Influence of Selected Carbon Nanostructures on the CYP2C9 Enzyme of the P450 Cytochrome
Abstract
:1. Introduction
2. Materials and Methods
2.1. Nanostructures
2.2. Visualization and Physicochemical Properties of Nanostructures
2.3. CYP450 Microsomal Model
2.4. Cell Culture
2.5. Cell Viability
2.6. Quantitative Real-Time PCR
2.6.1. RNA Isolation
2.6.2. cDNA Synthesis
2.6.3. Gene Expression
2.7. Western Blot
2.7.1. Protein Isolation
2.7.2. Western Blot Analysis
2.8. Statistical Analysis
3. Results
3.1. Physicochemical Properties of DN, GN and GO
3.2. Catalytic Activity and Inhibition of the CYP2C9 Isoenzyme in the Presence of Increasing Concentrations of DN, GN and GO
3.3. Cell Viability
3.4. CYP2C9 Gene Expression at the mRNA and Protein Levels
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Teradal, N.L.; Jelinek, R. Carbon Nanomaterials in Biological Studies and Biomedicine. Adv. Healthc. Mater. 2017, 6, 1–36. [Google Scholar] [CrossRef] [PubMed]
- Singh, Z. Applications and toxicity of graphene family nanomaterials and their composites. Nanotechnol. Sci. Appl. 2016, 9, 15–28. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, H.; Zhang, L.; Yan, M.; Yu, J. Carbon nanostructures in biology and medicine. J. Mater. Chem. B 2017, 5, 6437–6450. [Google Scholar] [CrossRef]
- Angelopoulou, A.; Voulgari, E.; Diamanti, E.K.; Gournis, D.; Avgoustakis, K. Graphene oxide stabilized by PLA-PEG copolymers for the controlled delivery of paclitaxel. Eur. J. Pharm. Biopharm. 2015, 93, 18–26. [Google Scholar] [CrossRef] [PubMed]
- Kim, B.-S.; La, W.-G.; Jin, M.; Park, S.; Yoon, H.-H.; Jeong, G.-J.; Bhang, S.H.; Park, H.; Char, K. Delivery of bone morphogenetic protein-2 and substance P using graphene oxide for bone regeneration. Int. J. Nanomed. 2014, 9, 107. [Google Scholar] [CrossRef] [Green Version]
- Yim, D.B.; Kang, H.; Jeon, S.J.; Kim, H.I.; Yang, J.K.; Kang, T.W.; Lee, S.; Choo, J.; Lee, Y.S.; Kim, J.W.; et al. Graphene oxide-encoded Ag nanoshells with single-particle detection sensitivity towards cancer cell imaging based on SERRS. Analyst 2015, 140, 3362–3367. [Google Scholar] [CrossRef]
- Kurantowicz, N.; Strojny, B.; Sawosz, E.; Jaworski, S.; Kutwin, M.; Grodzik, M.; Wierzbicki, M.; Lipińska, L.; Mitura, K.; Chwalibog, A. Biodistribution of a High Dose of Diamond, Graphite, and Graphene Oxide Nanoparticles After Multiple Intraperitoneal Injections in Rats. Nanoscale Res. Lett. 2015, 10, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Strojny, B.; Kurantowicz, N.; Sawosz, E.; Grodzik, M.; Jaworski, S.; Kutwin, M.; Wierzbicki, M.; Hotowy, A.; Lipińska, L.; Chwalibog, A. Long Term Influence of Carbon Nanoparticles on Health and Liver Status in Rats. PLoS ONE 2015, 10, e0144821. [Google Scholar] [CrossRef] [Green Version]
- Guengerich, F.P.; Waterman, M.R.; Egli, M. Recent Structural Insights into Cytochrome P450 Function. Trends Pharmacol. Sci. 2016, 25, 289–313. [Google Scholar] [CrossRef] [Green Version]
- Munro, A.W.; Girvan, H.M.; Mason, A.E.; Dunford, A.J.; McLean, K.J. What makes a P450 tick? Trends Biochem. Sci. 2013, 38, 140–150. [Google Scholar] [CrossRef]
