Strontium-Substituted Bioceramics Particles: A New Way to Modulate MCP-1 and Gro-α Production by Human Primary Osteoblastic Cells
Abstract
:1. Introduction
2. Results
2.1. CCL2 (MCP-1) and CXCL1 (Gro-α) Expression and Synthesis in Basal Conditions
2.2. Modulation of CCL2 (MCP-1) and CXCL1 (Gro-α) Expression and Synthesis by Human Primary Bone Cells after CaP Particles Contact
2.3. Cytokine Production and the Effect of Biphasic Calcium-Phosphate Particles
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Cells
4.3. Biomaterials
4.4. RNA Purification and Reverse-Transcription
4.5. Real Time PCR Primer Design and Efficiency Determination
4.6. Enzyme-Linked Immunosorbent Assay (ELISA)
4.7. Antibody Cytokine Arrays
4.8. Statistics
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Woo, K.M.; Yu, B.; Jung, H.-M.; Lee, Y.-K. Comparative evaluation of different crystal-structured calcium sulfates as bone-filling materials. J. Biomed. Mater. Res. Part B Appl. Biomater. 2009, 91, 545–554. [Google Scholar] [CrossRef] [PubMed]
- LeGeros, R.Z. Properties of osteoconductive biomaterials: Calcium phosphates. Clin. Orthop. Relat. Res. 2002, 395, 81–98. [Google Scholar] [CrossRef]
- Sun, L.; Berndt, C.C.; Gross, K.A.; Kucuk, A. Material fundamentals and clinical performance of plasma-sprayed hydroxyapatite coatings: A review. J. Biomed. Mater. Res. 2001, 58, 570–592. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Kim, K.-H.; Ong, J.L. A review on calcium phosphate coatings produced using a sputtering process—An alternative to plasma spraying. Biomaterials 2005, 26, 327–337. [Google Scholar] [CrossRef] [PubMed]
- Bloebaum, R.D.; Zou, L.; Bachus, K.N.; Shea, K.G.; Hofmann, A.A.; Dunn, H.K. Analysis of particles in acetabular components from patients with osteolysis. Clin. Orthop. Relat. Res. 1997, 338, 109–118. [Google Scholar] [CrossRef]
- Velard, F.; Laurent-Maquin, D.; Guillaume, C.; Bouthors, S.; Jallot, E.; Nedelec, J.-M.; Belaaouaj, A.; Laquerriere, P. Polymorphonuclear neutrophil response to hydroxyapatite particles, implication in acute inflammatory reaction. Acta Biomater. 2009, 5, 1708–1715. [Google Scholar] [CrossRef] [PubMed]
- Laquerriere, P.; Grandjean-Laquerriere, A.; Jallot, E.; Balossier, G.; Frayssinet, P.; Guenounou, M. Importance of hydroxyapatite particles characteristics on cytokines production by human monocytes in vitro. Biomaterials 2003, 24, 2739–2747. [Google Scholar] [CrossRef]
- Grandjean-Laquerriere, A.; Laquerriere, P.; Laurent-Maquin, D.; Guenounou, M.; Phillips, T.M. The effect of the physical characteristics of hydroxyapatite particles on human monocytes IL-18 production in vitro. Biomaterials 2004, 25, 5921–5927. [Google Scholar] [CrossRef] [PubMed]
- Braux, J.; Velard, F.; Guillaume, C.; Bouthors, S.; Jallot, E.; Nedelec, J.-M.; Laurent-Maquin, D.; Laquerrière, P. A new insight into the dissociating effect of strontium on bone resorption and formation. Acta Biomater. 2011, 7, 2593–2603. [Google Scholar] [CrossRef] [PubMed]
