Selection of Reference Genes for Gene Expression Analysis in Acacia melanoxylon under Different Conditions
Abstract
:1. Introduction
2. Results
2.1. Primer Specificity and Amplification Efficiency Analysis
2.2. Expression Levels of Candidate Reference Genes
2.3. Expression Stability of the Candidate Reference Genes
2.3.1. ΔCt Algorithm
2.3.2. NormFinder Algorithm
2.3.3. GeNorm Algorithm
2.3.4. BestKeeper Algorithm
2.4. Comprehensive Stability Ranking of Reference Genes
2.5. Validation of the Stability of Reference Genes
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Treatments
4.2. RNA Extraction and cDNA Synthesis
4.3. Candidate Reference Genes Selection and Primer Design
4.4. RT-qPCR and Amplification Efficiency Analysis
4.5. Stability Assessment of Candidate Reference Genes
4.6. Validation of Reference Genes
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Wujeska-Klause, A.; Bossinger, G.; Tausz, M. The Concentration of Ascorbic Acid and Glutathione in 13 Provenances of Acacia melanoxylon. Tree Physiol. 2016, 36, 524–532. [Google Scholar] [CrossRef] [PubMed]
- Bradbury, G.J.; Potts, B.M.; Beadle, C.L. Genetic and Environmental Variation in Wood Properties of Acacia melanoxylon. Ann. For. Sci. 2011, 68, 1363–1373. [Google Scholar] [CrossRef]
- Kull, C.A.; Shackleton, C.M.; Cunningham, P.J.; Ducatillon, C.; Dufour-Dror, J.-M.; Esler, K.J.; Friday, J.B.; Gouveia, A.C.; Griffin, A.R.; Marchante, E.; et al. Adoption, Use and Perception of Australian Acacias around the World: Adoption, Use, and Perception of Australian Acacias. Divers. Distrib. 2011, 17, 822–836. [Google Scholar] [CrossRef]
- Machado, J.S.; Louzada, J.L.; Santos, A.J.A.; Nunes, L.; Anjos, O.; Rodrigues, J.; Simões, R.M.S.; Pereira, H. Variation of Wood Density and Mechanical Properties of Blackwood (Acacia melanoxylon R. Br.). Mater. Design 2014, 56, 975–980. [Google Scholar] [CrossRef]
- Searle, S.D. Acacia melanoxylon—A Review of Variation among Planted Trees. Aust. For. 2000, 63, 79–85. [Google Scholar] [CrossRef]
- Zhang, R.; Zeng, B.; Chen, T.; Hu, B. Genotype–Environment Interaction and Horizontal and Vertical Distributions of Heartwood for Acacia melanoxylon R.Br. Genes 2023, 14, 1299. [Google Scholar] [CrossRef] [PubMed]
- Zotz, G.; Wilhelm, K.; Becker, A. Heteroblasty—A Review. Bot. Rev. 2011, 77, 109–151. [Google Scholar] [CrossRef]
- Forster, M.A.; Bonser, S.P. Heteroblastic Development and the Optimal Partitioning of Traits among Contrasting Environments in Acacia implexa. Ann. Bot. 2009, 103, 95–105. [Google Scholar] [CrossRef]
- Forster, M.A.; Bonser, S.P. Heteroblastic Development and Shade-Avoidance in Response to Blue and Red Light Signals in Acacia implexa. Photochem. Photobiol. 2009, 85, 1375–1383. [Google Scholar] [CrossRef]
- Winn, A.A. The Functional Significance and Fitness Consequences of Heterophylly. Int. J. Plant Sci. 1999, 160, S113–S121. [Google Scholar] [CrossRef]
