Next Article in Journal
Remote Sensing Applications in Monitoring Poplars: A Review
Previous Article in Journal
A Deformable Shape Model for Automatic and Real-Time Dendrometry
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 14
Issue 12
10.3390/f14122300
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Analysis of the Expression Patterns of 13 DREB Family Genes Related to Cone-Setting Genes in Hybrid Larch (Larix kaempferi × Larix olgensis)

by
Daixi Xu
,
Junfei Hao
,
Chen Wang
,
Lei Zhang
* and
Hanguo Zhang
*
State Key Laboratory of Tree Genetics and Breeding, Northeast Forestry University, Harbin 150040, China
*
Authors to whom correspondence should be addressed.
Forests 2023, 14(12), 2300; https://doi.org/10.3390/f14122300
Submission received: 28 September 2023 / Revised: 18 November 2023 / Accepted: 22 November 2023 / Published: 23 November 2023
(This article belongs to the Section Genetics and Molecular Biology)
Browse Figures
Versions Notes

Abstract

:
AP2/ERF is an important transcription factor family involved in physiological processes such as plant development and hormone signaling. In this study, based on the available transcriptome data of hybrid larch during floral induction, 13 DREB genes belonging to the AP2/EREBP family with complete CDS regions were identified through alignment using the NCBI website. We conducted a bioinformatics analysis on the gene sequences, examining their tissue specificity, response to hormone treatment, and response to environmental factors. The DREB genes in hybrid larch (Larix kaempferi × Larix olgensis) showed tissue-specific expression, with DREB7, DREB8, DREB10, DREB12, and DREB13 exhibiting higher expression levels in nascent buds and higher expression in female cones compared to male cones. They also showed high expression during signal convergence and floral induction, and were highly expressed in materials with good fertility, suggesting their positive role in the cone-setting process of hybrid larch. Additionally, 13 DREB genes were all induced by abscisic acid (ABA), gibberellin 3 (GA3), and indoleacetic acid (IAA), with the most pronounced expression changes observed after ABA treatment, indicating that these genes might be mainly regulated by ABA. In response to temperature and photoperiod treatments, DREB7, DREB8, DREB10, DREB12, and DREB13 showed significant responses, with increased expression levels induced by low temperature, while no clear pattern was observed after long or short-day treatments. These results of the study provide a reference for understanding the function of the DREB gene family in hybrid larch, offer a theoretical basis for inducing floral bud differentiation in hybrid larch, and contribute to a better understanding of the molecular mechanisms underlying cone-setting in hybrid larch.