- Nair, P.C.; McKinnon, R.A.; Miners, J.O. Cytochrome P450 structure–function: Insights from molecular dynamics simulations. Drug Metab. Rev. 2016, 48, 434–452. [Google Scholar] [CrossRef]
- Bernhardt, R. Cytochromes P450 as versatile biocatalysts. J. Biotechnol. 2006, 124, 128–145. [Google Scholar] [CrossRef]
- Penner, N.; Woodward, C.; Prakash, C. Drug Metabolizing Enzymes and Biotransformation Reactions. ADME-Enabling Technol. Drug Des. Dev. 2012, 545–565. [Google Scholar]
- Gray, I.C.; Nobile, C.; Muresu, R.; Ford, S.; Spurr, N.K. A 2.4-megabase physical map spanning the CYP2C gene cluster on chromosome 10q24. Genomics 1995, 28, 328–332. [Google Scholar] [CrossRef]
- Niwa, T.; Yamazaki, H. Comparison of Cytochrome P450 2C Subfamily Members in Terms of Drug Oxidation Rates and Substrate Inhibition. Curr. Drug Metab. 2012, 13, 1145–1159. [Google Scholar] [CrossRef]
- Anzenbacher, P.; Anzenbacherová, E. Review: Cellular and Molecular Life Sciences Cytochromes P450 and metabolism of xenobiotics. Cell. Mol. Life Sci. 2001, 58, 737–747. [Google Scholar] [CrossRef]
- Gerbal-chaloin, S.; Pascussi, J.; Pichard-garcia, L.; Daujat, M.; Waechter, F.; Fabre, J.; Ere, N.C.; Maurel, P. Induction of Cyp2C Genes in Human Hepatocytes in Primary Culture. Drug Metab. Dispos. 2009, 29, 1–10. [Google Scholar]
- Zanger, U.M.; Schwab, M. Cytochrome P450 enzymes in drug metabolism: Regulation of gene expression, enzyme activities, and impact of genetic variation. Pharmacol. Ther. 2013, 138, 103–141. [Google Scholar] [CrossRef]
- Thijssen, H.H.; Flinois, J.P.; Beaune, P.H. Cytochrome P4502C9 is the principal catalyst of racemic acenocoumarol hydroxylation reactions in human liver microsomes. Drug Metab. Dispos. 2000, 28, 1284–1290. [Google Scholar]
- Ufer, M.; Svensson, J.O.; Krausz, K.W.; Gelboin, H.V.; Rane, A.; Tybring, G. Identification of cytochromes P450 2C9 and 3A4 as the major catalysts of phenprocoumon hydroxylation in vitro. Eur. J. Clin. Pharmacol. 2004, 60, 173–182. [Google Scholar] [CrossRef]
- Daly, A.K.; Rettie, A.E.; Fowler, D.M.; Miners, J.O. Pharmacogenomics of CYP2C9: Functional and clinical considerations. J. Pers. Med. 2018, 8, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kulthong, K.; Maniratanachote, R.; Kobayashi, Y.; Fukami, T.; Yokoi, T. Effects of silver nanoparticles on rat hepatic cytochrome P450 enzyme activity. Xenobiotica 2012, 42, 854–862. [Google Scholar] [CrossRef] [PubMed]
- Tang, H.Q.; Xu, M.; Rong, Q.; Jin, R.W.; Liu, Q.J.; Li, Y.L. The effect of ZnO nanoparticles on liver function in rats. Int. J. Nanomed. 2016, 11, 4275–4285. [Google Scholar]
- Fröhlich, E.; Kueznik, T.; Samberger, C.; Roblegg, E.; Wrighton, C.; Pieber, T.R. Size-dependent effects of nanoparticles on the activity of cytochrome P450 isoenzymes. Toxicol. Appl. Pharmacol. 2010, 242, 326–332. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y.; Ong, C.E.; Pung, Y.F.; Chieng, J.Y. The current understanding of the interactions between nanoparticles and cytochrome P450 enzymes—A literature-based review. Xenobiotica 2019, 49, 863–876. [Google Scholar] [CrossRef]
