33.3 | 0.060 |
| UBC 812 | GAG AGA GAG AGA GAG AA | 50.0 | 7 | 1 | 14.3 | 0.063 |
| UBC 815 | CTC TTC TCT CTC TCT CTG | 53.9 | 5 | 0 | 0.0 | 0.000 |
| UBC 818 | CAC ACA CAC ACA CAC AG | 52.4 | 3 | 1 | 33.3 | 0.165 |
| UBC 825 | ACA CAC ACA CAC ACA CT | 50.0 | 5 | 2 | 40.0 | 0.158 |
| UBC 826 | ACACACACACACACACC | 52.4 | 3 | 1 | 33.3 | 0.060 |
| UBC 834 | AGA GAG AGA GAG AGA GYT | 51.6 | 5 | 1 | 20.0 | 0.069 |
| UBC 848 | CAC ACA CAC ACA CAC ARG | 53.9 | 8 | 6 | 75.0 | 0.169 |
| UBC 851 | GTG TGT GTG TGT GTG TYG | 53.9 | 5 | 0 | 0.0 | 0.000 |
| UBC 855 | ACA CAC ACA CAC ACA CYT | 51.6 | 4 | 1 | 25.0 | 0.105 |
| UBC 866 | CTC CTCCTCCTCCTCCTC | 60.7 | 4 | 0 | 0.0 | 0.000 |
| Total | - | 70 | 21 | - | - | |
| Average | - | 4.66 | 1.4 | 28.2 | 0.098 |
| Primers | Sequences (5′–3′) | AT 1 | NA 2 | PIC 3 |
|---|---|---|---|---|
| HS 01 | F: GTGTCTTCCATCCGAGCTTAAC | 50 | 3 | 0.593 |
| R: TTTCCCAGAAAGGAGAGGTACA | ||||
| HS 11 | F: GTGATATTTCGTGCTCTCCAAG | 50 | 2 | 0.180 |
| R: CTCTGCCACTGTGCAACC | ||||
| HS 18 | F: ATTCATGCTCCACTGGCTTC | 50 | 2 | 0.500 |
| R: GACCACAGCTAGTGACGTGTTC | ||||
| HS 17 | F: ACTCGAGCAGAAGAAGCAAATC | 54 | 2 | 0.500 |
| R: ACACACCCTCATCAGCCC | ||||
| HS 27 | F: TATAGTGGTCCTGCACCCTTGT | 54 | 2 | 0.278 |
| R: TTTTCCCTTGTGCTTCGC | ||||
| HS 08 | F: AATGTAGAGGTGAACGAGTGGG | 48 | 1 | 0.000 |
| R: TACACCCTGCTCATCGTTTATG | ||||
| HS 16 | F: CGTTGGTAGCGGCTGTATTAAG | 48 | 2 | 0.500 |
| R: CCCCTCCTGCCACTCTCT | ||||
| HS 10 | F: ACAAATCAATGAGGAGGTGCTT | 52 | 3 | 0.583 |
| R: TAACTATGTGCAACCGCAAGAC | ||||
| HS 13 | F: CTGGGGTACTTCAGCAAATCAC | 56 | 1 | 0.000 |
| R: CATCAAAGACCGTTGTCTCCTT | ||||
| HS 14 | F: GAGCAGGAGTCAGGAAAATCAC | 56 | 3 | 0.525 |
| R: ACAGTGAAGGGGCAATGAAG | ||||
| HS 22 | F: GGACGAAACGAAATGGAGAGTA | 56 | 1 | 0.000 |
| R: AGTAAAGACACGTCATCCCCAC | ||||
| HS 23 | F: TGCAAACCCTCATTTCTTTTCTTC | 56 | 2 | 0.500 |
| R: GGAGCAAATCGGGAAGCC | ||||
| HS 30 | F: GAGGAATCTCAGCCAAGTCCTA | 56 | 2 | 0.500 |
| R: CCCAGCCTCTACAAACTCTCTG | ||||
| HS 33 | F: CGTTGGTAGCGGCTGTATTAAG | 56 | 3 | 0.665 |
| R: CACTCTCTTTTCCCGATTTTCC | ||||
| HS 24 | F: GCTAAATCAAGCAAACCTCGAC | 58 | 2 | 0.463 |
| R: AAAGCAGTCCATGATCCATTTC | ||||
| HS 26 | F: CAAACAAGCTTTATGTGGGTCA | 58 | 1 | 0.000 |
