Evaluation of a Cell-Free Collagen Type I-Based Scaffold for Articular Cartilage Regeneration in an Orthotopic Rat Model
Abstract
:1. Introduction
2. Results
2.1. 3D Scaffold Characterization before Implantation
2.2. Morphological Evaluation of Explanted Femurs
2.3. Ex Vivo Evaluation of Cartilage Regeneration
3. Discussion
4. Materials and Methods
4.1. Scaffold Features
4.2. Breeding and Housing of Animals, Experimental Design and Surgery Procedure
4.3. Histology Analysis
- The type of repaired tissue on the lesion surface (cartilaginous, fibrous or calcified);
- Capability of the collagen I-based scaffold to recruit host cells and promote cartilaginous matrix deposition;
- The scaffold biocompatibility and reabsorption of the collagen I-based scaffold.
4.4. Analysis of sGAGs by Histochemistry
4.5. Immunohistochemistry (IHC) Analysis
4.6. Computerized Morphometric Measurements and Image Analysis
4.7. Quantitative Real-Time Polymerase Chain Reaction (q-PCR)
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Karuppal, R. Current concepts in the articular cartilage repair and regeneration. J. Orthop. 2017, 14, A1–A3. [Google Scholar] [CrossRef] [PubMed]
- Di Rosa, M.; Szychlinska, M.; Tibullo, D.; Malaguarnera, M.; Musumeci, G. Expression of CHI3L1 and CHIT1 in Osteoarthritic Rat Cartilage Model. A Morphological Study. Eur. J. Histochem. 2014, 58, 2423. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Szychlinska, M.A.; Trovato, F.M.; Di Rosa, M.; Malaguarnera, L.; Puzzo, L.; Leonardi, R.; Castrogiovanni, P.; Musumeci, G. Co-Expression and Co-Localization of Cartilage Glycoproteins CHI3L1 and Lubricin in Osteoarthritic Cartilage: Morphological, Immunohistochemical and Gene Expression Profiles. Int. J. Mol. Sci. 2016, 17, 359. [Google Scholar] [CrossRef] [PubMed]
- Redondo, M.; Beer, A.; Yanke, A. Cartilage Restoration: Microfracture and Osteochondral Autograft Transplantation. J. Knee Surg. 2018, 31, 231–238. [Google Scholar] [CrossRef]
- Richter, D.; Schenck, R.C.; Wascher, D.C.; Treme, G. Knee Articular Cartilage Repair and Restoration Techniques: A Review of the Literature. Sports Health 2015, 8, 153–160. [Google Scholar] [CrossRef] [Green Version]
- Armiento, A.R.; Stoddart, M.; Alini, M.; Eglin, D. Biomaterials for articular cartilage tissue engineering: Learning from biology. Acta Biomater. 2018, 65, 1–20. [Google Scholar] [CrossRef]
- Sharma, P.; Kumar, P.; Sharma, R.; Bhatt, V.D.; Dhot, P.S. Tissue Engineering; Current Status & Futuristic Scope. J. Med. Life 2019, 12, 225–229. [Google Scholar] [CrossRef]
- Eftekharid, A.; Dizaj, S.M.; Sharifi, S.; Salatin, S.; Saadat, Y.R.; Vahed, S.Z.; Samiei, M.; Ardalan, M.R.; Rameshrad, M.; Ahmadian, E.; et al. The Use of Nanomaterials in Tissue Engineering for Cartilage Regeneration; Current Approaches and Future Perspectives. Int. J. Mol. Sci. 2020, 21, 536. [Google Scholar] [CrossRef] [Green Version]
- Huang, B.J.; Hu, J.C.; Athanasiou, K.A. Cell-based tissue engineering strategies used in the clinical repair of articular cartilage. Biomaterials 2016, 98, 1–22. [Google Scholar] [CrossRef] [Green Version]
- Kwan, H.; Chisari, E.; Khan, W.S. Cell-Free Scaffolds as a Monotherapy for Focal Chondral Knee Defects. Materials 2020, 13, 306. [Google Scholar] [CrossRef] [Green Version]