- Kurantowicz, N.; Sawosz, E.; Halik, G.; Strojny, B.; Hotowy, A.; Grodzik, M.; Piast, R.; Pasanphan, W.; Chwalibog, A. Toxicity Studies of Six Types of Carbon Nanoparticles in a Chicken-Embryo Model. Int. J. Nanomed. 2017, 12, 2887–2898. [Google Scholar] [CrossRef] [Green Version]
- Wierzbicki, M.; Sawosz, E.; Strojny, B.; Jaworski, S.; Grodzik, M.; Chwalibog, A. NF-ΚB-Related Decrease of Glioma Angiogenic Potential by Graphite Nanoparticles and Graphene Oxide Nanoplatelets. Sci. Rep. 2018, 8, 14733. [Google Scholar] [CrossRef] [Green Version]
- Grodzik, M.; Szczepaniak, J.; Strojny-Cieslak, B.; Hotowy, A.; Wierzbicki, M.; Jaworski, S.; Kutwin, M.; Soltan, E.; Mandat, T.; Lewicka, A.; et al. Diamond Nanoparticles Downregulate Expression of CycD and Cyce in Glioma Cells. Molecules 2019, 24, 1549. [Google Scholar] [CrossRef] [Green Version]
- Majchrzycki, L.; Augustyniak-Jabłokow, M.A.; Strzelczyk, R.; Maćkowiak, M. Magnetic Centres in Functionalized Graphene. Acta Phys. Pol. A 2015, 127, 540–542. [Google Scholar] [CrossRef]
- Wang, D.; Jiang, Z.; Shen, Z.; Wang, H.; Wang, B.; Shou, W.; Zheng, H.; Chu, X.; Shi, J.; Huang, W. Functional evaluation of genetic and environmental regulators of P450 mRNA levels. PLoS ONE 2011, 6, e24900. [Google Scholar] [CrossRef] [Green Version]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An Open-Source Platform for Biological-Image Analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ai, J.; Biazar, E.; Jafarpour, M.; Montazeri, M.; Majdi, A.; Aminifard, S.; Zafari, M.; Akbari, H.R.; Rad, H.G. Nanotoxicology and nanoparticle safety in biomedical designs. Int. J. Nanomed. 2011, 6, 1117–1127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hariparsad, N.; Sane, R.S.; Strom, S.C.; Desai, P.B. In vitro methods in human drug biotransformation research: Implications for cancer chemotherapy. Toxicol. In Vitro 2006, 20, 135–153. [Google Scholar] [CrossRef] [PubMed]
- Strojny, B.; Sawosz, E.; Grodzik, M.; Jaworski, S.; Szczepaniak, J.; Sosnowska, M.; Wierzbicki, M.; Kutwin, M.; Orlińska, S.; Chwalibog, A. Nanostructures of diamond, graphene oxide and graphite inhibit CYP1A2, CYP2D6 and CYP3A4 enzymes and downregulate their genes in liver cells. Int. J. Nanomed. 2018, 13, 8561–8575. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Jensen, U.B.; Jensen, G.V.; Shipovskov, S.; Balakrishnan, V.S.; Otzen, D.; Pedersen, J.S.; Besenbacher, F.; Sutherland, D.S. Soft interactions at nanoparticles alter protein function and conformation in a size dependent manner. Nano Lett. 2011, 11, 4985–4991. [Google Scholar] [CrossRef] [PubMed]
- Sanfins, E.; Dairou, J.; Hussain, S.; Busi, F.; Chaffotte, A.F.; Rodrigues-Lima, F.; Dupret, J.M. Carbon black nanoparticles impair acetylation of aromatic amine carcinogens through inactivation of arylamine N-acetyltransferase enzymes. ACS Nano 2011, 5, 4504–4511. [Google Scholar] [CrossRef]
- Chen, M.; Zeng, G.; Xu, P.; Lai, C.; Tang, L. How Do Enzymes ‘Meet’ Nanoparticles and Nanomaterials? Trends Biochem. Sci. 2017, 42, 914–930. [Google Scholar] [CrossRef]
