Inter- and Intra-Continental Genetic Variation in the Generalist Conifer Wood Saprobic Fungus Phlebiopsis gigantea
Abstract
:1. Introduction
2. Materials and Methods
2.1. Survey and Isolation of Phlebiopsis gigantea from Western North American Forests
2.2. Molecular Analyses
2.2.1. DNA Extraction
2.2.2. PCR and DNA Sequencing
2.2.3. Alignments and Phylogenetic Analyses
3. Results
3.1. Results of the Analysis for Each Locus
3.1.1. Mitochondrial Gene atp6 Encoding the Sixth Subunit of ATP Synthase
3.1.2. Partial Mitochondrial Large Subunit rRNA, ML5-ML6
3.1.3. Internal Transcribed Spacer (nrITS)
3.1.4. RNA Polymerase II Subunit RPB1
3.1.5. RNA Polymerase II Subunit RPB2
3.1.6. Translation Elongation Factor 1-alpha (TEF1-α)
3.1.7. Glyceraldehyde-3-Phosphate Dehydrogenase (GPD)
3.1.8. Inference of Combined TEF1-α, nrITS, RPB1, RPB2 and GPD (Partial Exon and IV, V and VI Introns Included)
3.1.9. Phylogenetic Inference of Combined TEF1-α, nrITS, RPB1, RPB2 and GPD (Only IV and V Introns Included)
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hubbell, S.P. The Unified Neutral Theory of Biodiversity and Biogeography; Princeton University Press: Princeton, NJ, USA, 2001; pp. 1–448. [Google Scholar]
- Baas-Becking, L.G.M. Geobiologie of Inleiding Tot de Milieukunde; W.P. Van Stockum & Zoon: The Hague, The Netherlands, 1934; pp. 1895–1963. [Google Scholar]
- Green, J.; Bohannan, B.J.M. Spatial scaling of microbial biodiversity. Trends Ecol. Evol. 2006, 21, 501–507. [Google Scholar] [CrossRef]
- Garnica, S.; Riess, K.; Schön, M.E.; Oberwinkler, F.; Setaro, S.D. Divergence Times and Phylogenetic Patterns of Sebacinales, a Highly Diverse and Widespread Fungal Lineage. PLoS ONE 2016, 11, e0149531. [Google Scholar] [CrossRef] [PubMed]
- Sato, H.; Tsujino, R.; Kurita, K.; Yokoyama, K.; Agata, K. Modelling the global distribution of fungal species: New insights into microbial cosmopolitanism. Mol. Ecol. 2012, 21, 5599–5612. [Google Scholar] [CrossRef]
- Smith, S.E.; Read, D.J. Mycorrhizal Symbiosis; Academic Press: Cambridge, UK, 2008; pp. 1–787. [Google Scholar]
- Tedersoo, L.; May, T.W.; Smith, M.E. Ectomycorrhizal lifestyle in fungi: Global diversity, distribution, and evolution of phylogenetic lineages. Mycorrhiza 2010, 20, 217–263. [Google Scholar] [CrossRef] [PubMed]
- Bahram, M.; Peay, K.G.; Tedersoo, L. Local-scale biogeography and spatiotemporal variability in communities of mycorrhizal fungi. New Phytol. 2015, 205, 1454–1463. [Google Scholar] [CrossRef] [PubMed]
- Halling, R.E.; Osmundson, T.W.; Neves, M.-A. Pacific boletes: Implications for biogeographic relationships. Mycol. Res. 2008, 112, 437–447. [Google Scholar] [CrossRef] [PubMed]
- Geml, J.; Tulloss, R.E.; Laursen, G.A.; Sazanova, N.A.; Taylor, D.L. Evidence for strong inter-and intracontinental phylogeographic structure in Amanita muscaria, a wind-dispersed ectomycorrhizal basidiomycete. Mol. Phylogenet. Evol. 2008, 48, 694–701. [Google Scholar] [CrossRef]
- O’Donnell, K.; Rooney, A.P.; Mills, G.L.; Kuo, M.; Weber, N.S.; Rehner, S.A. Phylogeny and historical biogeography of true morels (Morchella) reveals an early Cretaceous origin and high continental endemism and provincialism in the Holarctic. Fungal Genet. Biol. 2011, 48, 252–265. [Google Scholar] [CrossRef]
- Peay, K.G.; Garbelotto, M.; Bruns, T.D. Evidence of dispersal limitation in soil microorganisms: Isolation reduces species richness on mycorrhizal tree islands. Ecology 2010, 91, 3631–3640. [Google Scholar] [CrossRef]
- Amend, A.; Garbelotto, M.; Fang, Z.; Keeley, S. Isolation by landscape in populations of a prized edible mushroom Tricholoma matsutake. Conserv. Genet. 2010, 11, 795–802. [Google Scholar] [CrossRef]
- Peay, K.G.; Bruns, T.D.; Kennedy, P.G.; Bergemann, S.E.; Garbelotto, M. A strong species–area relationship for eukaryotic soil microbes: Island size matters for ectomycorrhizal fungi. Ecol. Lett. 2007, 10, 470–480. [Google Scholar] [CrossRef] [PubMed]
- Bonito, G.M.; Gryganskyi, A.P.; Trappe, J.M.; Vilgalys, R. A global meta-analysis of Tuber ITS rDNA sequences: Species diversity, host associations and long-distance dispersal. Mol. Ecol. 2010, 19, 4994–5008. [Google Scholar] [CrossRef]
- Talbot, J.M.; Bruns, T.D.; Taylor, J.W.; Smith, D.P.; Branco, S.; Glassman, S.I.; Erlandson, S.; Vilgalys, R.; Liao, H.L.; Smith, M.E.; et al. Endemism and functional convergence across the North American soil mycobiome. Proc. Natl. Acad. Sci. USA 2014, 111, 6341–6346. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tedersoo, L.; Bahram, M.; Põlme, S.; Kõljalg, U.; Yorou, N.S.; Wijesundera, R.; Ruiz, L.V.; Vasco-Palacios, A.M.; Thu, P.Q.; Suija, A.; et al. Global diversity and geography of soil fungi. Science 2014, 346, 1256688. [Google Scholar] [CrossRef] [Green Version]