- Grandjean-Laquerriere, A.; Laquerriere, P.; Jallot, E.; Nedelec, J.-M.; Guenounou, M.; Laurent-Maquin, D.; Phillips, T.M. Influence of the zinc concentration of sol-gel derived zinc substituted hydroxyapatite on cytokine production by human monocytes in vitro. Biomaterials 2006, 27, 3195–3200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Velard, F.; Laurent-Maquin, D.; Braux, J.; Guillaume, C.; Bouthors, S.; Jallot, E.; Nedelec, J.M.; Belaaouaj, A.; Laquerriere, P. The effect of zinc on hydroxyapatite-mediated activation of human polymorphonuclear neutrophils and bone implant-associated acute inflammation. Biomaterials 2010, 31, 2001–2009. [Google Scholar] [CrossRef] [PubMed]
- Caetano-Lopes, J.; Canhão, H.; Fonseca, J.E. Osteoimmunology—The hidden immune regulation of bone. Autoimmun. Rev. 2009, 8, 250–255. [Google Scholar] [PubMed]
- Geusens, P.; Lems, W.F. Osteoimmunology and osteoporosis. Arthritis Res. Ther. 2011, 13, 242. [Google Scholar] [CrossRef] [PubMed]
- Goldring, M.B.; Otero, M. Inflammation in osteoarthritis. Curr. Opin. Rheumatol. 2011, 23, 471–478. [Google Scholar] [CrossRef] [PubMed]
- Scott, D.A.; Krauss, J. Neutrophils in periodontal inflammation. Front. Oral. Biol. 2012, 15, 56–83. [Google Scholar] [PubMed]
- Hallab, N.J.; Jacobs, J.J. Biologic effects of implant debris. Bull. NYU Hosp. Jt. Dis. 2009, 67, 182–188. [Google Scholar] [PubMed]
- Fritz, E.A.; Glant, T.T.; Vermes, C.; Jacobs, J.J.; Roebuck, K.A. Chemokine gene activation in human bone marrow-derived osteoblasts following exposure to particulate wear debris. J. Biomed. Mater. Res. A 2006, 77, 192–201. [Google Scholar] [CrossRef] [PubMed]
- Penolazzi, L.; Lambertini, E.; Tavanti, E.; Torreggiani, E.; Vesce, F.; Gambari, R.; Piva, R. Evaluation of chemokine and cytokine profiles in osteoblast progenitors from umbilical cord blood stem cells by BIO-PLEX technology. Cell Biol. Int. 2008, 32, 320–325. [Google Scholar] [CrossRef] [PubMed]
- Lacey, D.L.; Grosso, L.E.; Moser, S.A.; Erdmann, J.; Tan, H.L.; Pacifici, R.; Villareal, D.T. IL-1-induced murine osteoblast IL-6 production is mediated by the type 1 IL-1 receptor and is increased by 1,25 dihydroxyvitamin D3. J. Clin. Investig. 1993, 91, 1731–1742. [Google Scholar] [CrossRef] [PubMed]
- Chaudhary, L.R.; Avioli, L.V. Dexamethasone regulates IL-1 beta and TNF-alpha-induced interleukin-8 production in human bone marrow stromal and osteoblast-like cells. Calcif. Tissue Int. 1994, 55, 16–20. [Google Scholar] [CrossRef] [PubMed]
- Grcević, D.; Katavić, V.; Lukić, I.K.; Kovacić, N.; Lorenzo, J.A.; Marusić, A. Cellular and molecular interactions between immune system and bone. Croat Med. J. 2001, 42, 384–392. [Google Scholar] [PubMed]
- Kwan Tat, S.; Padrines, M.; Théoleyre, S.; Heymann, D.; Fortun, Y. IL-6, RANKL, TNF-alpha/IL-1: Interrelations in bone resorption pathophysiology. Cytokine Growth Factor Rev. 2004, 15, 49–60. [Google Scholar] [PubMed]