- Pinkard, E.A.; Beadle, C.L. Blackwood (Acacia melanoxylon R. Br.) Plantation Silviculture: A Review. Aust. For. 2002, 65, 7–13. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.; et al. The Need for Transparency and Good Practices in the qPCR Literature. Nat. Methods 2013, 10, 1063–1067. [Google Scholar] [CrossRef] [PubMed]
- VanGuilder, H.D.; Vrana, K.E.; Freeman, W.M. Twenty-Five Years of Quantitative PCR for Gene Expression Analysis. BioTechniques 2008, 44, 619–626. [Google Scholar] [CrossRef] [PubMed]
- Radonić, A.; Thulke, S.; Mackay, I.M.; Landt, O.; Siegert, W.; Nitsche, A. Guideline to Reference Gene Selection for Quantitative Real-Time PCR. Biochem. Bioph Res. Commun. 2004, 313, 856–862. [Google Scholar] [CrossRef] [PubMed]
- Kurkela, S.; Brown, D.W.G. Molecular Diagnostic Techniques. Medicine 2009, 37, 535–540. [Google Scholar] [CrossRef] [PubMed]
- Huggett, J.; Dheda, K.; Bustin, S.; Zumla, A. Real-Time RT-PCR Normalisation; Strategies and Considerations. Genes. Immun. 2005, 6, 279–284. [Google Scholar] [CrossRef] [PubMed]
- Joseph, J.T.; Poolakkalody, N.J.; Shah, J.M. Plant Reference Genes for Development and Stress Response Studies. J. Biosci. 2018, 43, 173–187. [Google Scholar] [CrossRef] [PubMed]
- Zhao, F.; Maren, N.A.; Kosentka, P.Z.; Liao, Y.-Y.; Lu, H.; Duduit, J.R.; Huang, D.; Ashrafi, H.; Zhao, T.; Huerta, A.I.; et al. An Optimized Protocol for Stepwise Optimization of Real-Time RT-PCR Analysis. Hortic. Res. 2021, 8, 179. [Google Scholar] [CrossRef]
- Sang, J.; Wang, Z.; Li, M.; Cao, J.; Niu, G.; Xia, L.; Zou, D.; Wang, F.; Xu, X.; Han, X.; et al. ICG: A Wiki-Driven Knowledgebase of Internal Control Genes for RT-qPCR Normalization. Nucleic Acids Res. 2018, 46, D121–D126. [Google Scholar] [CrossRef]
- Wang, X.; Wu, Z.; Bao, W.; Hu, H.; Chen, M.; Chai, T.; Wang, H. Identification and Evaluation of Reference Genes for Quantitative Real-Time PCR Analysis in Polygonum cuspidatum Based on Transcriptome Data. BMC Plant Biol. 2019, 19, 498. [Google Scholar] [CrossRef]
- Sankar, K.; Yoon, H.J.; Lee, Y.B.; Lee, K.Y. Evaluation of Reference Genes for Real-Time Quantitative PCR Analysis in Tissues from Bumble Bees (Bombus terrestris) of Different Lines. Int. J. Mol. Sci. 2022, 23, 14371. [Google Scholar] [CrossRef] [PubMed]
- Hu, A.; Yang, X.; Zhu, J.; Wang, X.; Liu, J.; Wang, J.; Wu, H.; Zhang, H.; Zhang, H. Selection and Validation of Appropriate Reference Genes for RT–qPCR Analysis of Nitraria sibirica under Various Abiotic Stresses. BMC Plant Biol. 2022, 22, 592. [Google Scholar] [CrossRef] [PubMed]
- Gutierrez, L.; Mauriat, M.; Gunin, S.; Pelloux, J.; Lefebvre, J.-F.; Louvet, R.; Rusterucci, C.; Moritz, T.; Guerineau, F.; Bellini, C.; et al. The Lack of a Systematic Validation of Reference Genes: A Serious Pitfall Undervalued in Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Analysis in Plants. Plant Biotechnol. J. 2008, 6, 609–618. [Google Scholar] [CrossRef]
- Tang, F.; Chu, L.; Shu, W.; He, X.; Wang, L.; Lu, M. Selection and Validation of Reference Genes for Quantitative Expression Analysis of miRNAs and mRNAs in Poplar. Plant Methods 2019, 15, 35. [Google Scholar] [CrossRef] [PubMed]
- Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of Housekeeping Genes for Gene Expression Studies in Human Reticulocytes Using Real-Time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef] [PubMed]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of Stable Housekeeping Genes, Differentially Regulated Target Genes and Sample Integrity: BestKeeper—Excel-Based Tool Using Pair-Wise Correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
- Pihur, V.; Datta, S.; Datta, S. RankAggreg, an R Package for Weighted Rank Aggregation. BMC Bioinform. 2009, 10, 62. [Google Scholar] [CrossRef]
- Gao, M.; Liu, Y.; Ma, X.; Shuai, Q.; Gai, J.; Li, Y. Evaluation of Reference Genes for Normalization of Gene Expression Using Quantitative RT-PCR under Aluminum, Cadmium, and Heat Stresses in Soybean. PLoS ONE 2017, 12, e0168965. [Google Scholar] [CrossRef]
- Han, B.; Yang, Z.; Samma, M.K.; Wang, R.; Shen, W. Systematic Validation of Candidate Reference Genes for qRT-PCR Normalization under Iron Deficiency in Arabidopsis. Biometals 2013, 26, 403–413. [Google Scholar] [CrossRef] [PubMed]
- De Almeida, M.R.; Ruedell, C.M.; Ricachenevsky, F.K.; Sperotto, R.A.; Pasquali, G.; Fett-Neto, A.G. Reference Gene Selection for Quantitative Reverse Transcription-Polymerase Chain Reaction Normalization during In Vitro Adventitious Rooting in Eucalyptus globulus Labill. BMC Mol. Biol. 2010, 11, 73. [Google Scholar] [CrossRef] [PubMed]
- Yan, H.; Zhang, Y.; Xiong, Y.; Chen, Q.; Liang, H.; Niu, M.; Guo, B.; Li, M.; Zhang, X.; Li, Y.; et al. Selection and Validation of Novel RT-qPCR Reference Genes under Hormonal Stimuli and in Different Tissues of Santalum album. Sci. Rep. 2018, 8, 17511. [Google Scholar] [CrossRef]
- Derveaux, S.; Vandesompele, J.; Hellemans, J. How to Do Successful Gene Expression Analysis Using Real-Time PCR. Methods 2010, 50, 227–230. [Google Scholar] [CrossRef] [PubMed]
- Lü, J.; Yang, C.; Zhang, Y.; Pan, H. Selection of Reference Genes for the Normalization of RT-qPCR Data in Gene Expression Studies in Insects: A Systematic Review. Front. Physiol. 2018, 9, 1560. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zhang, C.; Yang, H.; Lyu, L.; Li, W.; Wu, W. Selection and Validation of Candidate Reference Genes for Gene Expression Analysis by RT-qPCR in Rubus. Int. J. Mol. Sci. 2021, 22, 10533. [Google Scholar] [CrossRef] [PubMed]
- Song, H.; Mao, W.; Duan, Z.; Que, Q.; Zhou, W.; Chen, X.; Li, P. Selection and Validation of Reference Genes for Measuring Gene Expression in Toona ciliata under Different Experimental Conditions by Quantitative Real-Time PCR Analysis. BMC Plant Biol. 2020, 20, 450. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Beaulieu, J.-F.; Huggett, J.; Jaggi, R.; Kibenge, F.S.; Olsvik, P.A.; Penning, L.C.; Toegel, S. MIQE Précis: Practical Implementation of Minimum Standard Guidelines for Fluorescence-Based Quantitative Real-Time PCR Experiments. BMC Mol. Biol. 2010, 11, 74. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