- Hoeksema, J.D.; Averill, C.; Bhatnagar, J.M.; Brzostek, E.; Buscardo, E.; Chen, K.H.; Liao, H.L.; Nagy, L.; Policelli, N.; Ridgeway, J.; et al. Ectomycorrhizal Plant-Fungal Co-invasions as Natural Experiments for Connecting Plant and Fungal Traits to Their Ecosystem Consequences. Front. For. Glob. Chang. 2020, 3, 84. [Google Scholar] [CrossRef]
- Donoghue, M.J.; Moore, B.R. Toward an integrative historical biogeography. Integr. Comp. Biol. 2003, 43, 261–270. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiang, Q.Y.; Soltis, D.E.; Soltis, P.S. The eastern Asian and eastern and western North American floristic disjunction: Congruent phylogenetic patterns in seven diverse genera. Mol. Phylogenetics Evol. 1998, 10, 178–190. [Google Scholar] [CrossRef] [Green Version]
- Tiffney, B.H. The Eocene North Atlantic land bridge: Its importance in Tertiary and modern phytogeography of the Northern Hemisphere. J. Arn. Arb. 1985, 66, 243–273. [Google Scholar]
- Wen, J.; Ickert-Bond, S.M. Evolution of the Madrean–Tethyan disjunctions and the North and South American amphitropical disjunctions in plants. J. Syst. Evol. 2009, 47, 331–348. [Google Scholar] [CrossRef]
- Wen, J.; Nie, Z.L.; Ickert-Bond, S.M. Intercontinental disjunctions between eastern Asia and western North America in vascular plants highlight the biogeographic importance of the Bering land bridge from late Cretaceous to Neogene. J. Syst. Evol. 2016, 54, 469–490. [Google Scholar] [CrossRef]
- Donoghue, M.J.; Bell, C.D.; Li, J. Phylogenetic patterns in Northern Hemisphere plant geography. Int. J. Plant Sci. 2001, 162, S41–S52. [Google Scholar] [CrossRef] [Green Version]
- Ruddiman, W.F.; Kutzbach, J.E. Forcing of late Cenozoic northern hemisphere climate by plateau uplift in southern Asia and the American West. J. Geophys. Res. Atmos. 1989, 94, 18409–18427. [Google Scholar] [CrossRef]
- Zinck, J.W.; Rajora, O.P. Post-glacial phylogeography and evolution of a wide-ranging highly-exploited keystone forest tree, eastern white pine (Pinus strobus) in North America: Single refugium, multiple routes. BMC Evol. Biol. 2016, 16, 1–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Adams, J.M.; Faure, H. Preliminary vegetation maps of the world since the last glacial maximum: An aid to archaeological understanding. J. Archaeol. Sci. 1997, 24, 623–647. [Google Scholar] [CrossRef]
- Cook, J.A.; Hoberg, E.P.; Koehler, A.; Henttonen, H.; Wickström, L.; Haukisalmi, V.; Galbreath, K.; Chernyavski, F.; Dokuchaev, N.; Lahzuhtkin, A.; et al. Beringia: Intercontinental exchange and diversification of high latitude mammals and their parasites during the Pliocene and Quaternary. Mammal Study 2005, 30, S33–S44. [Google Scholar] [CrossRef]
- Graham, A. The Tertiary history of the northern temperate element in the northern Latin American biota. Am. J. Bot. 1999, 86, 32–38. [Google Scholar] [CrossRef] [PubMed]
- Linzer, R.E.; Otrosina, W.J.; Gonthier, P.; Bruhn, J.; Laflamme, G.; Bussieres, G.; Garbelotto, M. Inferences on the phylogeography of the fungal pathogen Heterobasidion annosum, including evidence of interspecific horizontal genetic transfer and of human-mediated, long-range dispersal. Mol. Phylogenet. Evol. 2008, 46, 844–862. [Google Scholar] [CrossRef]
- Millar, C.I. Impact of the Eocene on the evolution of Pinus L. Ann. Mo. Bot. Gard. 1993, 80, 471–498. [Google Scholar] [CrossRef]
- Wood, C.E. Some floristic relationships between the southern Appalachians and western North America. In The Distributional History of the Bbiota of the Southern Appalachians, Part II. Flora; Holt, P.C., Ed.; Polytechnic Institute and State Univ.: Blacksburg, VA, USA, 1971; pp. 331–404. [Google Scholar]
- Wood, C.E. Morphology and phytogeography: The classical approach to the study of disjunctions. Ann. Mo. Bot. Gard. 1972, 59, 107–124. [Google Scholar] [CrossRef]
- Li, H.L. Eastern Asia–eastern North America species-pairs in wide-ranging genera. In Floristics and Paleofloristics of Asia and Eastern North America; Graham, A., Ed.; Elsevier: Amsterdam, The Netherlands, 1972; pp. 65–78. ISBN 978-0444409584. [Google Scholar]
- Wu, Z.Y. On the significance of Pacific intercontinental discontinuity. Ann. Mo. Bot. Gard. 1983, 70, 577–590. [Google Scholar]