- Lee, H.-L.; Yi, T.; Woo, K.M.; Ryoo, H.-M.; Kim, G.-S.; Baek, J.-H. Msx2 mediates the inhibitory action of TNF-alpha on osteoblast differentiation. Exp. Mol. Med. 2010, 42, 437–445. [Google Scholar] [CrossRef] [PubMed]
- Khan, U.A.; Hashimi, S.M.; Bakr, M.M.; Forwood, M.R.; Morrison, N.A. Foreign body giant cells and osteoclasts are TRAP positive, have podosome-belts and both require OC-STAMP for cell fusion. J. Cell Biochem. 2013, 114, 1772–1778. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Qin, L.; Bergenstock, M.; Bevelock, L.M.; Novack, D.V.; Partridge, N.C. Parathyroid hormone stimulates osteoblastic expression of MCP-1 to recruit and increase the fusion of pre/osteoclasts. J. Biol. Chem. 2007, 282, 33098–33106. [Google Scholar] [CrossRef] [PubMed]
- Rahimi, P.; Wang, C.Y.; Stashenko, P.; Lee, S.K.; Lorenzo, J.A.; Graves, D.T. Monocyte chemoattractant protein-1 expression and monocyte recruitment in osseous inflammation in the mouse. Endocrinology 1995, 136, 2752–2759. [Google Scholar] [PubMed]
- Valerio, M.S.; Herbert, B.A.; Basilakos, D.S.; Browne, C.; Yu, H.; Kirkwood, K.L. Critical role of MKP-1 in lipopolysaccharide-induced osteoclast formation through CXCL1 and CXCL2. Cytokine 2015, 71, 71–80. [Google Scholar] [CrossRef] [PubMed]
- Hardaway, A.L.; Herroon, M.K.; Rajagurubandara, E.; Podgorski, I. Marrow adipocyte-derived CXCL1 and CXCL2 contribute to osteolysis in metastatic prostate cancer. Clin. Exp. Metastasis 2015, 32, 353–368. [Google Scholar] [CrossRef] [PubMed]
- Marie, P.J. Strontium as therapy for osteoporosis. Curr. Opin. Pharmacol. 2005, 5, 633–636. [Google Scholar] [CrossRef] [PubMed]
- Canalis, E.; Hott, M.; Deloffre, P.; Tsouderos, Y.; Marie, P.J. The divalent strontium salt S12911 enhances bone cell replication and bone formation in vitro. Bone 1996, 18, 517–523. [Google Scholar] [CrossRef]
- Liu, X.; Zhu, S.; Cui, J.; Shao, H.; Zhang, W.; Yang, H.; Xu, Y.; Geng, D.; Yu, L. Strontium ranelate inhibits titanium-particle-induced osteolysis by restraining inflammatory osteoclastogenesis in vivo. Acta Biomater. 2014, 10, 4912–4918. [Google Scholar] [CrossRef] [PubMed]
- Baron, R.; Tsouderos, Y. In vitro effects of S12911–2 on osteoclast function and bone marrow macrophage differentiation. Eur. J. Pharmacol. 2002, 450, 11–17. [Google Scholar] [CrossRef]
- Renaudin, G.; Laquerrière, P.; Filinchuk, Y.; Jallot, E.; Nedelec, J.M. Structural characterization of sol–gel derived Sr-substituted calcium phosphates with anti-osteoporotic and anti-inflammatory properties. J. Mater. Chem. 2008, 18, 3593–3600. [Google Scholar] [CrossRef] [Green Version]
- Buache, E.; Velard, F.; Bauden, E.; Guillaume, C.; Jallot, E.; Nedelec, J.M.; Laurent-Maquin, D.; Laquerriere, P. Effect of strontium-substituted biphasic calcium phosphate on inflammatory mediators production by human monocytes. Acta Biomater. 2012, 8, 3113–3119. [Google Scholar] [CrossRef] [PubMed]
- Theill, L.E.; Boyle, W.J.; Penninger, J.M. RANK-L and RANK: T cells, bone loss, and mammalian evolution. Annu. Rev. Immunol. 2002, 20, 795–823. [Google Scholar] [CrossRef] [PubMed]