1. Introduction

Transcription factors are proteins that play crucial roles in regulating various aspects of plant growth and development, as well as in responding to environmental stresses [1,2]. In higher plants, approximately 60 transcription factor families have been identified [3]. One of the largest and most important families is the AP2/ERF family, which is widely involved in plant growth and development, reproductive development [4], hormone signaling, and response to biotic [5] and abiotic stresses [6]. Larch trees (Larix spp.) hold significant economic and ecological value [7]. The hybrid species between Japanese larch (L. kaempferi) and Korean larch (L. olgensis) combines the characteristics of its parent species and exhibits significant hybrid vigor. It performs well in terms of growth rate, adaptability, and wood quality [8], making it one of the main tree species for afforestation in the northern regions of China. Currently, seed orchards are unable to provide a consistent and stable supply of seeds, thus it is necessary to conduct research on the cone-setting induction mechanism of larch.
The induction of cone-setting in hybrid larches refers to the formation of reproductive organs in hybrid larches, which belong to the gymnosperms, a group of coniferous trees. Flowers of hybrid larches are not conventional flowers in the sense of floral organs, but rather their reproductive organs. The process of exposing their reproductive organs is called flowering. For hybrid larches, their male reproductive organ is formed by the aggregation of microsporophylls (stamens), which is also known as a microsporophyll sphere or staminate cone. The female reproductive organ is formed by the cluster or aggregation of megasporophylls (ovules), which is also known as an ovule-bearing cone or pistillate cone [9]. Therefore, the induction of the formation of male and female cones in hybrid larches is referred to as the induction of flowering. Flowering induction is a complex process that is jointly controlled by endogenous factors (hormones) and exogenous factors (such as temperature and light) [10], and it is a critical stage in the reproduction of higher plants. Currently, research and understanding of the mechanism of flowering induction mainly focus on annual or biennial model plants such as Arabidopsis (Arabidopsis thaliana) [11] and rice (Oryza sativa) [12]. However, for gymnosperms with large genomes and long growth cycles, there is less related research on the mechanism of cone-setting induction [13], and further exploration is needed.
In the preliminary stage of the laboratory experiment, the floral induction period in hybrid larch was identified through anatomical observations [14]. It was found that the AP2 gene family was significantly enriched during the floral induction period, with 14 DREB genes showing significant differences among different fertility materials. This suggests their potential involvement in the floral induction of hybrid larch. Through the alignment of conserved domains and screening of open reading frames (ORFs), a total of 13 full-length DREB genes were obtained. In this study, the selected 13 DREB differentially expressed genes were subjected to bioinformatics analysis, including identification and analysis of their physicochemical properties and evolutionary relationships. The tissue expression patterns of these 13 genes were analyzed using real-time fluorescence quantitative PCR, and the expression of this gene family was examined under the influence of hormones and environmental factors. This analysis can help us understand their roles in systematic development and hybrid larch floral bud differentiation processes.

2. Materials and Methods

2.1. Materials and Processing

The hybrid larch seeds used as experimental materials were obtained from the hybrid larch second-generation asexual seed garden at Qingshan National Hybrid Larch Seed Base in Linkou County, Heilongjiang Province. After three months of sowing, seedlings with vigorous growth and consistent development were selected for further treatment. Hormone treatment: The larch seedlings were separately irrigated with a concentration of 50 mg/L of GA3, IAA, and ABA, with normal watering as the control (CK). The whole larch seedlings were then collected at 0, 12, 24, 48, and 96 h after the treatment. Photoperiod treatment: Long-day treatment consisted of 16 h of light and 8 h of darkness, while short-day treatment consisted of 8 h of light and 16 h of darkness. After 14 days, whole larch seedlings were sampled. Temperature treatment: 25 °C (room temperature) was used as the control, and 8 °C was used as the low-temperature treatment. Whole larch seedlings were sampled after 8 h of treatment. After sampling, all the aforementioned treatments were rapidly frozen with liquid nitrogen and stored in a −80 °C freezer for future use. Three replicates were set, with three larch seedlings sampled each time.
Hybrid larch callus tissue, 3-month-old seedlings, and nascent buds, needles, male cones, and female cones of hybrid larch trees were collected for sampling. After sampling, they were rapidly frozen with liquid nitrogen and stored in a −80 °C freezer for future use. These materials were used for gene expression analysis in different tissue organs.
For each of the seven stages of flower bud development, three untreated buds from three natural growth clones were collected, and the transcriptome data were sourced from our laboratory’s RNA-seq data uploaded to the CDCB database (cncb.ac.cn) (login number: CRA007780). The transcriptome data for the cone-setting induction stage of hybrid larch were also sourced from RNA-seq data uploaded by our laboratory to the CDCB database (cncb.ac.cn) (Login number: CRA007533).

