Design of Species-Specific Primers for Early Detection of Kretzschmaria zonata, the Causal Agent of Root and Neck Rot of Teak (Tectona grandis)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Isolation
2.2. Genomic DNA Isolation
2.3. Fungal DNA Sequencing
2.4. Design of Kretzschmaria zonata-Specific PCR Primers
2.5. Kretzschmaria zonata-Specific PCR Primers Amplification
2.6. The Sensitivity of Kretzschmaria zonata-Specific PCR Primers
2.7. Kretzschmaria zonata Detection on Symptomless Plants
3. Results
3.1. Fungal Isolates
3.2. Sequence Variation in ITS Region and Kretzschmaria zonata-Specific PCR Primer Design
3.3. Specificity and Sensitivity of the K. zonata Primer Sets
3.4. Kretzschmaria zonata Detection on Symptomless Plants
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nidavani, R.B.; Mahalakshmi, A.M. Teak (Tectona grandis Linn.): A renowned timber plant with potential medicinal values. Int. J. Pharm. Pharm. Sci. 2014, 6, 48–54. [Google Scholar]
- Ghareeb, M.A.; Hussein, A.H.; Hassan, M.F.M.; Laila, A.R.; Mona, A.M.; Amal, M.S. Antioxidant and cytotoxic activities of Tectona grandis Linn leaves. Int. J. Phytopharm. 2014, 5, 143–157. [Google Scholar]
- Balám-Che, M.; Gómez-Guerrero, A.; Vargas-Hernández, J.J.; Aldrete, A.; Obrador-Olán, J.J. Fertilización inicial de plantaciones comerciales de teca (Tectona grandis Linn F.) en el sureste de México. Rev. Fitotec. Mex. 2015, 38, 205–212. [Google Scholar] [CrossRef]
- Kaosa-ard, A. Teak (Tectona grandis Linn. f) its natural distribution and related factors. Nat. His. Bull. Siam. Soc. 1981, 29, 55–74. [Google Scholar]
- Nayeem, N.; Karvekkar, M.D. Isolation of phenolic compounds from the methanolic extract of Tectona grandis. Res. J. Pharm. Biol. Chem. Sci. 2010, 1, 221–225. [Google Scholar]
- Boedijn, K.B. The Uredinales of Indonesia. Nova Hedwig. 1960, 1, 463–494. [Google Scholar]
- Doilom, M.; Taylor, J.E.; Bhat, D.J.; Chukeatirote, E.; Hyde, K.; To-Anun, C.; Jones, E. Checklist of fungi on teak. Mycosphere 2016, 7, 656–678. [Google Scholar] [CrossRef]
- Mohanan, C. Bacterial diseases of teak (Tectona grandis Lf) in forest nurseries and plantations in Kerala and their management. Indian J. For. 2009, 32, 131–136. [Google Scholar]
- Borges, R.C.; Macedo, M.A.; Cabral, C.S.; Rossato, M.; Fontes, M.G.; Santos, M.D.; Ferreira, M.A.; Fonseca, M.E.; Reis, A.; Boiteux, L.S. Vascular wilt of teak (Tectona grandis) caused by Fusarium oxysporum in Brazil. Phytopathol. Mediterr. 2018, 57, 115–121. [Google Scholar]
- Bakshi, B.K.; Singh, S.; Singh, U. A new root rot disease complex in Teak. Indian For. 1966, 92, 566–569. [Google Scholar]
- Momoh, Z.O. Status of Root Rot Disease of Teak (Tectona grandis Linn. f.) in Nigeria. Proc. Natl. Acad. Sci. USA 1976, 22, 43–48. [Google Scholar] [CrossRef]
- Mohd Farid, A.; Lee, S.S.; Maziah, Z.; Rosli, H.; Norwati, M. Basal Root Rot, a new Disease of Teak (Tectona grandis) in Malaysia caused by Phellinus noxius. Malays J. Microbiol. 2005, 1, 40–45. [Google Scholar] [CrossRef]