- Onan, D.; Allan, E.H.; Quinn, J.M.W.; Gooi, J.H.; Pompolo, S.; Sims, N.A.; Gillespie, M.T.; Martin, T.J. The chemokine Cxcl1 is a novel target gene of parathyroid hormone (PTH)/PTH-related protein in committed osteoblasts. Endocrinology 2009, 150, 2244–2253. [Google Scholar] [CrossRef] [PubMed]
- Macias, M.P.; Fitzpatrick, L.A.; Brenneise, I.; McGarry, M.P.; Lee, J.J.; Lee, N.A. Expression of IL-5 alters bone metabolism and induces ossification of the spleen in transgenic mice. J. Clin. Investig. 2001, 107, 949–959. [Google Scholar] [CrossRef] [PubMed]
- Miyamoto, T. Regulators of osteoclast differentiation and cell-cell fusion. Keio J. Med. 2011, 60, 101–105. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.S.; Day, C.J.; Morrison, N.A. MCP-1 is induced by receptor activator of nuclear factor-{kappa}B ligand, promotes human osteoclast fusion, and rescues granulocyte macrophage colony-stimulating factor suppression of osteoclast formation. J. Biol. Chem. 2005, 280, 16163–16169. [Google Scholar] [CrossRef] [PubMed]
- Bendre, M.S.; Montague, D.C.; Peery, T.; Akel, N.S.; Gaddy, D.; Suva, L.J. Interleukin-8 stimulation of osteoclastogenesis and bone resorption is a mechanism for the increased osteolysis of metastatic bone disease. Bone 2003, 33, 28–37. [Google Scholar] [CrossRef]
- Kim, M.S.; Day, C.J.; Selinger, C.I.; Magno, C.L.; Stephens, S.R.J.; Morrison, N.A. MCP-1-induced human osteoclast-like cells are tartrate-resistant acid phosphatase, NFATc1, and calcitonin receptor-positive but require receptor activator of NFkappaB ligand for bone resorption. J. Biol. Chem. 2006, 281, 1274–1285. [Google Scholar] [CrossRef] [PubMed]
- Hounoki, H.; Sugiyama, E.; Mohamed, S.G.-K.; Shinoda, K.; Taki, H.; Abdel-Aziz, H.O.; Maruyama, M.; Kobayashi, M.; Miyahara, T. Activation of peroxisome proliferator-activated receptor gamma inhibits TNF-alpha-mediated osteoclast differentiation in human peripheral monocytes in part via suppression of monocyte chemoattractant protein-1 expression. Bone 2008, 42, 765–774. [Google Scholar] [CrossRef] [PubMed]
- Mizutani, K.; Sud, S.; McGregor, N.A.; Martinovski, G.; Rice, B.T.; Craig, M.J.; Varsos, Z.S.; Roca, H.; Pienta, K.J. The chemokine CCL2 increases prostate tumor growth and bone metastasis through macrophage and osteoclast recruitment. Neoplasia 2009, 11, 1235–1242. [Google Scholar] [CrossRef] [PubMed]
- Posner, L.J.; Miligkos, T.; Gilles, J.A.; Carnes, D.L.; Taddeo, D.R.; Graves, D.T. Monocyte chemoattractant protein-1 induces monocyte recruitment that is associated with an increase in numbers of osteoblasts. Bone 1997, 21, 321–327. [Google Scholar] [CrossRef]
- Gibon, E.; Batke, B.; Jawad, M.U.; Fritton, K.; Rao, A.; Yao, Z.; Biswal, S.; Gambhir, S.S.; Goodman, S.B. MC3T3-E1 osteoprogenitor cells systemically migrate to a bone defect and enhance bone healing. Tissue Eng. Part A 2012, 18, 968–973. [Google Scholar] [CrossRef] [PubMed]