2.2. Experimental Methods

2.2.1. Bioinformatics Analysis

Using the NCBI database (https://www.ncbi.nlm.nih.gov/, accessed on 4 July 2023) and UniPort, the 13 DREB genes were aligned, and homologous sequences from other species were obtained for phylogenetic analysis. The MEGA 7.0 software was used to construct the phylogenetic tree using the neighbor-joining method with a bootstrap value of 1000. Protein domain analysis was performed using the SMART tool (http://smart.embl-heidelberg.de, accessed on 7 July 2023). MEME Version 5.4.1 (http://meme-suite.org/tools/meme, accessed on 28 August 2023) was used to predict conserved protein motifs. Physicochemical properties were calculated using the ExPASy online tool (https://web.expasy.org/protparam/, accessed on 10 July 2023). Secondary and tertiary protein structures were analyzed using the SOPMA and SWISS MODEL online tools, respectively. Signal peptide prediction was conducted using the iPSORT website (https://ipsort.hgc.jp/predict.cgi, accessed on 14 July 2023). Transmembrane structure prediction was performed using TMHMM (https://services.healthtech.dtu.dk/service.php?TMHMM-2.0, accessed on 24 July 2023). Subcellular localization prediction analysis was carried out on the WoLFPSORT website (https://wolfpsort.hgc.jp/, accessed on 28 July 2023).

2.2.2. Real-Time Fluorescent Quantitative PCR

Real-time fluorescent quantitative PCR was used to analyze the expression patterns of 13 hybrid larch DREB genes in different tissues, as well as their expression patterns under hormone treatment and environmental factors. The PureLinkTM Plant RNA Reagent kit was used for RNA extraction from the hybrid larch samples. The extracted RNA was reverse transcribed into cDNA using the ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO) kit. Specific quantitative primers for the genes were designed using Primer5 software (Table 1), the internal reference gene was the Larix olgensis gene [15] (the gene number on the NCBI database is MF278617.1) named LoB80280. The fluorescent quantitative reagent used was the SYBR Premix Ex TaqII (Tli RNaseH Plus) kit from TaKaRa. A qTOWER3G real-time fluorescent quantitative gene amplification was used, and a melt curve analysis was conducted at the end of the reaction. Data analysis was performed using Microsoft Excel 2016, and the relative expression levels of genes were calculated using the 2−∆∆CT formula. Graphs were plotted using GraphPad Prism10 software.

3. Results

3.1. Bioinformatics Characterization of 13 DREB Family Genes

The physicochemical analysis results of the hybrid larch DREB family proteins (Table 2) indicate that the amino acid numbers of the 13 genes range from 137 to 424aa, with DREB4 having the highest and DREB7 having the lowest number of amino acids. The molecular weight ranges from 15,801.45 Da to 44,945.48 Da. The isoelectric points of the proteins range from 4.80 to 11.33, with 5 genes having an isoelectric point greater than 7 and 8 genes having an isoelectric point less than 7, indicating a higher proportion of acidic amino acids. The hydrophobicity coefficients are all higher than 48.04, reflecting the high thermal stability of these DREB family proteins. The average hydrophobicity coefficients are negative, indicating that these DREB family proteins are hydrophilic. The instability coefficients are all greater than 40, indicating that the proteins in this family are unstable. According to signal peptide analysis, only the DREB7 protein in the DREB family has a signal peptide, while the others do not, indicating that all except DREB7 are non-secretory proteins. According to the protein transmembrane analysis, only the DREB10 protein has two transmembrane helical structures, while the others are non-transmembrane proteins.
The prediction of the secondary and tertiary structural features of the 13 DREB family genes in hybrid larch revealed that there are similarities in the amino acid sequences. The major components of the proteins in this family consist of alpha-helix structures and irregular curls, while the extended folding regions are dispersed within the individual amino acid chains. Supplementary Materials (Figure S1) and Table 3 provide information about the proportions of these structural features in each DREB family gene. Among the 13 genes, DREB5 has the largest proportion of alpha-helices, while DREB8 has the smallest proportion. On the other hand, DREB9 has the largest proportion of irregular curls, while DREB7 has the smallest. Lastly, DREB7 has the largest proportion of extended folding regions, whereas DREB1 has the smallest proportion.