- Hou, S.; Zhao, T.; Yang, D.; Li, Q.; Liang, L.; Wang, G.; Ma, Q. Selection and Validation of Reference Genes for Quantitative RT-PCR Analysis in Corylus heterophylla Fisch. × Corylus avellana L. Plants 2021, 10, 159. [Google Scholar] [CrossRef]
- Sun, H.; Jiang, X.; Sun, M.; Cong, H.; Qiao, F. Evaluation of Reference Genes for Normalizing RT-qPCR in Leaves and Suspension Cells of Cephalotaxus hainanensis under Various Stimuli. Plant Methods 2019, 15, 31. [Google Scholar] [CrossRef] [PubMed]
- Horiguchi, G.; Van Lijsebettens, M.; Candela, H.; Micol, J.L.; Tsukaya, H. Ribosomes and Translation in Plant Developmental Control. Plant Sci. 2012, 191–192, 24–34. [Google Scholar] [CrossRef] [PubMed]
- Dai, F.; Zhao, X.; Tang, C.; Wang, Z.; Kuang, Z.; Li, Z.; Huang, J.; Luo, G. Identification and Validation of Reference Genes for qRT-PCR Analysis in Mulberry (Morus alba L.). PLoS ONE 2018, 13, e0194129. [Google Scholar] [CrossRef] [PubMed]
- Máthé, C.; M-Hamvas, M.; Freytag, C.; Garda, T. The Protein Phosphatase PP2A Plays Multiple Roles in Plant Development by Regulation of Vesicle Traffic—Facts and Questions. Int. J. Mol. Sci. 2021, 22, 975. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Xu, J.; Deng, Y.; Sun, H.; Li, Y. Selection of Reference Genes for Normalization of Cranberry (Vaccinium macrocarpon Ait.) Gene Expression under Different Experimental Conditions. PLoS ONE 2019, 14, e0224798. [Google Scholar] [CrossRef]
- Zhang, J.-R.; Feng, Y.-Y.; Yang, M.-J.; Xiao, Y.; Liu, Y.-S.; Yuan, Y.; Li, Z.; Zhang, Y.; Zhuo, M.; Zhang, J.; et al. Systematic Screening and Validation of Reliable Reference Genes for qRT-PCR Analysis in Okra (Abelmoschus esculentus L.). Sci. Rep. 2022, 12, 12913. [Google Scholar] [CrossRef] [PubMed]
- Guo, R.; Guo, H.; Zhang, Q.; Guo, M.; Xu, Y.; Zeng, M.; Lv, P.; Chen, X.; Yang, M. Evaluation of Reference Genes for RT-qPCR Analysis in Wild and Cultivated cannabis. Biosci. Biotechnol. Biochem. 2018, 82, 1902–1910. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Chu, Z.; Wang, H.; Wang, G.; Wu, S.; Yang, Y. Selection and Validation of Reference Genes for Quantitative Real-Time PCR in Cymbidium sinense. BioTechniques 2022, 72, 51–59. [Google Scholar] [CrossRef]
- Dash, P.K.; Rai, R.; Pradhan, S.K.; Shivaraj, S.M.; Deshmukh, R.; Sreevathsa, R.; Singh, N.K. Drought and Oxidative Stress in Flax (Linum usitatissimum L.) Entails Harnessing Non-Canonical Reference Gene for Precise Quantification of qRT-PCR Gene Expression. Antioxidants 2023, 12, 950. [Google Scholar] [CrossRef]
- Sudhakaran, S.; Thakral, V.; Padalkar, G.; Rajora, N.; Dhiman, P.; Raturi, G.; Sharma, Y.; Tripathi, D.K.; Deshmukh, R.; Sharma, T.R.; et al. Significance of Solute Specificity, Expression, and Gating Mechanism of Tonoplast Intrinsic Protein during Development and Stress Response in Plants. Physiol. Plant. 2021, 172, 258–274. [Google Scholar] [CrossRef]