- Mao, H.Y.; Laurent, S.; Chen, W.; Akhavan, O.; Imani, M.; Ashkarran, A.A.; Mahmoudi, M. Graphene: Promises, facts, opportunities, and challenges in nanomedicine. Chem. Rev. 2013, 113, 3407–3424. [Google Scholar] [CrossRef]
- Lerf, A.; He, H.; Forster, M.; Klinowski, J. Structure of Graphite Oxide Revisited. J. Phys. Chem. B 1998, 102, 4477–4482. [Google Scholar] [CrossRef]
- Han, X.; Li, S.; Peng, Z.; Al-Yuobi, A.O.; Omar Bashammakh, A.S.; El-Shahawi, M.S.; Leblanc, R.M. Interactions between Carbon Nanomaterials and Biomolecules. J. Oleo Sci. 2015, 65, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Ye, M.; Tang, L.; Luo, M.; Zhou, J.; Guo, B.; Liu, Y.; Chen, B. Size- and time-dependent alteration in metabolic activities of human hepatic cytochrome P450 isozymes by gold nanoparticles via microsomal coincubations. Nanoscale Res. Lett. 2014, 9, 1–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Denisov, I.G.; Makris, T.M.; Sligar, S.G.; Schlichting, I. Structure and Chemistry of Cytochrome P450. Chem. Rev. 2005, 105, 2253–2278. [Google Scholar] [CrossRef] [PubMed]
- Zakrzewska, K.E.; Samluk, A.; Wierzbicki, M.; Jaworski, S.; Kutwin, M.; Sawosz, E.; Chwalibog, A.; Pijanowska, D.G.; Pluta, K.D. Analysis of the cytotoxicity of carbon-based nanoparticles, diamond and graphite, in human glioblastoma and hepatoma cell lines. PLoS ONE 2015, 10, e0122579. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Berger, B.; Donzelli, M.; Maseneni, S.; Boess, F.; Roth, A.; Krähenbühl, S.; Haschke, M. Comparison of Liver Cell Models Using the Basel Phenotyping Cocktail. Front. Pharmacol. 2016, 7, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hewitt, N.J.; Lechón, M.J.G.; Houston, J.B.; Hallifax, D.; Brown, H.S.; Maurel, P.; Kenna, J.G.; Gustavsson, L.; Lohmann, C.; Skonberg, C.; et al. Primary hepatocytes: Current understanding of the regulation of metabolic enzymes and transporter proteins, and pharmaceutical practice for the use of hepatocytes in metabolism, enzyme induction, transporter, clearance, and hepatotoxicity studies. Drug Metab. Rev. 2007, 39, 159–234. [Google Scholar] [CrossRef]
- Tang, C.; Lin, J.H.; Lu, A.Y.H. Metabolism-based drug-drug interactions: What determines individual variability in cytochrome P450 induction? Drug Metab. Dispos. 2005, 33, 603–613. [Google Scholar] [CrossRef]
- Fuhr, U. Induction of drug metabolising enzymes. Pharmacokinetic and toxicological consequences in humans. Clin. Pharm. 2000, 38, 493–504. [Google Scholar] [CrossRef]
- Ehman, E.C.; Johnson, G.B.; Villanueva-meyer, J.E.; Cha, S.; Leynes, A.P.; Eric, P.; Larson, Z.; Hope, T.A. Biological Interactions of Carbon-Based Nanomaterials: From Coronation to Degradation. Nanomedicine 2017, 46, 1247–1262. [Google Scholar]
- Duan, G.; Kang, S.G.; Tian, X.; Garate, J.A.; Zhao, L.; Ge, C.; Zhou, R. Protein corona mitigates the cytotoxicity of graphene oxide by reducing its physical interaction with cell membrane. Nanoscale 2015, 7, 15214–15224. [Google Scholar] [CrossRef] [Green Version]
- Chong, Y.; Ge, C.; Yang, Z.; Garate, J.A.; Gu, Z.; Weber, J.K.; Liu, J.; Zhou, R. Reduced Cytotoxicity of Graphene Nanosheets Mediated by Blood-Protein Coating. ACS Nano 2015, 9, 5713–5724. [Google Scholar] [CrossRef]