- Borges, R.C.F.; Santos, M.D.M.; Macedo, M.A.; Martins, I.; Nascimento, A.G.; Café-Filho, A.C.; Boiteux, L.S.; Fonseca, M.E.N.; Inácio, C.A.; Mello, S.C.M. A trunk canker disease of Tectona grandis induced by Lasiodiplodia theobromae in Brazil. New Dis. Rep. 2015, 31, 26. [Google Scholar] [CrossRef] [Green Version]
- Daly, A.M.; Shivas, R.G.; Pegg, G.S.; Mackie, A.E. First record of teak leaf rust (Olivea tectonae) in Australia. Australas. Plant Dis. Notes 2006, 1, 25–26. [Google Scholar] [CrossRef] [Green Version]
- Kaneko, S.; Pham, T.Q.; Hiratsuka, Y. Notes on some rust fungi in Vietnam. Mycoscience 2007, 48, 263–265. [Google Scholar] [CrossRef]
- Perez, M.; Lopez, M.O.; Marti, O. Olivea tectonae, leaf rust of teak, occurs in Cuba. New Dis. Rep. 2008, 17, 32. [Google Scholar] [CrossRef]
- Cabral, P.G.C.; Capucho, A.S.; Pereira, O.L.; Maciel-Zambolim, E.; Freitas, R.L.; Zambolim, L. First report of teak leaf rust disease caused by Olivea tectonae in Brazil. Australas. Plant Dis. Notes 2010, 5, 113–114. [Google Scholar] [CrossRef]
- Coumans, J.V.F.; Harvey, J.; Backhouse, D.; Poljak, A.; Raftery, M.J.; Nehl, D.; Katz, M.E.; Pereg, L. Proteomic assessment of host-associated microevolution in the fungus Thielaviopsis basicola. Environ. Microbiol. 2011, 13, 576–588. [Google Scholar] [CrossRef]
- Borges, R.C.F.; Santos, M.D.M.; Macedo, M.A.; Martins, I.; Nascimento, A.G.; Boiteux, L.S.; Fonseca, M.E.N.; Mello, S.C.M. First report of a wilt disease of Tectona grandis caused by Thielaviopsis basicola in Brazil. New Dis. Rep. 2014, 30, 17. [Google Scholar] [CrossRef] [Green Version]
- Firmino, A.C.; Tozze, H.J., Jr.; Furtado, E.L. First report of Ceratocystis fimbriata causing wilt in Tectona grandis in Brazil. New Dis. Rep. 2012, 25, 24. [Google Scholar] [CrossRef] [Green Version]
- Murthy, N.; Lokesh, S. Impact of Cercospora apii on teak nursery and its management in vivo. Int. J. Agric. Sci. Res. 2013, 3, 47–54. [Google Scholar]
- West, J. A preliminary list of plant diseases in Nigeria. Kew Bull. 1938, 1, 17. [Google Scholar] [CrossRef]
- Cibrián Tovar, D.; Pérez Vera, O.A.; García Díaz, S.E.; Medel Ortiz, R.; Cibrián Tovar, J. Kretzschmaria zonata (Lév.) PMD Martin, causante de la pudrición del cuello y la raíz de teca. Rev. Mex. Cienc. For. 2014, 5, 110–118. [Google Scholar] [CrossRef] [Green Version]
- Alfenas, R.F.; Arenhart, M.L.; Alexandre, F.S.; Maitan-Alfenas, G.P. Root collar rot, a new lethal disease on Tectona grandis caused by Kretzschmaria zonata in Brazil. Plant Dis. 2021, 105, 221. [Google Scholar] [CrossRef] [PubMed]
- Situación Actual del Germoplasma Utilizado en los Programas de Plantaciones Forestales Comerciales en el Sureste de México. Available online: https://www.gob.mx/cms/uploads/attachment/file/246716/Situacion_actual_de_germoplasma_utilizado_en_los_proyectos_de_PFC_en_el_sureste.pdf (accessed on 18 September 2021).