- Campos, Y.; Almirall, A.; Fuentes, G.; Bloem, H.L.; Kaijzel, E.L.; Cruz, L.J. Tissue Engineering: An Alternative to Repair Cartilage. Tissue Eng. Part B Rev. 2019, 25, 357–373. [Google Scholar] [CrossRef] [PubMed]
- Szychlinska, M.A.; D’Amora, U.; Ravalli, S.; Ambrosio, L.; Di Rosa, M.; Musumeci, G. Functional Biomolecule Delivery Systems and Bioengineering in Cartilage Regeneration. Curr. Pharm. Biotechnol. 2019, 20, 32–46. [Google Scholar] [CrossRef] [PubMed]
- Im, G. Biomaterials in orthopaedics: The past and future with immune modulation. Biomater. Res. 2020, 24, 7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dai, Y.; Shen, T.; Ma, L.; Wang, D.-A.; Gaoa, C. Regeneration of osteochondral defects in vivo by a cell-free cylindrical poly(lactide-co-glycolide) scaffold with a radially oriented microstructure. J. Tissue Eng. Regen. Med. 2017, 12, 1647–1661. [Google Scholar] [CrossRef] [PubMed]
- Szychlinska, M.; Castrogiovanni, P.; Nsir, H.; Di Rosa, M.; Guglielmino, C.; Parenti, R.; Calabrese, G.; Pricoco, E.; Salvatorelli, L.; Magro, G.; et al. Engineered cartilage regeneration from adipose tissue derived-mesenchymal stem cells: A morphomolecular study on osteoblast, chondrocyte and apoptosis evaluation. Exp. Cell Res. 2017, 357, 222–235. [Google Scholar] [CrossRef]
- Dang, J.; Leong, K.W. Natural polymers for gene delivery and tissue engineering. Adv. Drug Deliv. Rev. 2006, 58, 487–499. [Google Scholar] [CrossRef]
- Gavenis, K.; Schneider, U.; Maus, U.; Mumme, T.; Muller-Rath, R.; Schmidt-Rohlfing, B.; Andereya, S. Cell-free repair of small cartilage defects in the Goettinger minipig: Which defect size is possible? Knee Surg. Sports Traumatol. Arthrosc. 2011, 20, 2307–2314. [Google Scholar] [CrossRef]
- Efe, T.; Theisen, C.; Fuchs-Winkelmann, S.; Stein, T.; Getgood, A.; Rominger, M.B.; Paletta, J.R.J.; Schofer, M.D. Cell-free collagen type I matrix for repair of cartilage defects—Clinical and magnetic resonance imaging results. Knee Surg. Sports Traumatol. Arthrosc. 2011, 20, 1915–1922. [Google Scholar] [CrossRef]
- Schüttler, K.F.; Schenker, H.; Theisen, C.; Schofer, M.D.; Getgood, A.; Roessler, P.P.; Struewer, J.; Rominger, M.B.; Efe, T. Use of cell-free collagen type I matrix implants for the treatment of small cartilage defects in the knee: Clinical and magnetic resonance imaging evaluation. Knee Surg. Sports Traumatol. Arthrosc. 2013, 22, 1270–1276. [Google Scholar] [CrossRef]
- Roessler, P.P.; Pfister, B.; Gesslein, M.; Figiel, J.; Heyse, T.J.; Colcuc, C.; Lorbach, O.; Efe, T.; Schüttler, K.F. Short-term follow up after implantation of a cell-free collagen type I matrix for the treatment of large cartilage defects of the knee. Int. Orthop. 2015, 39, 2473–2479. [Google Scholar] [CrossRef]
- Irawan, V.; Sung, T.-C.; Higuchi, A.; Ikoma, T. Collagen Scaffolds in Cartilage Tissue Engineering and Relevant Approaches for Future Development. Tissue Eng. Regen. Med. 2018, 15, 673–697. [Google Scholar] [CrossRef] [PubMed]
- Calabrese, G.; Forte, S.; Gulino, R.; Cefalì, F.; Figallo, E.; Salvatorelli, L.; Maniscalchi, E.T.; Angelico, G.; Parenti, R.; Gulisano, M.; et al. Combination of Collagen-Based Scaffold and Bioactive Factors Induces Adipose-Derived Mesenchymal Stem Cells Chondrogenic Differentiation In vitro. Front. Physiol. 2017, 8, 50. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Calabrese, G.; Gulino, R.; Giuffrida, R.; Forte, S.; Figallo, E.; Fabbi, C.; Salvatorelli, L.; Memeo, L.; Gulisano, M.; Parenti, R. In Vivo Evaluation of Biocompatibility and Chondrogenic Potential of a Cell-Free Collagen-Based Scaffold. Front. Physiol. 2017, 8, 984. [Google Scholar] [CrossRef]