- Boufford, D.E.; Spongberg, S.A. Eastern Asia–Eastern North American phytogeographical relationships—a history from the time of Linnaeus to the twentieth century. Ann. Mo. Bot. Gard. 1983, 70, 423–439. [Google Scholar] [CrossRef]
- Jaramillo-Correa, J.P.; Beaulieu, J.; Bousquet, J. Variation in mitochondrial DNA reveals multiple distant glacial refugia in black spruce (Picea mariana), a transcontinental North American conifer. Mol. Ecol. 2004, 13, 2735–2747. [Google Scholar] [CrossRef]
- Axelrod, D.I. Rise of the grassland biome, central North America. Bot. Rev. 1985, 51, 163–201. [Google Scholar] [CrossRef]
- Manos, P.S.; Stanford, A.M. The historical biogeography of Fagaceae: Tracking the tertiary history of temperate and subtropical forests of the Northern Hemisphere. Int. J. Plant Sci. 2001, 162, S77–S93. [Google Scholar] [CrossRef]
- Brundrett, M.C.; Tedersoo, L. Evolutionary history of mycorrhizal symbioses and global host plant diversity. New Phytol. 2018, 220, 1108–1115. [Google Scholar] [CrossRef] [PubMed]
- Nuñez, M.A.; Dickie, I.A. Invasive belowground mutualists of woody plants. Biol. Invasions 2014, 16, 645–661. [Google Scholar] [CrossRef]
- Chapela, I.H.; Garbelotto, M. Phylogeography and evolution in Matsutake and close allies inferred by analyses of ITS sequences and AFLPs. Mycologia 2004, 96, 730–741. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.X.; Mueller, G.M.; Lutzoni, F.M.; Huang, Y.Q.; Guo, S.Y. Phylogenetic and biogeographic relationships of eastern Asian and eastern North American disjunct Suillus species (Fungi) as inferred from nuclear ribosomal RNA ITS sequences. Mol. Phylogenet. Evol. 2000, 17, 37–47. [Google Scholar] [CrossRef] [Green Version]
- Buyck, B.; Hofstetter, V.; Olariaga, I. Setting the record straight on North American Cantharellus. Cryptogam. Mycol. 2016, 37, 405–417. [Google Scholar] [CrossRef]
- Lindgren, J.E. Amanita novinupta a rubescent, white species from the Western United States and Southwestern Canada. Mycotaxon 1994, 51, 179–190. [Google Scholar]
- Burdon, J.J.; Thrall, P.H. Coevolution of plants and their pathogens in natural habitats. Science 2009, 324, 755–756. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, J.J.; Cui, B.K.; Zhou, L.W.; Korhonen, K.; Dai, Y.C. Phylogeny, divergence time estimation, and biogeography of the genus Heterobasidion (Basidiomycota, Russulales). Fungal Divers. 2015, 71, 185–200. [Google Scholar] [CrossRef]
- Garbelotto, M.; Gonthier, P. Biology, epidemiology, and control of Heterobasidion species worldwide. Annu. Rev. Phytopathol. 2013, 51, 39–59. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dalman, K.; Olson, A.; Stenlid, J. Evolutionary history of the conifer root rot fungus Heterobasidion annosum sensu lato. Mol. Ecol. 2010, 19, 4979–4993. [Google Scholar] [CrossRef] [PubMed]
- Korhonen, K.; Kauppila, P.I. The sexuality of Phlebiopsis gigantea. Karstenia 1988, 27, 23–30. [Google Scholar] [CrossRef] [Green Version]
- Vasiliauskas, R.; Larsson, E.; Larsson, K.H.; Stenlid, J. Persistence and longterm impact of Rotstop biological control agent on mycodiversity in Picea abies stumps. Biol. Control 2005, 32, 295–304. [Google Scholar] [CrossRef]
- Desprez-Loustau, M.L.; Robin, C.; Buee, M.; Courtecuisse, R.; Garbaye, J.; Suffert, F.; Sache, I.; Rizzo, D.M. The fungal dimension of biological invasions. Trends Ecol. Evol. 2007, 22, 472–480. [Google Scholar] [CrossRef]
- Fisher, M.C.; Henk, D.A.; Briggs, C.J.; Brownstein, J.S.; Madoff, L.C.; McCraw, S.L.; Gurr, S.J. Emerging fungal threats to animal, plant and ecosystem health. Nature 2012, 484, 186–194. [Google Scholar] [CrossRef]
- Stenlid, J.; Oliva, J.; Boberg, J.B.; Hopkins, A.J. Emerging diseases in European forest ecosystems and responses in society. Forests 2011, 2, 486–504. [Google Scholar] [CrossRef]
- Vellinga, E.C.; Wolfe, B.E.; Pringle, A. Global patterns of ectomycorrhizal introductions. New Phytol. 2009, 181, 960–973. [Google Scholar] [CrossRef] [Green Version]
- Wingfield, M.J.; Slippers, B.; Roux, J.; Wingfield, B.D. Worldwide movement of exotic forest fungi, especially in the tropics and the southern hemisphere. Bioscience 2001, 51, 134–140. [Google Scholar] [CrossRef] [Green Version]
- Pringle, A.; Vellinga, E.C. Last chance to know? Using literature to explore the biogeography and invasion biology of the death cap mushroom Amanita phalloides (Vaill. ex Fr.: Fr.) Link. Biol. Invasions 2006, 8, 1131–1144. [Google Scholar] [CrossRef]