3.2. Phylogenetic and Conserved Structural Domain Analysis

Through Blast, the 13 DREB proteins in hybrid larch were subjected to homology analysis, obtaining protein sequences with higher homology to hybrid larch DREB proteins from species such as Larix olgensis, Arabidopsis thaliana, Nicotiana tabacum, Juglans regia. A phylogenetic tree of evolutionary development was constructed using the neighbor-joining method in the MEGA 7.0 software (Figure 1). From the perspective of the results of a phylogenetic tree, the 13 DREB proteins are mainly distributed among 6 branches. The homology of DREB1–6 to Arabidopsis is relatively higher than other plants in their respective branches; DREB7–13 mainly cluster with their own internal proteins, forming two branches, especially DREB13 shows high homology with Larix olgensis ERF017. The motif analysis results (Figure 1) revealed that among the 10 identified motifs, motif1 and motif3 are shared motifs.

3.3. Analysis of Expression Patterns in Different Tissue Organs

The expression patterns of the 13 DREB family genes in different tissues were analyzed using real-time fluorescence quantitative PCR. The results (Figure 2) showed that half of the genes (DREB1, 3, 4, 5, 6, and 11) exhibited the highest expression in male reproductive organs. The next highly expressed genes were found in nascent buds, including DREB7, 8, 12, and 13. DREB2 and DREB9 showed high expression levels in seedlings, while DREB10 was most highly expressed in female reproductive organs.

3.4. Changes in Gene Expression during the Developmental Stages of Flower Buds

In the dynamic transcriptome analysis of different developmental stages of nascent buds, a significant difference was observed before and after the stage of floral organ formation in early August, indicating a distinct shift in the expression patterns of related genes during cone-setting induction and floral organ development stages (Figure 3), DREB3, DREB5, and DREB6 showed weak expression in the early to mid-July, early-August, and mid-August periods, with a significant increase in expression from mid-August to early September. The remaining genes demonstrated a consistent trend of decreasing and then increasing expression from early July to mid-July and early August, followed by a rapid decrease after mid-August.

3.5. Analysis of Gene Expression Pattern under Hormone Treatment

Larch seedlings were treated with 50 mg/L of ABA, GA3, and IAA for 0, 12, 24, 48, and 96 h, respectively.
The results of the ABA treatment (Figure 4) showed that DREB1, DREB5, DREB9, and DREB10 were initially up-regulated at 24 h of treatment, followed by a rapid decline, and then showed another up-regulation after 96 h of treatment. On the other hand, DREB3, DREB4, DREB6, and DREB8 displayed a similar expression pattern, with a significant up-regulation in the first 48 h of ABA treatment. DREB7 and DREB11 exhibited a different expression trend. They were rapidly up-regulated by ABA at 12 h, followed by a decrease, and then another up-regulation after 96 h of treatment. DREB12 and DREB13 were found to be up-regulated by ABA at 12, 48, and 96 h. DREB2 showed significant induction by ABA at 12 and 48 h.
The results of the GA3 treatment (Figure 5) showed that all 13 genes showed some level of response to GA3 treatment, but most of the effects were small. DREB2, DREB4, DREB6, DREB9, DREB10, DREB11, DREB12, and DREB13 had down-regulated expression during the treatment. DREB1, DREB3, DREB5, DREB7, and DREB8 were consistently up-regulated at all times of the GA3 treatment.
The results of the IAA treatment (Figure 6) showed that, in general, most DREB genes in hybrid larch were induced by IAA to a certain extent. In addition, the expression levels of almost every gene were suppressed at certain time points by IAA. However, the gene expression levels were not fully suppressed by IAA throughout the entire treatment, but rather exhibited decreased expression levels within 96 h of IAA treatment. The up-regulation of DREB genes was mainly observed at 12 h and 96 h of treatment. For down-regulation, except for DREB3, which did not show down-regulation, DREB8 was the most inhibited and had the lowest expression at 24 h. The other 11 genes were most inhibited and had the lowest expression at 48 h.

3.6. Analysis of Gene Expression Patterns under the Influence of Environmental Factors

The results of the photoperiodic treatments (Figure 7) showed that DREB1, DREB5, DREB7, DREB9, DREB12, and DREB13 showed high expression levels under short-day treatment, while DREB2 and DREB6 exhibited high expression levels under long-day treatment. The expression levels of the remaining genes differ by less than two-fold under long and short-day treatments and are thus considered to be indistinguishable.
The results of the temperature treatment (Figure 8) showed that the majority of DREB genes demonstrated significantly higher expression levels under low-temperature treatment compared to room temperature conditions. Only DREB2 displayed higher expression at room temperature than under low-temperature treatment.