- Lefebvre, V.; Dvir-Ginzberg, M. SOX9 and the many facets of its regulation in the chondrocyte lineage. Connect. Tissue Res. 2016, 58, 2–14. [Google Scholar] [CrossRef] [PubMed]
- Deponti, D.; Di Giancamillo, A.; Gervaso, F.; Domenicucci, M.; Domeneghini, C.; Sannino, A.; Peretti, G.M. Collagen Scaffold for Cartilage Tissue Engineering: The Benefit of Fibrin Glue and the Proper Culture Time in an Infant Cartilage Model. Tissue Eng. Part A 2014, 20, 1113–1126. [Google Scholar] [CrossRef] [PubMed]
- Omori, K.; Nakamura, T.; Kanemaru, S.; Magrufov, A.; Yamashita, M.; Shimizu, Y. In Situ Tissue Engineering of the Cricoid and Trachea in a Canine Model. Ann. Otol. Rhinol. Laryngol. 2008, 117, 609–613. [Google Scholar] [CrossRef] [PubMed]
- Calabrese, G.; Giuffrida, R.; Forte, S.; Salvatorelli, L.; Fabbi, C.; Figallo, E.; Gulisano, M.; Parenti, R.; Magro, G.; Colarossi, C.; et al. Bone augmentation after ectopic implantation of a cell-free collagen-hydroxyapatite scaffold in the mouse. Sci. Rep. 2016, 6, 36399. [Google Scholar] [CrossRef] [Green Version]
- Calabrese, G.; Giuffrida, R.; Forte, S.; Fabbi, C.; Figallo, E.; Salvatorelli, L.; Memeo, L.; Parenti, R.; Gulisano, M.; Gulino, R. Human adipose-derived mesenchymal stem cells seeded into a collagen-hydroxyapatite scaffold promote bone augmentation after implantation in the mouse. Sci. Rep. 2017, 7, 7110. [Google Scholar] [CrossRef]
- Lefebvre, V.; Angelozzi, M.; Haseeb, A. SOX9 in cartilage development and disease. Curr. Opin. Cell Biol. 2019, 61, 39–47. [Google Scholar] [CrossRef]
- Akiyama, H.; Kim, J.E.; Nakashima, K.; Balmes, G.; Iwai, N.; Deng, J.M.; Zhang, Z.; Martin, J.F.; Behringer, R.R.; Nakamura, T.; et al. Osteo-chondroprogenitor cells are derived from Sox9 expressing precursors. Proc. Natl. Acad. Sci. USA 2005, 102, 14665–14670. [Google Scholar] [CrossRef] [Green Version]
- Jin, G.Z.; Kim, H.W. Chondrogenic Potential of Dedifferentiated Rat Chondrocytes Reevaluated in Two- and Three-Dimensional Culture Conditions. Tissue Eng. Regen. Med. 2017, 15, 163–172. [Google Scholar] [CrossRef] [PubMed]
- Ng, J.; Wei, Y.; Zhou, B.; Burapachaisri, A.; Guo, X.E.; Vunjak-Novakovic, G. Extracellular matrix components and culture regimen selectively regulate cartilage formation by self-assembling human mesenchymal stem cells in vitro and in vivo. Stem Cell Res. Ther. 2016, 7, 183. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Estes, B.; Guilak, F. Three-Dimensional Culture Systems to Induce Chondrogenesis of Adipose-Derived Stem Cells. Breast Cancer 2011, 702, 201–217. [Google Scholar] [CrossRef] [Green Version]
- Liu, C.F.; Angelozzi, M.; Haseeb, A.; Lefebvre, V. SOX9 is dispensable for the initiation of epigenetic remodeling and the activation of marker genes at the onset of chondrogenesis. Development 2018, 145, 164459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, L.; Gao, C.; Mao, Z.; Zhou, J.; Shen, J.; Hu, X.; Han, C. Collagen/chitosan porous scaffolds with improved biostability for skin tissue engineering. Biomaterials 2003, 24, 4833–4841. [Google Scholar] [CrossRef]