- Hu, W.; Peng, C.; Lv, M.; Li, X.; Zhang, Y.; Chen, N.; Fan, C.; Huang, Q. Protein corona-mediated mitigation of cytotoxicity of graphene oxide. ACS Nano 2011, 5, 3693–3700. [Google Scholar] [CrossRef] [PubMed]
- Rahmati, M.; Mozafari, M. Biological Response to Carbon-Family Nanomaterials: Interactions at the Nano-Bio Interface. Front. Bioeng. Biotechnol. 2019, 7, 1–22. [Google Scholar] [CrossRef] [PubMed]
- Hitoshi, K.; Katoh, M.; Suzuki, T.; Ando, Y.; Nadai, M. Changes in expression of drug-metabolizing enzymes by single-walled carbon nanotubes in human respiratory tract cells. Drug Metab. Dispos. 2012, 40, 579–587. [Google Scholar] [CrossRef] [PubMed]
- Xu, C.; Li, C.Y.-T.; Kong, A.-N.T. Induction of Phase I, II and III Drug Metabolism/Transport by Xenobiotics. Arch. Pharm. Res. 2005, 28, 249–268. [Google Scholar] [CrossRef] [PubMed]
- Rosemary, J.; Adithan, C. The Pharmacogenetics of CYP2C9 and CYP2C19: Ethnic Variation and Clinical Significance. Curr. Clin. Pharmacol. 2008, 2, 93–109. [Google Scholar] [CrossRef] [PubMed]
- García-Martín, E.; Martínez, C.; Ladero, J.M.; Agúndez, J.A.G. Interethnic and intraethnic variability of CYP2C8 and CYP2C9 polymorphisms in healthy individuals. Mol. Diagn. Ther. 2006, 10, 29–40. [Google Scholar] [CrossRef] [PubMed]
- Jonas, D.E.; McLeod, H.L. Genetic and clinical factors relating to warfarin dosing. Trends Pharmacol. Sci. 2009, 30, 375–386. [Google Scholar] [CrossRef]
Gene | Primer Sequence 5′→3′ | PCR Product (bp) | Reference |
---|---|---|---|
CYP2C9 | F: CTCTCTTTCCTCTGGGGCATT R: GGAAACTCTCCGTAATGGAGGTC | 124 | [30] |
GAPDH | F: GAGAAGGCTGGGGCTCATTTG R: CATGGTTCACACCCATGACGA | 97 | PrimerBlast |
Nanostructure | Zeta Potential (mV) | Average Hydrodynamic Diameter DLS (nm) | Size TEM (nm) | |||
---|---|---|---|---|---|---|
Concentration (mg/L) | 3.13 | 6.25 | 50 | 100 | - | |
DN | −24.27 | −32.40 | −27.93 | −31.0 | 209.53 | 3–4 |
GN | 18.23 | 22.53 | 21.34 | 24.40 | 619.33 | 4–8 |
GO | −48.8 | −49.67 | −53.87 | −57.20 | 1747.00 | >1000 |
Nanostructure | FC 1 | Log2FC |
---|---|---|
DN | 0.334 | −1.580 |
GN | 0.525 | −0.929 |
GO | 1.073 | 0.102 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sekretarska, J.; Szczepaniak, J.; Sosnowska, M.; Grodzik, M.; Kutwin, M.; Wierzbicki, M.; Jaworski, S.; Bałaban, J.; Daniluk, K.; Sawosz, E.; et al. Influence of Selected Carbon Nanostructures on the CYP2C9 Enzyme of the P450 Cytochrome. Materials 2019, 12, 4149. https://doi.org/10.3390/ma12244149
Sekretarska J, Szczepaniak J, Sosnowska M, Grodzik M, Kutwin M, Wierzbicki M, Jaworski S, Bałaban J, Daniluk K, Sawosz E, et al. Influence of Selected Carbon Nanostructures on the CYP2C9 Enzyme of the P450 Cytochrome. Materials. 2019; 12(24):4149. https://doi.org/10.3390/ma12244149
Chicago/Turabian StyleSekretarska, Justyna, Jarosław Szczepaniak, Malwina Sosnowska, Marta Grodzik, Marta Kutwin, Mateusz Wierzbicki, Sławomir Jaworski, Jaśmina Bałaban, Karolina Daniluk, Ewa Sawosz, and et al. 2019. "Influence of Selected Carbon Nanostructures on the CYP2C9 Enzyme of the P450 Cytochrome" Materials 12, no. 24: 4149. https://doi.org/10.3390/ma12244149