4. Discussion

4.1. Identification and Physicochemical Characterization of the DREB Gene Family in Hybrid Larch

Members of the AP2/ERF family play a role in various aspects of plant growth and development, including flower development, hormone signaling, and cell differentiation., they are also involved in responses to both biotic and abiotic stressors [16]. These transcription factors typically contain at least one AP2 structural domain, which is a conserved sequence of amino acids [17]. The AP2/ERF family is further divided into five subfamilies based on the number and arrangement of structural domains and the degree of sequence similarity. These subfamilies are AP2, ERF, DREB, RAV, and Soloist [18]. The DREB subfamily within the AP2/ERF family is associated with the regulation of abiotic stress responses, such as cold and drought. The DREB proteins bind to specific cis-acting elements in the DNA, usually the CCGAC sequence, to regulate the expression of genes involved in stress response and phytohormone signaling, particularly ABA [19]. Currently, although the identification of the AP2/ERF gene family is mostly focused on angiosperms such as Poplar trichocarpa [20] and Triticum aestivum [21], there is relatively limited research on related genes in gymnosperms. Furthermore, based on Nilsson et al.’s study on the AP2 gene in Picea abies, it was found that the function of the AP2 gene is conserved in both gymnosperms and angiosperms [22]. Due to these reasons, we conducted an analysis on the AP2/ERF gene family in hybrid larch. By combining the results of transcriptome sequencing of hybrid larch and the identification using ORF Finder data, we obtained 13 hybrid larch DREB genes belonging to the AP2/ERF gene family with complete open reading frames. It is worth noting that the number of DREB genes in hybrid larch is lower compared to other species like Arabidopsis, which has 57 DREB genes [18], rice has 57 DREB genes [23], and Poplar tomentosa has 77 DREB genes [24], indicating species-specific differences in the AP2/ERF gene family and the DREB genes. This also indicates that there are some differences between different species and that the DREB gene family has been eliminated or added during the evolutionary process.
In the analysis of the physicochemical properties of hybrid larch DREB proteins, it was found that most of these proteins share similar physicochemical properties, with only a few differences, indicating that they have overall similarities in their biological functions, with some minor functional differences. The motif analysis results showed that the hybrid larch DREB protein family shares motif 1, which is RAYD, mainly regulating the strength of YRG elements binding to DNA, and motif 3, which is YRG, facilitating DNA binding [25]. These motifs together constitute the conserved structural domain of the AP2/ERF family proteins. Furthermore, although there are significant differences in the types and numbers of motifs among members of the DREB family, proteins within the same branch show a high degree of similarity in the types and numbers of motifs they contain. This result further confirms the reliability of the evolutionary tree branching relationship of the hybrid larch DREB protein family and provides a reference for further research on the functions of this protein family in the growth, development, and gene regulation of hybrid larch.