- Wolfe, B.E.; Richard, F.; Cross, H.B.; Pringle, A. Distribution and abundance of the introduced ectomycorrhizal fungus Amanita phalloides in North America. New Phytol. 2010, 185, 803–816. [Google Scholar] [CrossRef] [PubMed]
- Giordano, L.; Gonthier, P.; Lione, G.; Capretti, P.; Garbelotto, M. The saprobic and fruiting abilities of the exotic forest pathogen Heterobasidion irregulare may explain its invasiveness. Biol. Invasions 2014, 16, 803–814. [Google Scholar] [CrossRef]
- Gonthier, P.; Nicolotti, G.; Linzer, R.; Guglielmo, F.; Garbelotto, M. Invasion of European pine stands by a North American forest pathogen and its hybridization with a native interfertile taxon. Mol. Ecol. 2007, 16, 1389–1400. [Google Scholar] [CrossRef] [PubMed]
- Sillo, F.; Garbelotto, M.; Giordano, L.; Gonthier, P. Genic introgression from an invasive exotic fungal forest pathogen increases the establishment potential of a sibling native pathogen. NeoBiota 2021, 65, 109–136. [Google Scholar] [CrossRef]
- Geils, B.W.; Hummer, K.E.; Hunt, R.S. White pines, Ribes, and blister rust: A review and synthesis. For. Pathol. 2010, 40, 147–185. [Google Scholar] [CrossRef]
- Hamelin, R.C.; Hunt, R.S.; Geils, B.W.; Jensen, G.D.; Jacobi, V.; Lecours, N. Barrier to gene flow between eastern and western populations of Cronartium ribicola in North America. Phytopathology 2000, 90, 1073–1078. [Google Scholar] [CrossRef] [Green Version]
- McKay, S. State regulation of Ribes to control white pine blister rust. Horttechnology 2000, 10, 562–564. [Google Scholar] [CrossRef] [Green Version]
- Korhonen, K.; Lipponen, K.; Bendz, M.; Johansson, M.; Ryen, I.; Venn, K.; Seiskari, P.; Niemi, M. Control of Heterobasidion annosum by stump treatment with _Rotstop_, a new 242 M. Berglund and J. Ronnberg commercial formulation of Phlebiopsis gigantea. In Proceedings of the 8th International Conference on Root and Butt Rots, Wik, Sweden and Haikko, Finland, 9–16 August 1993; Johansson, M., Stenlid, J., Eds.; The Swedish University of Agricultural Sciences: Uppsala, Sweden, 1994; pp. 675–685. [Google Scholar]
- Rishbeth, J. Stump protection against Fomes annosus. III. Inoculation with Peniophora gigantea. Ann. Appl. Biol. 1963, 52, 63–77. [Google Scholar] [CrossRef]
- Gonthier, P.; Garbelotto, M.; Nicolotti, G. Seasonal patterns of spore deposition of Heterobasidion species in four forests of the western Alps. Phytopathology 2005, 95, 759–767. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- White, T.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. Guide Methods Appl. 1990, 18, 315–322. [Google Scholar]
- Rehner, S.A.; Buckley, E.A. Beauveria phylogeny inferred from nuclear ITS and EF1-sequences: Evidencefor cryptic diversification and links to Cordyceps teleomorphs. Mycologia 2005, 97, 84–98. [Google Scholar] [CrossRef]
- Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes—application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef] [PubMed]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef]
- Hori, C.; Ishida, T.; Igarashi, K.; Samejima, M.; Suzuki, H.; Master, E.; Ferreira, P.; Ruiz-Duenas, F.J.; Held, B.; Canessa, P.; et al. Analysis of the Phlebiopsis gigantea Genome, Transcriptome and Secretome ProvidesInsight into Its Pioneer Colonization Strategies of Wood. PLoS Genet. 2014, 10, e1004759. [Google Scholar] [CrossRef] [Green Version]
- Katoh, K.; Toh, H. Recent developments in the MAFFT multiple sequence alignment program. Brief. Bioinform. 2008, 9, 286–298. [Google Scholar] [CrossRef] [Green Version]
- Stamatakis, A. RAxML Version 8: A tool for Phylogenetic Analysis and Post-Analysis of Large Phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
- Wit, M.; Sierota, Z.; Żółciak, A.; Mirzwa-Mróz, E.; Jabłońska, E.; Wakuliński, W. Phylogenetic relationships between Phlebiopsis gigantea and selected basidiomycota species inferred from partial DNA sequence of Elongation Factor 1-Alpha gene. Forests 2020, 11, 592. [Google Scholar] [CrossRef]
- Douhan, G.W.; Vincenot, L.; Gryta, H.; Selosse, M.A. Population genetics of ectomycorrhizal fungi: From current knowledge to emerging directions. Fungal Biol. 2011, 115, 569–597. [Google Scholar] [CrossRef]
- McDonald, B.A.; Linde, C. Pathogen population genetics, evolutionary potential, and durable resistance. Annu. Rev. Phytopathol. 2002, 40, 349–379. [Google Scholar] [CrossRef] [Green Version]
- Farr, D.F.; Rossman, A.Y. Fungal Databases, U.S. National Fungus Collections, ARS, USDA. Available online: https://nt.ars-grin.gov/fungaldatabases/ (accessed on 7 April 2021).