- Gibon, E.; Ma, T.; Ren, P.-G.; Fritton, K.; Biswal, S.; Yao, Z.; Smith, L.; Goodman, S.B. Selective inhibition of the MCP-1-CCR2 ligand-receptor axis decreases systemic trafficking of macrophages in the presence of UHMWPE particles. J. Orthop. Res. 2012, 30, 547–553. [Google Scholar] [CrossRef] [PubMed]
- Ishimi, Y.; Miyaura, C.; Jin, C.H.; Akatsu, T.; Abe, E.; Nakamura, Y.; Yamaguchi, A.; Yoshiki, S.; Matsuda, T.; Hirano, T.; et al. IL-6 is produced by osteoblasts and induces bone resorption. J. Immunol. 1990, 145, 3297–3303. [Google Scholar] [PubMed]
- Yoshitake, F.; Itoh, S.; Narita, H.; Ishihara, K.; Ebisu, S. Interleukin-6 directly inhibits osteoclast differentiation by suppressing receptor activator of NF-kappaB signaling pathways. J. Biol. Chem. 2008, 283, 11535–11540. [Google Scholar] [CrossRef] [PubMed]
- Duplomb, L.; Baud’huin, M.; Charrier, C.; Berreur, M.; Trichet, V.; Blanchard, F.; Heymann, D. Interleukin-6 inhibits receptor activator of nuclear factor kappaB ligand-induced osteoclastogenesis by diverting cells into the macrophage lineage: Key role of Serine727 phosphorylation of signal transducer and activator of transcription 3. Endocrinology 2008, 149, 3688–3697. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kudo, O.; Sabokbar, A.; Pocock, A.; Itonaga, I.; Fujikawa, Y.; Athanasou, N.A. Interleukin-6 and interleukin-11 support human osteoclast formation by a RANKL-independent mechanism. Bone 2003, 32, 1–7. [Google Scholar] [CrossRef]
- De Oliveira, S.; Reyes-Aldasoro, C.C.; Candel, S.; Renshaw, S.A.; Mulero, V.; Calado, A. Cxcl8 (IL-8) mediates neutrophil recruitment and behavior in the zebrafish inflammatory response. J. Immunol. 2013, 190, 4349–4359. [Google Scholar] [CrossRef] [PubMed]
- Kumegawa, M.; Hiramatsu, M.; Hatakeyama, K.; Yajima, T.; Kodama, H.; Osaki, T.; Kurisu, K. Effects of epidermal growth factor on osteoblastic cellsin vitro. Calcif. Tissue Int. 1983, 35, 542–548. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Jia, X.; Xiao, G.; Kang, Y.; Partridge, N.C.; Qin, L. EGF-like ligands stimulate osteoclastogenesis by regulating expression of osteoclast regulatory factors by osteoblasts: Implications for osteolytic bone metastases. J. Biol. Chem. 2007, 282, 26656–26664. [Google Scholar] [CrossRef] [PubMed]
- Yano, S.; Mentaverri, R.; Kanuparthi, D.; Bandyopadhyay, S.; Rivera, A.; Brown, E.M.; Chattopadhyay, N. Functional expression of beta-chemokine receptors in osteoblasts: Role of regulated upon activation, normal T cell expressed and secreted (RANTES) in osteoblasts and regulation of its secretion by osteoblasts and osteoclasts. Endocrinology 2005, 146, 2324–2335. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Huang, Y.; Collin-Osdoby, P.; Osdoby, P. CCR1 chemokines promote the chemotactic recruitment, RANKL development, and motility of osteoclasts and are induced by inflammatory cytokines in osteoblasts. J. Bone Miner. Res. 2004, 19, 2065–2077. [Google Scholar] [CrossRef] [PubMed]