- Tapia–Tussell, R.; Quijano-Ramayo, A.; Rojas-Herrera, R.; Larque-Saavedra, A.; Perez-Brito, D. A fast, simple, and reliable high-yielding method for DNA extraction from different plant species. Mol. Biotechnol. 2005, 31, 137–139. [Google Scholar] [CrossRef]
- Tapia-Tussell, R.; Lappe, P.; Ulloa, M.; Quijano-Ramayo, A.; Cáceres-Farfán, M.; Larqué-Saavedra, A.; Perez-Brito, D. A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes. Mol. Biotechnol. 2006, 33, 67–70. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Shinsky, J.J., White, T.J., Eds.; Academic Press Inc.: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Rozen, S.; Skaletsky, H.J. Primer3 on the WWW for general users and for biologists programmers. In Bioinformatics Methods Protocols: Methods in Molecular Biology; Krawetz, S., Misener, S., Eds.; Human Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Herrera, G.M.R.; González, S.G.M. A revision of the genus Kretzschmaria (Ascomycota, Xylariaceae) in Cuba. Willdenowia 2014, 44, 57–64. [Google Scholar] [CrossRef] [Green Version]
- Abraham, A.; Philip, S.; Jacob, S.K.; Jayachandran, K. Novel bacteria endophytes from Hevea brasiliensis as biocontrol agent against Phytophthora leaf fall disease. BioControl 2013, 58, 675–684. [Google Scholar] [CrossRef]
- Martinez-Culebras, P.V.; Querol, A.; Suarez-Fernandez, M.B.; Garcia-Lopez, M.D.; Barrio, E. Phylogenetic relationships among Colletotrichum pathogens of strawberry and design of PCR primers for their identification. J. Phytopathol. 2003, 151, 135–143. [Google Scholar] [CrossRef]
- Cibrián Tovar, D. Manual Para la Identificación y Manejo de Plagas en Plantaciones Forestales Comerciales; Comisión Nacional Forestal: Ciudad de México, México, 2016; pp. 16–21. Available online: http://www.conafor.gob.mx/biblioteca/Manuales-Tecnicos/Manual_para_la_identificacion_y_manejo_de_plagas_en_plantaciones_forestales.pdf (accessed on 11 January 2022).
Species | NCBI Accession Number |
---|---|
Kretzschmaria deusta | MH084755 |
Ustidina deusta | AF201718 |
Kretzschmaria hedjaroudei | MH084757 |
Kretzschmaria lucida | KP133208 |
Kretzschmaria clavus | KP133206 |
Kretzschmaria neocaledonica | GU300078 |
Kretzschmaria sandvicensis | KP133209 |
Kretzschmaria pavimentosa | MF770843 |
Kretzschmaria iranica | MH084758 |
Kretzschmaria quercicola | KX260114 |
Kretzschmaria zelandica | MN007020 |
Kretzschmaria megalospora | EF026124 |
Kretzschmaria guyanensis | GU300079 |
Kretzschmaria micropus | KJ154955 |
Ceratocystis fimbriata | AF264904 |
Fusarium solani | MF996559.1 |
Fusarium oxysporum | MT001892.1 |
Lasiodiplodia theobromae | KJ412514 |
Phellinus robustus | GU136220 |
Phellinus noxius | LN558877 |
Thielaviopsis basicola | KJ715965 |
Colletotrichum capsici | HM450126 |
Colletotrichum magnum | KT949407 |
Colletotrichum gloeosporioides | FN868840 |
Sample Number | K. zonata Strain Name | NCBI Accession Number | Origin |