| R: AGCTCAAGGAAGTGGGATCTAA | ||||
| Total | 36 | |||
| Average | 2 | 0.362 |
| A1-P1 | A3-P1 | A6-P2 | A7-P2 | A8-P2 | A4-P2 | A5-P2 | A10-P3 | A11-P3 | ||
|---|---|---|---|---|---|---|---|---|---|---|
| A1-P1 | 0 | 0.02 | 0.10 | 0.13 | 0.13 | 0.10 | 0.07 | 0.07 | 0.03 | |
| A3-P1 | 0.14 | 0 | 0.09 | 0.13 | 0.15 | 0.12 | 0.12 | 0.09 | 0.05 | |
| A6-P2 | 0.19 | 0.28 | 0 | 0.08 | 0.09 | 0.12 | 0.11 | 0.15 | 0.10 | |
| A7-P2 | 0.14 | 0.23 | 0.05 | 0 | 0.05 | 0.08 | 0.09 | 0.16 | 0.15 | |
| A8-P2 | 0.17 | 0.25 | 0.17 | 0.13 | 0 | 0.06 | 0.08 | 0.17 | 0.16 | |
| A4-P2 | 0.17 | 0.20 | 0.13 | 0.08 | 0.20 | 0 | 0.03 | 0.15 | 0.13 | |
| A5-P2 | 0.17 | 0.20 | 0.13 | 0.08 | 0.20 | 0.00 | 0 | 0.12 | 0.11 | |
| A10-P3 | 0.22 | 0.31 | 0.27 | 0.22 | 0.34 | 0.25 | 0.25 | 0 | 0.05 | |
| A11-P3 | 0.22 | 0.31 | 0.27 | 0.22 | 0.34 | 0.25 | 0.25 | 0.00 | 0 | |
| ISSR A 1 | 0.07 | 0.08 | 0.09 | 0.09 | 0.10 | 0.09 | 0.08 | 0.11 | 0.09 | 0.09 |
| SSR A 2 | 0.16 | 0.22 | 0.16 | 0.13 | 0.20 | 0.14 | 0.14 | 0.21 | 0.21 | 0.17 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Costa, G.F.d.; Cabral, P.D.S.; Silva, F.G.; Rubio Neto, A.; Mendonça, M.A.C. Clonal Fidelity and Genetic Diversity of Micropropagated Hancornia speciosa Gomes (Apocynaceae) as Evaluated by Molecular Markers. Forests 2022, 13, 1645. https://doi.org/10.3390/f13101645
Costa GFd, Cabral PDS, Silva FG, Rubio Neto A, Mendonça MAC. Clonal Fidelity and Genetic Diversity of Micropropagated Hancornia speciosa Gomes (Apocynaceae) as Evaluated by Molecular Markers. Forests. 2022; 13(10):1645. https://doi.org/10.3390/f13101645
Chicago/Turabian StyleCosta, Géssica Ferreira da, Pablo Diego Silva Cabral, Fabiano Guimarães Silva, Aurélio Rubio Neto, and Maria Andréia Corrêa Mendonça. 2022. "Clonal Fidelity and Genetic Diversity of Micropropagated Hancornia speciosa Gomes (Apocynaceae) as Evaluated by Molecular Markers" Forests 13, no. 10: 1645. https://doi.org/10.3390/f13101645
APA StyleCosta, G. F. d., Cabral, P. D. S., Silva, F. G., Rubio Neto, A., & Mendonça, M. A. C. (2022). Clonal Fidelity and Genetic Diversity of Micropropagated Hancornia speciosa Gomes (Apocynaceae) as Evaluated by Molecular Markers. Forests, 13(10), 1645. https://doi.org/10.3390/f13101645