Level of Production | Cytokines | Frequency of Detection | Relative Mean Level Detected |
---|---|---|---|
Produced by all donors in all conditions | IL-6 | 36 | 66 |
MCP-1 | 36 | 47 | |
Produced by a majority of donors in a majority of conditions | IL-8 | 26 | 40 |
GRO | 19 | 12 | |
EGF | 19 | 9 | |
RANTES | 18 | 8 | |
Produced by a minority of donors in a minority of conditions | IL-7 | 15 | 9 |
ENA-78 | 11 | 6 | |
TARC | 10 | 6 | |
IL-3 | 9 | 6 | |
Leptin | 9 | 5 | |
IGF-1 | 8 | 5 | |
GM-CSF | 7 | 5 | |
I-309 | 7 | 5 | |
IL-1α | 7 | 4 | |
MCSF | 6 | 4 | |
SCF | 6 | 5 | |
TGF-β1 | 6 | 4 | |
TNF-α | 6 | 5 | |
Oncostatin M | 6 | 4 | |
SDF-1 | 5 | 5 | |
Angiogenin | 5 | 7 | |
PDGF BB | 5 | 4 | |
IL-10 | 2 | 4 | |
MCP-2 | 2 | 5 | |
MCP-3 | 2 | 4 | |
VEGF | 2 | 4 | |
IL-1β | 1 | 4 | |
IL-2 | 1 | 5 | |
IL-4 | 1 | 4 | |
IL-15 | 1 | 4 | |
MDC | 1 | 4 |
Cytokines | Day 7 | Day 14 | Day 21 | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Basal | BCP | BCP5% | SrCl2 | Basal | BCP | BCP5% | SrCl2 | Basal | BCP | BCP5% | SrCl2 | |
IL-6 | 63.46 | 68.80 | 57.50 | 43.65 | 63.63 | 61.75 | 52.24 | 59.61 | 91.41 | 69.82 | 78.74 | 85.96 |
MCP-1 | 29.31 | 53.58 | 42.87 | 30.02 | 35.85 | 50.81 | 47.32 | 37.59 | 63.52 | 55.65 | 62.41 | 69.94 |
IL-8 | 20.94 | 28.16 | 37.63 | 29.02 | 9.32 | 6.42 | 9.97 | 8.73 | 57.01 | 41.55 | 43.17 | 56.64 |
GROs | 2.10 | 4.03 | 6.68 | 3.47 | 5.02 | 1.62 | 6.16 | 7.16 | 10.17 | 9.79 | 12.20 | 10.26 |
EGF | 4.87 | 9.35 | 10.93 | 8.27 | 5.57 | 1.83 | 7.19 | 2.46 | NA | 8.00 | 7.19 | 2.46 |
RANTES | 5.75 | 7.03 | 7.72 | 7.72 | 3.12 | 1.92 | 2.01 | 2.16 | NA | 5.15 | 4.79 | 6.52 |
Targeted mRNA | Sense Primer (5′-3′) | Antisense Primer (5′-3′) | Efficiency |
---|---|---|---|
CXCL1 | TCCTGCATCCCCCATAGTTA | CTTCAGGAACAGCCACCAGT | 1.97 |
CCL2 | AGTCTCTGCCGCCCTTCT | GTGACTGGGGCATTGATTG | 1.98 |
HPRT1 | TGACCTTGATTTATTTTGCATACC | CGAGCAAGACGTTCAGTCCT | 1.99 |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Braux, J.; Velard, F.; Guillaume, C.; Jourdain, M.-L.; Gangloff, S.C.; Jallot, E.; Nedelec, J.-M.; Laquerrière, P.; Laurent-Maquin, D. Strontium-Substituted Bioceramics Particles: A New Way to Modulate MCP-1 and Gro-α Production by Human Primary Osteoblastic Cells. Materials 2016, 9, 985. https://doi.org/10.3390/ma9120985
Braux J, Velard F, Guillaume C, Jourdain M-L, Gangloff SC, Jallot E, Nedelec J-M, Laquerrière P, Laurent-Maquin D. Strontium-Substituted Bioceramics Particles: A New Way to Modulate MCP-1 and Gro-α Production by Human Primary Osteoblastic Cells. Materials. 2016; 9(12):985. https://doi.org/10.3390/ma9120985
Chicago/Turabian StyleBraux, Julien, Frédéric Velard, Christine Guillaume, Marie-Laure Jourdain, Sophie C. Gangloff, Edouard Jallot, Jean-Marie Nedelec, Patrice Laquerrière, and Dominique Laurent-Maquin. 2016. "Strontium-Substituted Bioceramics Particles: A New Way to Modulate MCP-1 and Gro-α Production by Human Primary Osteoblastic Cells" Materials 9, no. 12: 985. https://doi.org/10.3390/ma9120985