- Shaw, C.G. Is Heterobasidion annosum Poorly Adapted to Incite Disease in Cool, Wet Environments? In Proceedings of the Symposium on Research and Management of Annosus Root Disease (Heterobasidion annosum) in Western North America, Monterey, CA, USA, 18–21 April 1989; Gen. Tech. Rep. PSW 116. Pacific Southwest Forest and Range Experiment Station, Forest Service, U.S. Department of Agriculture: Berkeley, CA, USA, 1989; pp. 101–104. [Google Scholar]
- Critchfield, W.B.; Little, E.L. Geographic Distribution of the Pines of the World (No. 991); US Department of Agriculture, Forest Service: Washington, DC, USA, 1927.
- Oliva, J.; Zhao, A.; Zarei, S.; Sedlák, P.; Stenlid, J. Effect of temperature on the interaction between Phlebiopsis gigantea and the root-rot forest pathogen Heterobasidion spp. For. Ecol. Manag. 2015, 340, 22–30. [Google Scholar] [CrossRef]
- Simberloff, D.; Stiling, P. How risky is biological control? Ecology 1996, 77, 1965–1974. [Google Scholar] [CrossRef]
- Clercq, P.D. Dark clouds and their silver linings: Exotic generalist predators in augmentative biological control. Neotrop. Entomol. 2002, 31, 169–176. [Google Scholar] [CrossRef]
- Hulcr, J.; Gomez, D.F.; Skelton, J.; Johnson, A.J.; Adams, S.; Li, Y.; Justino, M.A.; Smith, M.E. Invasion of an inconspicuous ambrosia beetle and fungus may affect wood decay in Southeastern North America. Biol. Invasions 2021, 23, 1339–1347. [Google Scholar] [CrossRef]
- Brasier, C.M.; Buck, K.; Paoletti, M.; Crawford, L.; Kirk, S. Molecular analysis of evolutionary changes in populations of Ophiostoma novo-ulmi. Investig. Agrar.-Sist. Recur. 2004, 13, 93–103. [Google Scholar]
- Kretzer, A.M.; Bruns, T.D. Use of atp6 in fungal phylogenetics: An example from the Boletales. Mol. Phylogenetics Evol. 1999, 13, 483–492. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bruns, T.D.; Szaro, T.M.; Gardes, M.; Cullings, K.W.; Pan, J.J.; Taylor, D.L.; Horton, T.R.; Kretzer, A.; Garbelotto, M.; Li, Y. A sequence database for the identification of ectomycorrhizal basidiomycetes by phylogenetic analysis. Mol. Ecol. 1998, 7, 257–272. [Google Scholar] [CrossRef] [Green Version]
- Vainio, E.J.; Hantula, J. Genetic differentiation between European and North American populations of Phlebiopsis gigantea. Mycologia 2000, 92, 436–446. [Google Scholar] [CrossRef]
- Vainio, E.J.; Korhonen, K.; Hantula, J. Genetic variation in Phlebiopsis gigantea as detected with random amplified microsatellite (RAMS) markers. Mycol. Res. 1998, 102, 187–192. [Google Scholar] [CrossRef]
- Sierota, Z.; Nowakowska, J.A.; Sikora, K.; Wrzosek, M.; Żółciak, A.; Małecka, M. Genetic variation among Phlebiopsis gigantea strains determined by Random Amplified Microsatellite Markers. Balt. For. 2015, 21, 178–183. [Google Scholar]
- Liu, A.Z.; Samils, N.; Higgins, B.; Stenlid, J.; Slippers, B.; Nairn, C.J.; Covert, S.F. Microsatellite markers for the wood decay fungus Phlebiopsis gigantea. Conserv. Genet. 2009, 10, 1529–1532. [Google Scholar] [CrossRef]
- Giordano, L.; Sillo, F.; Garbelotto, M.; Gonthier, P. Mitonuclear interactions may contribute to fitness of fungal hybrids. Sci. Rep. 2018, 8, 1–7. [Google Scholar]
- Olson, Å.; Stenlid, J. Mitochondrial control of fungal hybrid virulence. Nature 2001, 411, 438. [Google Scholar] [CrossRef]
- Bonuso, E.; Zambonelli, A.; Bergemann, S.E.; Iotti, M.; Garbelotto, M. Multilocus phylogenetic and coalescent analyses identify two cryptic species in the Italian bianchetto truffle, Tuber borchii Vittad. Conserv. Genet. 2010, 11, 1453–1466. [Google Scholar] [CrossRef]
- Chothia, C.; Finkelstein, A.V. The classification and origins of protein folding patterns. Annu. Rev. Biochem. 1990, 59, 1007–1035. [Google Scholar] [CrossRef]