- Reddy, D.S.; Bhatnagar-Mathur, P.; Reddy, P.S.; Cindhuri, K.S.; Ganesh, A.S.; Sharma, K.K. Identification and Validation of Reference Genes and Their Impact on Normalized Gene Expression Studies across Cultivated and Wild Cicer Species. PLoS ONE 2016, 11, e0148451. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Tan, Z.; Hu, B.; Yang, Z.; Xu, B.; Zhuang, L.; Huang, B. Selection and Validation of Reference Genes for Target Gene Analysis with Quantitative RT-PCR in Leaves and Roots of Bermudagrass under Four Different Abiotic Stresses. Physiol. Plant. 2015, 155, 138–148. [Google Scholar] [CrossRef] [PubMed]
- Qu, R.; Miao, Y.; Cui, Y.; Cao, Y.; Zhou, Y.; Tang, X.; Yang, J.; Wang, F. Selection of Reference Genes for the Quantitative Real-Time PCR Normalization of Gene Expression in Isatis indigotica Fortune. BMC Mol. Biol. 2019, 20, 9. [Google Scholar] [CrossRef] [PubMed]
- Zhou, T.; Yang, X.; Fu, F.; Wang, G.; Cao, F. Selection of Suitable Reference Genes Based on Transcriptomic Data in Ginkgo biloba under Different Experimental Conditions. Forests 2020, 11, 1217. [Google Scholar] [CrossRef]
- Hong, S.-Y.; Seo, P.J.; Yang, M.-S.; Xiang, F.; Park, C.-M. Exploring Valid Reference Genes for Gene Expression Studies in Brachypodium distachyonby Real-Time PCR. BMC Plant Biol. 2008, 8, 112. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Hu, S.; Cao, Y.; Chen, R.; Wang, Z.; Cao, X. Selection and Evaluation of Reference Genes for qRT-PCR of Scutellaria baicalensis Georgi under Different Experimental Conditions. Mol. Biol. Rep. 2021, 48, 1115–1126. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Qi, X.; Yan, H.; Huang, L.; Nie, G.; Zhang, X. Reference Gene Selection for Quantitative Real-Time Reverse-Transcriptase PCR in Annual Ryegrass (Lolium multiflorum) Subjected to Various Abiotic Stresses. Molecules 2018, 23, 172. [Google Scholar] [CrossRef]
- Guo, Y.; Zhang, S.; Yuan, Q. Deubiquitinating Enzymes and Bone Remodeling. Stem Cells Int. 2018, 2018, e3712083. [Google Scholar] [CrossRef]
- Radjacommare, R.; Usharani, R.; Kuo, C.-H.; Fu, H. Distinct Phylogenetic Relationships and Biochemical Properties of Arabidopsis Ovarian Tumor-Related Deubiquitinases Support Their Functional Differentiation. Front. Plant Sci. 2014, 5, 84. [Google Scholar] [CrossRef]
- Greaves, J.; Chamberlain, L.H. DHHC Palmitoyl Transferases: Substrate Interactions and (Patho) Physiology. Trends Biochem. Sci. 2011, 36, 245–253. [Google Scholar] [CrossRef]
- Wang, Y.; Yang, W. Proteome-Scale Analysis of Protein S-Acylation Comes of Age. J. Proteome Res. 2021, 20, 14–26. [Google Scholar] [CrossRef] [PubMed]
- Long, L.; Gu, L.; Wang, S.; Cai, H.; Wu, J.; Wang, J.; Yang, M. Progress in the Understanding of WRKY Transcription Factors in Woody Plants. Int. J. Biol. Macromol. 2023, 242, 124379. [Google Scholar] [CrossRef] [PubMed]