4.2. Analysis of Tissue-Specific Expression and Floral Bud Development Stage Expression of DREB Genes in Hybrid Larch

Based on the data on gene expression from the transcriptome of hybrid larch, the transcription levels of 13 DREB family genes were analyzed in callus tissues, seedlings, nascent buds, needles, female cones, and male cones. Overall, the DREB genes in hybrid larch exhibited tissue-specific expression patterns, consistent with studies conducted in other plants such as soybean (Glycine max) [26]. Among them, DREB1 and DREB13 showed a certain level of expression in all tissues, while the remaining genes exhibited very low or no expression in certain tissues. DREB7, 8, 10, 12, and 13 showed high expression in new shoots and higher expression levels in female cones compared to male cones. Previous studies have shown that these genes are highly expressed in materials with good fertility (Figure 9). These results suggest that these genes may not only be closely associated with nascent bud growth but also contribute to female cone formation, promoting increased fruit set [14]. DREB2 and DREB9, which exhibited the highest expression levels during the seedling stage, showed very low or no expression in nascent buds and other tissues. Considering their higher expression levels in materials with poor fertility, it is speculated that DREB2 and DREB9 have inhibitory effects on cone-setting. DREB1, 3, 4, 5, 6, and 11 exhibited the highest expression levels in male cones, and they were distributed in both materials with good and poor fertility, indicating their close association with male cone growth and development but no obvious direct relationship with female cone quantity.
According to previous research, it has been found that the period before August is the period of signal accumulation and cone-setting induction, while the period after August is the period of organ development [14]. Therefore, the floral bud development stage is divided into the first three periods and the last four periods for differential analysis, revealing clear patterns. DREB1, 2, 4, 7, 8, 9, 10, 11, 12, and 13 showed significantly higher expression levels in the first three periods compared to the last four periods, suggesting their potential involvement in signal transduction and cone-setting induction. On the other hand, DREB3, DREB5, and DREB6 showed higher expression levels in the last four periods, which may be their potential role as organ development genes.

4.3. Analysis of the Differential Expression of DREB Genes in Hybrid Larch under Hormone Treatments and Environmental Factors

Plant hormones such as IAA, ABA, and GA participate in complex signal transduction pathways, influencing the expression of numerous genes in different organs and at different stages [27,28]. They play roles in regulating plant growth, development, and defense responses. Previous research has shown that ABI4, a member of the DREB family in Arabidopsis, is involved in ABA signaling transduction and seed development [29]. Overexpression of the DREB gene DBF2 in maize not only suppresses the basal promoter activity of downstream genes but also inhibits the action of ABA [30]. The rice DREB gene ARAG1 is involved in ABA signal transduction [31], and the cloned rice DREB transcription factor OsDREB1F, in response to exogenous ABA treatment, also participates in the ABA signal transduction pathway [32]. These studies indicate a close association between the plant hormone ABA and DREB proteins, which is consistent with the findings of this study. In this study, based on the gene expression levels after treatment with three different hormones, the DREB family genes exhibited the most significant changes in expression under ABA treatment, indicating their responsiveness to ABA. Except for DREB2, which showed a downregulation period, the expression of other genes was induced to varying degrees by ABA. Under IAA treatment, DREB3, 5, and 8 showed the greatest changes in expression, while other genes did not show a strong response. This finding is consistent with the study on tomato fruit development, which found that IAA signal induction only affected the expression of certain DREB genes [33]. Furthermore, DREB7, 8, 10, 12, and 13, which may promote floral bud differentiation, showed a consistent trend in expression changes under IAA treatment (initial increase, followed by decrease, and then increase again), with high expression levels at 12 h and 96 h. According to previous research, under GA3 treatment, the expression levels of most TmERF genes in Taxus × media were similar to CK and did not show significant changes [34]. Additionally, there is a certain synergistic effect between gibberellins and other growth regulators in inducing and promoting the cone-setting process of coniferous trees [35,36]. This may also be the reason why GA3 can regulate DREB family genes but with minimal changes in expression. Taken together, these results suggest that DREB genes may be involved in multiple hormone signaling pathways to regulate the growth and development of hybrid larch. The biological clock has an influence on regulating plant gene expression, growth, and development [37], and photoperiod is a key signal that regulates the biological clock. In this study, hybrid larch seedlings were subjected to long and short-day treatments, and it was found that 13 DREB genes could be induced by photoperiod. Among them, DREB2 and DREB6 showed significant upregulation under long-day conditions, while DREB7 showed significant upregulation under short-day conditions. For DREB7, 8, 10, 12, and 13, which may promote floral bud differentiation, although they are also regulated by photoperiod, there was no clear pattern in the effect of long and short-day treatments on the expression levels of these five genes. Based on known research, Dubouzet et al. isolated five DREB homologous genes from rice, among which OsDREB1A and OsDREB1B are induced by low temperatures [38]. TaDREB1 in wheat also shows higher expression under low-temperature induction [39]. PeDREB28 in bamboo is rapidly and strongly induced to reach the highest level under low temperatures [40]. The transcription products of two DREB genes, CnDREB3-1 and CnDREB3-2, in chrysanthemum increase in expression during cold stress [41]. Homologs of DREBs induced by low temperatures have also been found in white spruce and Japanese cedar [42]. In this study, except for DREB2, which had high expression at room temperature, the others were induced by low temperature and showed significant upregulation in expression, indicating that the DREB genes in hybrid larch can respond to low temperature, which is consistent with the aforementioned research.