- Nicolotti, G.; Gonthier, P.; Varese, C. Effectiveness of some biocontrol and chemical treatments against Heterobasidion annosum on Norway spruce stumps. Eur. J. Plant Pathol. 1999, 29, 339–346. [Google Scholar] [CrossRef]
- Simberloff, D. Risks of biological control for conservation purposes. Biocontrol 2012, 57, 263–276. [Google Scholar] [CrossRef]
ID | P.g. | Location | County and Ecoregion | Latitude | Longitude | Substrate | Average Yearly Rainfall (mm) | Average Temperature Range | Elevation |
---|---|---|---|---|---|---|---|---|---|
P15 | No | Van Damme State Park | Mendocino, Coastal | 39.277142 | −123.782546 | Douglas-fir log | 1041 | 5 to 22 | 65 |
P25 | No | Van Damme State Park | Mendocino, Coastal | 39.276701 | −123.780552 | Conifer log | 1041 | 5 to 22 | 78 |
P11 | No | Pygmy Forest | Mendocino, Coastal | 39.265512 | −123.736040 | Douglas-fir log | 1041 | 5 to 22 | 187 |
P19 | No | Pygmy Forest | Mendocino, Coastal | 39.266242 | −123.734775 | Shore pine log | 1041 | 5 to 22 | 189 |
P20 | No | Pygmy Forest | Mendocino, Coastal | 39.266450 | −123.766441 | Shore pine log | 1041 | 5 to 22 | 166 |
P16 | No | Airport Rd. | Mendocino, Coastal | 39.269930 | −123.779402 | Bishop pine log | 1041 | 5 to 22 | 90 |
P17 | No | Airport Rd. | Mendocino, Coastal | 39.271307 | −123.774745 | Bishop pine stump | 1041 | 5 to 22 | 127 |
P18 | No | Airport Rd. | Mendocino, Coastal | 39.271176 | −123.771672 | Bishop pine log | 1041 | 5 to 22 | 149 |
P12 | No | Russian Gulch State Park | Mendocino, Coastal | 39.329418 | −123.808355 | Douglas-fir log | 1041 | 5 to 22 | 20 |
P23 | No | Russian Gulch State Park | Mendocino, Coastal | 39.329460 | −123.809579 | Douglas-fir log | 1041 | 5 to 22 | 20 |
P7 | No | Cobb Mtn. | Lake, Coast Range | 38.811006 | −122.712369 | Ponderosa pine log | 965 | −2 to 29 | 816 |
P8/U-P8 | Yes | Cobb Mtn. | Lake, Coast Range | 38.811006 | −122.712369 | Ponderosa pine log | 965 | −2 to 29 | 818 |
P9/U-P9 | Yes | Cobb Mtn | Lake, Coast Range | 38.811006 | −122.712369 | Ponderosa pine log | 965 | −2 to 29 | 818 |
P10 | No | Cobb Mtn. | Lake, Coast Range | 38.81118 | −122.713345 | Ponderosa pine log | 965 | −2 to 29 | 826 |
P21 | Yes | Cobb Mtn. | Lake, Coast Range | 38.809389 | −122.711941 | Ponderosa pine log | 965 | −2 to 29 | 820 |
P22/U- P22 | Yes | Cobb Mtn. | Lake, Coast Range | 38.819652 | −122.712103 | Ponderosa pine log | 965 | −2 to 29 | 821 |
P24/U-P24 | Yes | Cobb Mtn. | Lake, Coast Range, | 38.819652 | −122.712109 | Ponderosa pine log | 965 | −2 to 29 | 820 |
P26/U-P26 | Yes | Cobb Mtn. | Lake, Coast Range | 38.819652 | −122.712109 | Ponderosa pine log | 965 | −2 to 29 | 820 |
P2 | No | Loch Lomond | Lake, Coast Range | 38.895662 | −122.742704 | Ponderosa pine log | 965 | −2 to 29 | 785 |
P6 | No | Loch Lomond | Lake, Coast Range | 38.887198 | −122.729372 | Ponderosa pine log | 965 | −2 to 29 | 797 |
P1 | No | Tahoe City | Placer, High Sierra Nevada | 39.155065 | −120.152929 | White fir log | 787 | −8 to 26 | 1935 |
P3 | No | Tahoe city | Placer, High Sierra Nevada | 39.173049 | −120.148085 | White fir log | 787 | −8 to 26 | 1951 |
P4 | No | Tahoe Vista | Placer, High Sierra Nevada | 39.250457 | −120.108564 | White fir log | 787 | −8 to 26 | 2180 |
P5 | No | Tahoe Vista | Placer, High Sierra Nevada | 39.250457 | −120.108564 | White fir log | 787 | −8 to 26 | 2180 |
P13 | No | Tahoe City | Placer, High Sierra Nevada | 39.161265 | −120.153599 | Ponderosa pine log | 787 | −8 to 26 | 1913 |
P14 | No | Tahoe City | Placer, High Sierra Nevada | 39.161064 | −120.154032 | White fir log | 787 | −8 to 26 | 1917 |
P27 | No | Tahoe City | Placer, High Sierra Nevada | 39.161265 | −120.153599 | Ponderosa pine log | 787 | −8 to 26 | 1915 |
P29 | No | Ward Valley | Placer, High Sierra Nevada | 39.144342 | −120.206932 | Lodgepole pine log | 787 | −8 to 26 | 2022 |