- Wani, S.H.; Anand, S.; Singh, B.; Bohra, A.; Joshi, R. WRKY Transcription Factors and Plant Defense Responses: Latest Discoveries and Future Prospects. Plant Cell Rep. 2021, 40, 1071–1085. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Mao, Y.; Huang, S.; Ni, J.; Lu, W.; Hou, J.; Wang, Y.; Zhao, W.; Li, M.; Wang, Q.; et al. Selection of Suitable Reference Genes for Quantitative Real-Time PCR in Sapium sebiferum. Front. Plant Sci. 2017, 8, 637. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Yang, Z.; Hu, Y.; Tan, J.; Jia, J.; Xu, H.; Chen, X. Reference Genes Selection for Quantitative Gene Expression Studies in Pinus massoniana L. Trees 2016, 30, 685–696. [Google Scholar] [CrossRef]
- Kubista, M.; Andrade, J.M.; Bengtsson, M.; Forootan, A.; Jonák, J.; Lind, K.; Sindelka, R.; Sjöback, R.; Sjögreen, B.; Strömbom, L.; et al. The Real-Time Polymerase Chain Reaction. Mol. Asp. Med. 2006, 27, 95–125. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Gene Symbol | Gene ID | Gene Description | Forward/Reverse Primer (5′-3′) | Amplicon Length (bp) | Primers TM (°C) | E (%) | R2 |
---|---|---|---|---|---|---|---|
ACT7 | evm.model.Chr8.816 | actin 7 | F:AGATTCCGCTACCCAGAAG R:AGCCGCCACTTAGAACAAT | 148 | 56.94/ 57.44 | 103.47 | 0.991 |
OTUD6B | evm.model.Chr7.1946 | deubiquitinase OTUD6B | F:TCCTTCCCAGATGTTGAGAT R:TAGTCCAAATGCGTGCTTAT | 105 | 57.06/ 56.02 | 105.49 | 1.000 |
EF1a | evm.model.Chr7.4292 | elongation factor1-alpha | F:AAGTATGCCTGGGTTCTTGA R:TGATGAAGTCTCTGTGTCCTG | 136 | 57.27/ 56.29 | 106.15 | 0.998 |
PAT10 | evm.model.Chr3.3020 | protein S-acyltransferase 10 | F: CTGGTCTGTGTAGCCGTTCT R:GGAGGAAATGGAGGTAACAA | 138 | 57.96/ 56.57 | 91.07 | 1.000 |
PP2a | evm.model.Chr3.536 | protein phosphatase 2a | F:AAGAGTTTGGTCCTGAGTGG R:CAAGCAGAGAGACAGCGTTA | 114 | 56.78/ 56.96 | 105.96 | 0.999 |
RPL4 | evm.model.Chr8.89 | 60S ribosomal protein L4-like | F:AAAGGCAAGATGAGAAATCG R:ATAACGAACCTCCCAAGATG | 179 | 57.03/ 56.6 | 103.59 | 0.999 |
TIP41 | evm.model.Chr10.2641 | tonoplast intrinsic protein | F:TAGGCACAGAGCGAAGAAAT R:TCAAAGTCTCAATCTCCCAAC | 156 | 57.73/ 56.81 | 106.11 | 1.000 |
TUB2 | evm.model.Chr3.2570 | beta-tubulin | F:CACCATCCAGTTTGTTGACT R:ACAGCCCTCTGAACCTTG | 108 | 55.94/ 56.2 | 103.02 | 0.999 |
UBI3 | evm.model.Chr3.1463 | ubiquitin 3 | F:AGCAGCGTCTCATCTTCG R:ATCTTCTTGGGCTTGGTGTA | 154 | 57.71/ 57.27 | 103.88 | 0.998 |
UBI11 | evm.model.Chr10.2426 | ubiquitin 11 | F:AGATTCCGCTACCCAGAAG R:AGCCGCCACTTAGAACAAT | 148 | 56.5/ 56.6 | 104.81 | 1.000 |
Rank | DCV | SD ± CV | DTO | SD ± CV | LDGS | SD ± CV | PEG | SD ± CV |
---|---|---|---|---|---|---|---|---|
1 | PAT10 | 0.43 ± 1.90 | RPL4 | 0.51 ± 2.57 | TIP41 | 0.47 ± 2.12 | UBI11 | 0.64 ± 3.75 |
2 | TIP41 | 0.43 ± 1.93 | UBI11 | 0.61 ± 3.34 | PAT10 | 0.47 ± 2.14 | UBI3 | 0.68 ± 3.63 |
3 | UBI3 | 0.45 ± 2.38 | PP2a | 0.65 ± 3.08 | PP2a | 0.47 ± 2.25 | TUB2 | 0.81 ± 3.16 |
4 | RPL4 | 0.48 ± 2.43 | TIP41 | 0.72 ± 3.14 | EF1a | 0.48 ± 2.19 | PP2a | 0.82 ± 3.96 |
5 | ACT7 | 0.49 ± 1.81 | EF1a | 0.77 ± 3.37 | UBI11 | 0.63 ± 3.58 | ACT7 | 0.87 ± 3.13 |
6 | OTUD6B | 0.57 ± 2.68 | PAT10 | 0.83 ± 3.55 | OTUD6B | 0.66 ± 3.12 | OTUD6B | 0.89 ± 4.26 |