---|---|---|---|
1 | krt-1 | MW015147.1 | Tizimin, Yucatán state |
2 | krt-2 | MW015744.1 | Tizimin, Yucatán state |
3 | krt-3 | MW018822.1 | Tizimin, Yucatán state |
4 | krt-4 | MW015747.1 | Tizimin, Yucatán state |
5 | krt-7 | MW015748.1 | Tizimin, Yucatán state |
6 | krt-8 | MW015749.1 | Tizimin, Yucatán state |
7 | krt-9 | MW018821.1 | Tizimin, Yucatán state |
8 | krt-10 | MW015755.1 | Candelaria, Campeche state |
9 | krt-11 | MW018823.1 | Huimanguillo, Tabasco state |
10 | krt-12 | MW018820.1 | Hopelchen, Campeche state |
11 | krt-13 | MW018819.1 | Huimanguillo, Tabasco state |
12 | krt-14 | MW015756.1 | Palenque, Chiapas state |
13 | krt-15 | MW015758.1 | Hopelchen, Campeche state |
14 | krt-16 | MW015759.1 | Palenque, Chiapas state |
15 | krt-17 | MW015760.1 | Huimanguillo, Tabasco state |
16 | krt-18 | MW018825.1 | Huimanguillo, Tabasco state |
17 | krt-19 | MW015761.1 | Hopelchen, Campeche state |
18 | krt-20 | MW018824.1 | Candelaria, Campeche state |
19 | krt-22 | KY660541.1 | Candelaria, Campeche state |
ID Primer | Sequence | Amplicon Size (bp 1) |
---|---|---|
KZ-AQ-1 | F: 5′GGCTCATCTATAGGCGAGATAGAATC 3′ | 525 |
R: 5′CCTGCGGAGGGATCATTAAAGA 3′ | ||
KZ-AQ-2 | F: 5′CGTAGGACCCTATCCTGTGTAA 3′ | 342 |
R: 5′GCTGTAGGCTCTCAACACTAAG 3′ | ||
KZ-AQ-3 | F: 5′GCAGCGAAATGCGATAAGTAATG 3′ | 241 |
R: 5′CGGCTCATCTATAGGCGAGATA 3′ | ||
KZ-AQ-4 | F: 5′GCTGTAGGCTCTCAACACTAAG 3′ | 342 |
R: 5′CGTAGGACCCTATCCTGTGTAA 3′ | ||
KZ-AQ-5 | F: 5′AAACCGACTCCGCCACTATT 3′ | 426 |
R: 5′TTACCTTCTGTTGCCTCGGC 3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Magaña-Álvarez, A.; Quijano-Ramayo, A.; Nexticapan-Garcéz, A.; Cibrián-Tovar, J.; Guardia-Chalé, S.; Sánchez-Rodríguez, Y.; Cortés-Velázquez, A.; Valencia-Yah, T.; Martín-Mex, R.; Ortega-Ramírez, M.E.; et al. Design of Species-Specific Primers for Early Detection of Kretzschmaria zonata, the Causal Agent of Root and Neck Rot of Teak (Tectona grandis). Forests 2022, 13, 1175. https://doi.org/10.3390/f13081175
Magaña-Álvarez A, Quijano-Ramayo A, Nexticapan-Garcéz A, Cibrián-Tovar J, Guardia-Chalé S, Sánchez-Rodríguez Y, Cortés-Velázquez A, Valencia-Yah T, Martín-Mex R, Ortega-Ramírez ME, et al. Design of Species-Specific Primers for Early Detection of Kretzschmaria zonata, the Causal Agent of Root and Neck Rot of Teak (Tectona grandis). Forests. 2022; 13(8):1175. https://doi.org/10.3390/f13081175
Chicago/Turabian StyleMagaña-Álvarez, Anuar, Andrés Quijano-Ramayo, Angel Nexticapan-Garcéz, José Cibrián-Tovar, Sandy Guardia-Chalé, Yasmín Sánchez-Rodríguez, Alberto Cortés-Velázquez, Teresita Valencia-Yah, Rodolfo Martín-Mex, Marynor Elena Ortega-Ramírez, and et al. 2022. "Design of Species-Specific Primers for Early Detection of Kretzschmaria zonata, the Causal Agent of Root and Neck Rot of Teak (Tectona grandis)" Forests 13, no. 8: 1175. https://doi.org/10.3390/f13081175