P32 | No | Ward Valley | Placer, High Sierra Nevada | 39.143975 | −120.210386 | Conifer wood | 787 | −8 to 26 | 2031 |
P28 | No | Sierraville | Sierra, High Sierra Nevada | 39.491148 | −120.306089 | Conifer wood | 787 | −8 to 26 | 1975 |
P34 | No | Sierraville | Sierra, High Sierra Nevada | 39.490843 | −120.28722 | Ponderosa pine log | 787 | −8 to 26 | 1962 |
P35 | No | Sierraville | Sierra, High Sierra Nevada | 39.490845 | −120.28722 | Ponderosa pine log | 787 | −8 to 26 | 1962 |
P36 | No | Sierraville | Sierra, High Sierra Nevada | 39.490847 | −120.28724 | Ponderosa pine log | 787 | −8 to 26 | 1960 |
P37 | No | Sierraville | Sierra, High Sierra Nevada | 39.490847 | −120.28724 | Ponderosa pine log | 787 | −8 to 26 | 1960 |
P31 | No | Sierraville | Sierra, High Sierra Nevada | 39.489625 | −120.29373 | Ponderosa pine log | 787 | −8 to 26 | 1974 |
P30 | No | Blodgett Forest | Eldorado, Sierra Nevada | 38.880831 | −120.648867 | Ponderosa pine log | 1651 | 0 to 27 | 1288 |
P33 | No | Blodgett Forest | Eldorado, Sierra Nevada | 38.875021 | −120.651343 | White fir log | 1651 | 0 to 27 | 1330 |
P39 | Yes | Blodgett Forest | Eldorado, Sierra Nevada | 39.912835 | −120.665881 | Douglas-fir log | 1651 | 0 to 27 | 1337 |
P41 | Yes | Blodgett Forest | Eldorado, Sierra Nevada | 39.912858 | −120.666114 | Black oak log | 1651 | 0 to 27 | 1337 |
P38 | No | Eldorado National Forest | Eldorado, Sierra Nevada | 38.830903 | −120.383638 | Douglas-fir log | 1651 | 0 to 27 | 1643 |
P40 | No | Eldorado National Forest | Eldorado, Sierra Nevada | 38.830903 | −120.383638 | Douglas-fir log | 1651 | 0 to 27 | 1643 |
Name | Nucleotide Sequence (5’–3’) | Reference | Region |
---|---|---|---|
GDP-14f | GTATCGTCCTCCGTAATGCTCTCCT | This study | glyceraldehyde-3-phosphate dehydrogenase (GPD) |
GDP-693r | GTCCTTGTTTGAGGGACCATCGAC | This study | glyceraldehyde-3-phosphate dehydrogenase (GPD) |
GDP-633f | TAC AAG GTC ATC TCG AAC GCG | This study | glyceraldehyde-3-phosphate dehydrogenase (GPD) |
GDP-1134r | GAC ACG ACC TTC TCA TCG GTG | This study | glyceraldehyde-3-phosphate dehydrogenase (GPD) |
GPD1 | AGCCTCTGCCCAYTTGAARG | [30] | glyceraldehyde-3-phosphate dehydrogenase (GPD) |
GPDR | RTANCCCCAYTCRTTRTCRTACCA | [30] | glyceraldehyde-3-phosphate dehydrogenase (GPD) |
ML5 | CTCGGCAAATTATCCTCATAAG | [68] | introns in the ML5–ML6 DNA region of the mitochondrial large ribosomal RNA (mt LrRNA) |
ML6 | CAGTAGAAGCTGCATAGGGTC | [68] | introns in the ML5–ML6 DNA region of the mitochondrial large ribosomal RNA (mt LrRNA) |
ATP6-34f | GGGTTAAATGCTCCCATTTTTGGT | This study | ATPase subunit 6 (atp6) |
ATP6-693r | TGAGAAAACGTAGGCTTGTATAAATGA | This study | ATPase subunit 6 (atp6) |
EF625f | GGACCGCTTCAACGAAATCG | This study | translation elongation factor 1-alpha (tef-1a) |
EF1437r | CTCGCCTCGATCACCTTACC | This study | translation elongation factor 1-alpha (tef-1a) |
EF983F | GCYCCYGGHCAYCGTGAYTTAT | [69] | translation elongation factor 1-alpha (tef-1a) |
EF-2218R | ATGACACCRACRGCRACRGTYTG | [69] | translation elongation factor 1-alpha (tef-1a) |
RPB1-29f | TGGACTGATGGATCCTCGGT | This study | RNA polymerase II subunit (rpb1) |
RPB1-1292r | TCGCCCAGTTTGTACGTCAA | This study | RNA polymerase II subunit (rpb1) |
PRB2-5f | TACCTCACAAACTTCCTCGTACG | This study | RNA polymerase II subunit (rpb2) |
RPB2-957r | ATGTGCTTCAGACGCTGATAGTA | This study | RNA polymerase II subunit (rpb2) |
ITS1F | CTTGGTCATTTAGAGGAAGTAA | [70] | internal transcribed spacer (nrITS) of nuclear ribosomal DNA |
ITS4 | TCCTCCGCTTATTGATATGC | [68] | internal transcribed spacer (nrITS) of nuclear ribosomal DNA |
Regions | Primers | PCR Protocol |
---|---|---|
ATP6 | ATP6-PGF | 95 °C 2 min; 34 cycles: 95 °C 30 s, 59.5 °C 30 s, 72 °C 2 min; 72 °C 5 min |
ATP6-PGR | ||