7 | PP2a | 0.59 ± 2.80 | UBI3 | 1.01 ± 5.09 | UBI3 | 0.69 ± 3.73 | PAT10 | 0.93 ± 4.02 |
8 | EF1a | 0.63 ± 2.85 | ACT7 | 1.24 ± 4.53 | RPL4 | 0.77 ± 4.06 | EF1a | 0.93 ± 4.16 |
9 | UBI11 | 0.78 ± 4.36 | OTUD6B | 1.33 ± 6.35 | ACT7 | 0.97 ± 3.77 | RPL4 | 1.04 ± 5.19 |
10 | TUB2 | 1.79 ± 8.04 | TUB2 | 1.43 ± 5.84 | TUB2 | 1.27 ± 5.22 | TIP41 | 1.07 ± 4.67 |
Rank | HT | SD ± CV | ST | SD ± CV | GA | SD ± CV | ET | SD ± CV |
1 | UBI11 | 0.39 ± 2.22 | TIP41 | 0.66 ± 2.89 | RPL4 | 0.73 ± 3.59 | UBI3 | 0.46 ± 2.38 |
2 | PAT10 | 0.63 ± 2.70 | ACT7 | 0.70 ± 2.61 | PAT10 | 0.77 ± 3.32 | RPL4 | 0.62 ± 3.12 |
3 | TIP41 | 0.66 ± 2.93 | PAT10 | 0.70 ± 3.04 | UBI11 | 0.83 ± 4.84 | PP2a | 0.69 ± 3.23 |
4 | UBI3 | 0.68 ± 3.65 | RPL4 | 0.71 ± 3.53 | UBI3 | 0.86 ± 4.50 | EF1a | 1.39 ± 5.94 |
5 | RPL4 | 0.72 ± 3.57 | TUB2 | 0.74 ± 2.74 | ACT7 | 0.87 ± 3.08 | TUB2 | 1.45 ± 5.74 |
6 | OTUD6B | 0.74 ± 3.52 | PP2a | 0.80 ± 3.80 | TIP41 | 0.88 ± 3.85 | UBI11 | 1.92 ± 10.30 |
7 | PP2a | 0.83 ± 4.04 | EF1a | 0.83 ± 3.70 | PP2a | 0.92 ± 4.36 | PAT10 * | 0.88 ± 3.90 |
8 | EF1a | 0.97 ± 4.29 | UBI11 | 0.98 ± 5.67 | OTUD6B | 1.01 ± 4.67 | TIP41 * | 1.88 ± 8.70 |
9 | TUB2 * | 0.78 ± 2.89 | UBI3 | 1.01 ± 5.15 | TUB2 | 1.23 ± 4.66 | ACT7 * | 2.45 ± 9.10 |
10 | ACT7 * | 1.20 ± 4.34 | OTUD6B | 1.45 ± 7.15 | EF1a | 1.36 ± 5.91 | OTUD6B * | 3.19 ± 13.77 |
Rank | IAA | SD ± CV | ASs | SD ± CV | ETHs | SD ± CV | All | SD ± CV |
1 | PAT10 | 0.50 ± 2.16 | UBI11 | 0.65 ± 3.78 | UBI3 | 0.65 ± 3.40 | RPL4 | 0.55 ± 2.75 |
2 | TIP41 | 0.52 ± 2.24 | PAT10 | 0.74 ± 3.19 | RPL4 | 0.69 ± 3.45 | PP2a | 0.59 ± 2.80 |
3 | OTUD6B | 0.58 ± 2.72 | TIP41 | 0.79 ± 3.47 | PP2a | 0.74 ± 3.51 | PAT10 | 0.60 ± 2.61 |
4 | PP2a | 0.60 ± 2.88 | RPL4 | 0.82 ± 4.09 | PAT10 | 0.75 ± 3.27 | TIP41 | 0.62 ± 2.74 |
5 | UBI3 | 0.66 ± 3.39 | UBI3 | 0.83 ± 4.38 | TIP41 | 1.07 ± 4.74 | UBI3 | 0.66 ± 3.49 |
6 | UBI11 | 0.66 ± 3.78 | PP2a | 0.84 ± 4.04 | EF1a | 1.19 ± 5.17 | UBI11 | 0.78 ± 4.44 |
7 | RPL4 | 0.71 ± 3.48 | TUB2 | 0.91 ± 3.44 | UBI11 | 1.19 ± 6.72 | EF1a | 0.80 ± 3.55 |
8 | EF1a | 0.80 ± 3.54 | EF1a | 0.96 ± 4.29 | TUB2 | 1.29 ± 4.94 | OTUD6B | 0.90 ± 4.23 |
9 | TUB2 * | 0.65 ± 2.42 | ACT7 | 0.98 ± 3.59 | ACT7 | 1.34 ± 4.86 | ACT7 | 1.00 ± 3.67 |
10 | ACT7 * | 0.81 ± 2.94 | OTUD6B | 1.02 ± 4.92 | OTUD6B | 1.44 ± 6.54 | TUB2 | 1.54 ± 6.05 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Z.; Bai, X.; Li, X.; Zeng, B.; Hu, B. Selection of Reference Genes for Gene Expression Analysis in Acacia melanoxylon under Different Conditions. Forests 2023, 14, 2245. https://doi.org/10.3390/f14112245
Chen Z, Bai X, Li X, Zeng B, Hu B. Selection of Reference Genes for Gene Expression Analysis in Acacia melanoxylon under Different Conditions. Forests. 2023; 14(11):2245. https://doi.org/10.3390/f14112245
Chicago/Turabian StyleChen, Zhaoli, Xiaogang Bai, Xiangyang Li, Bingshan Zeng, and Bing Hu. 2023. "Selection of Reference Genes for Gene Expression Analysis in Acacia melanoxylon under Different Conditions" Forests 14, no. 11: 2245. https://doi.org/10.3390/f14112245