- She, H.; Xiao, X.; Liu, R. Preparation and characterization of polycaprolactone-chitosan composites for tissue engineering applications. J. Mater. Sci. 2007, 42, 8113–8119. [Google Scholar] [CrossRef]
- Szychlinska, M.A.; Castrogiovanni, P.; Trovato, F.M.; Nsir, H.; Zarrouk, M.; Furno, D.L.; Di Rosa, M.; Imbesi, R.; Musumeci, G. Physical activity and Mediterranean diet based on olive tree phenolic compounds from two different geographical areas have protective effects on early osteoarthritis, muscle atrophy and hepatic steatosis. Eur. J. Nutr. 2018, 58, 565–581. [Google Scholar] [CrossRef]
- Szychlinska, M.; Imbesi, R.; Castrogiovanni, P.; Guglielmino, C.; Ravalli, S.; Di Rosa, M.; Musumeci, G. Assessment of Vitamin D Supplementation on Articular Cartilage Morphology in a Young Healthy Sedentary Rat Model. Nutrients 2019, 11, 1260. [Google Scholar] [CrossRef] [Green Version]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.G.; Madden, T. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Szychlinska, M.A.; Calabrese, G.; Ravalli, S.; Parrinello, N.L.; Forte, S.; Castrogiovanni, P.; Pricoco, E.; Imbesi, R.; Castorina, S.; Leonardi, R.; et al. Cycloastragenol as an Exogenous Enhancer of Chondrogenic Differentiation of Human Adipose-Derived Mesenchymal Stem Cells. A Morphological Study. Cells 2020, 9, 347. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Castrogiovanni, P.; Di Rosa, M.; Ravalli, S.; Castorina, A.; Guglielmino, C.; Imbesi, R.; Vecchio, M.; Drago, F.; Szychlinska, M.A.; Musumeci, G. Moderate Physical Activity as a Prevention Method for Knee Osteoarthritis and the Role of Synoviocytes as Biological Key. Int. J. Mol. Sci. 2019, 20, 511. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Study Groups | Time Points | Number of Rats |
---|---|---|
CTRL | 4, 8, 16 weeks | n. 9 (3 × each time point) |
ACL (only lesion) | 4, 8, 16 weeks | n. 9 (3 × each time point) |
ACL-S (lesion + scaffold) | 4, 8, 16 weeks | n. 9 (3 × each time point) |
Target Gene | Forward | Reverse |
---|---|---|
COL1A1 | CCGGAAACAGACAAGCAACCCAAA | AAAGGAGCAGAAAGGGCAGCATTG |
COL2A1 | TGGTCTTGGTGGAAACTTTGCTGC | AGGTTCACCAGGTTCACCAGGATT |
Aggrecan | TGTGGTGATGATCTGGCACGAGAA | CGGCGGACAAATTAGATGCGGTT |
Sox9 | AACAACCCGTCTACACACAGCTCA | TGGGTAATGCGCTTGGATAGGTCA |
TuBB4a | GACGTGAGTACTGCTCCGC | CTTGCAGGTGCACGATTTCC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szychlinska, M.A.; Calabrese, G.; Ravalli, S.; Dolcimascolo, A.; Castrogiovanni, P.; Fabbi, C.; Puglisi, C.; Lauretta, G.; Di Rosa, M.; Castorina, A.; et al. Evaluation of a Cell-Free Collagen Type I-Based Scaffold for Articular Cartilage Regeneration in an Orthotopic Rat Model. Materials 2020, 13, 2369. https://doi.org/10.3390/ma13102369
Szychlinska MA, Calabrese G, Ravalli S, Dolcimascolo A, Castrogiovanni P, Fabbi C, Puglisi C, Lauretta G, Di Rosa M, Castorina A, et al. Evaluation of a Cell-Free Collagen Type I-Based Scaffold for Articular Cartilage Regeneration in an Orthotopic Rat Model. Materials. 2020; 13(10):2369. https://doi.org/10.3390/ma13102369
Chicago/Turabian StyleSzychlinska, Marta Anna, Giovanna Calabrese, Silvia Ravalli, Anna Dolcimascolo, Paola Castrogiovanni, Claudia Fabbi, Caterina Puglisi, Giovanni Lauretta, Michelino Di Rosa, Alessandro Castorina, and et al. 2020. "Evaluation of a Cell-Free Collagen Type I-Based Scaffold for Articular Cartilage Regeneration in an Orthotopic Rat Model" Materials 13, no. 10: 2369. https://doi.org/10.3390/ma13102369