GPD (IV-V introns) | GPD-PGF1 | 95 °C 2 min; 34 cycles: 95 °C 30 s, 60 °C 30 s, 72 °C 2 min; 72 °C 5 min |
GPD-PGR1 | ||
GPD (VI Iintron) | GPD-PGF2 | 95 °C 2 min; 34 cycles: 95 °C 30 s, 59.5 °C 30 s, 72 °C 2 min; 72 °C 5 min |
GPD-PGR2 | ||
RPB1 | RPB1-PGF | 95 °C 2 min; 34 cycles: 95 °C 40 s, 57 °C 40 s, 72 °C 2 min; 72 °C 5 min |
RPB1-PGR | ||
RPB2 | PRB2-PGF | 95 °C 2 min; 34 cycles: 95 °C 30 s, 56 °C 30 s, 72 °C 2 min; 72 °C 5 min |
RPB2-PGR | ||
tef-1a | EF-PGF | 95 °C 2 min; 34 cycles: 95 °C 30 s, 57 °C 30 s, 72 °C 2 min; 72 °C 5 min |
EF-PGR |
GenBank Code | |||||||
---|---|---|---|---|---|---|---|
ID Code | ATP6 | ITS | ML5ML6 | EFA | RPB1 | rpb2 | GDP |
MVW11027 US-E AL 1 | MW052838 | MW055455 | MW067609 | MW074132 | MW168678 | MW239099 | MW272459 |
MVW11111 US-E AL 1 | MW052837 | MW055456 | MW067610 | MW074136 | MW168677 | MW239078 | MW272460 |
MVW23048A US-E GA 1 | MW052841 | MW055457 | MW067611 | MW074133 | MW168682 | MW239079 | MW272461 |
MVW24089A US-E GA 1 | MW052840 | MW055458 | MW067612 | MW074134 | MW168681 | MW239080 | MW272462 |
MVW31044B US-E GA 1 | MW052839 | MW055454 | MW067613 | MW074135 | MW168680 | MW239081 | MW272463 |
NCII US-E NC 1 | MW052836 | MW055459 | MW067614 | MW074137 | MW168675 | MW239082 | MW272464 |
P21 US-W CA 2 | MW052834 | MW055461 | MW067616 | MW074139 | MW168670 | MW239084 | MW272466 |
P22 US-W CA 2 | MW052833 | MW055462 | MW067617 | MW074140 | MW168669 | no | MW272467 |
P24 US-W CA 2 | MW052832 | MW055463 | MW067618 | MW074141 | MW168668 | MW239085 | MW272468 |
P26 US-W CA 2 | MW052831 | MW055464 | MW067619 | MW074142 | No | no | MW272469 |
P29 US-W CA 2 | MW052830 | No | MW067620 | no | No | MW239077 | MW272470 |
P39 US-W CA 2 | MW052829 | MW055465 | MW067621 | MW074143 | MW168664 | MW239086 | MW272471 |
P41 US-W CA 2 | MW052828 | MW055466 | MW067622 | MW074144 | MW168665 | MW239098 | MW272472 |
P9 US-W CA 2 | MW052835 | MW055460 | MW067615 | MW074138 | MW168671 | MW239083 | MW272465 |
PG0045 EU IT 3 | MW052826 | MW055468 | MW067624 | MW074146 | MW168683 | MW239088 | MW272474 |
PG16g EU IT 3 | MW052828 | MW055467 | MW067623 | MW074145 | MW168684 | MW239087 | MW272473 |
PG1862 EU CZ 3 | MW052825 | MW055469 | MW067625 | MW074147 | MW168686 | MW239089 | MW272475 |
PG1889 EU CZ 3 | MW052824 | MW055470 | MW067626 | MW074148 | MW168685 | MW239090 | MW272476 |
SC US-E SC 1 | MW052823 | MW055471 | MW067627 | MW074149 | MW168674 | MW239100 | MW272477 |
SCNC US-E GA 1 | MW052822 | MW055472 | MW067628 | MW074150 | MW168676 | MW239091 | MW272478 |
U-P22 US-W CA 2 | MW052819 | MW055476 | MW067632 | MW074152 | MW168679 | MW239094 | MW272480 |
U-P24 US-W CA 2 | MW052818 | MW055477 | MW067629 | MW074153 | MW168673 | MW239095 | MW272481 |
U-P26 US-W CA 2 | MW052817 | MW055474 | MW067633 | MW074155 | MW168672 | MW239096 | MW272482 |
U-P8 US-W CA 2 | MW052821 | MW055475 | MW067630 | MW074151 | MW168667 | MW239092 | MW272479 |
U-P9 US-W CA 2 | MW052820 | MW055473 | MW067631 | MW074154 | No | MW239093 | no |
VA_APP US-E VA 1 | MW052816 | MW055478 | MW067634 | MW074156 | MW168666 | MW239097 | MW272483 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dovana, F.; Gonthier, P.; Garbelotto, M. Inter- and Intra-Continental Genetic Variation in the Generalist Conifer Wood Saprobic Fungus Phlebiopsis gigantea. Forests 2021, 12, 751. https://doi.org/10.3390/f12060751
Dovana F, Gonthier P, Garbelotto M. Inter- and Intra-Continental Genetic Variation in the Generalist Conifer Wood Saprobic Fungus Phlebiopsis gigantea. Forests. 2021; 12(6):751. https://doi.org/10.3390/f12060751
Chicago/Turabian StyleDovana, Francesco, Paolo Gonthier, and Matteo Garbelotto. 2021. "Inter- and Intra-Continental Genetic Variation in the Generalist Conifer Wood Saprobic Fungus Phlebiopsis gigantea" Forests 12, no. 6: 751. https://doi.org/10.3390/f12060751