5. Conclusions

In conclusion, 13 DREB family genes were identified from the transcriptome data of hybrid larch during the cone-setting induction stage into four major evolutionary branches. Through analysis of gene physicochemical properties and protein conserved motifs, it was found that members within the same evolutionary branch of hybrid larch exhibited structural similarities. Based on expression pattern analysis of different tissue organs and hormonal and environmental factors, it was inferred that DREB7, 8, 10, 12, and 13 may play a promoting role in flower bud differentiation and are significantly induced by ABA and low temperature. This study utilized existing transcriptome data of hybrid larch to identify and analyze the DREB gene family, providing theoretical references for further research on inducing flower bud differentiation in hybrid larch.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/f14122300/s1, Figure S1. Predicted secondary and tertiary structure of DREB transcription factor family gene protein.

Author Contributions

Conceptualization, L.Z. and H.Z.; validation, D.X.; formal analysis, D.X. and J.H.; investigation, D.X., J.H. and C.W.; data curation, D.X.; writing—original draft preparation, D.X.; writing—review and editing, L.Z. and H.Z.; visualization, D.X. and J.H.; project administration, H.Z.; funding acquisition, H.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key R&D Program of China: Breeding and New Germplasm Creation of Fast-Growing Cold-Resistant Deciduous Pine Varieties in Cold Temperate Mountainous Regions (No. 2022YFD220030202).

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

This work was supported by the staff of Qingshan Larch National Improved Seed Base in Linkou County. We also thank Qing Cao and QingRong Zhao for assisting with the experiment.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Shinozaki, K.; Yamaguchi-Shinozaki, K.; Seki, M. Regulatory network of gene expression in the drought and cold stress responses. Curr. Opin. Plant Biol. 2003, 6, 410–417. [Google Scholar] [CrossRef] [PubMed]
  2. Riechmann, J.L.; Heard, J.; Martin, G.; Reuber, L.; Jiang, C.Z.; Keddie, J.; Adam, O.; Pineda, O.J.; Ratcliffe, R.R.; Samaha, R. Arabidopsis transcription factors: Genome-wide comparative analysis among eukaryotes. Science 2000, 290, 2105–2110. [Google Scholar] [CrossRef] [PubMed]
  3. Jin, J.; Tian, F.; Yang, D.C.; Meng, Y.Q.; Kong, L.; Luo, J.; Gao, G. PlantTFDB 4.0: Toward a central hub for transcription factors and regulatory interactions in plants. Nucleic Acids Res. 2017, 45, D1040–D1045. [Google Scholar] [CrossRef] [PubMed]
  4. Zahn, L.M.; Feng, B.; Ma, H. Beyond the ABC-model: Regulation of floral homeotic genes. Adv. Bot. Res. 2006, 44, 163–207. [Google Scholar]
  5. Krizek, B. AINTEGUMENTA and AINTEGUMENTA-LIKE6 act redundantly to regulate Arabidopsis floral growth and patterning. Plant Physiol. 2009, 150, 1916–1929. [Google Scholar] [CrossRef] [PubMed]
  6. Zhou, L.; Yarra, R. Genome-wide identification and characterization of AP2/ERF transcription factor family genes in oil palm under abiotic stress conditions. Int. J. Mol. Sci. 2021, 22, 2821. [Google Scholar] [CrossRef] [PubMed]
  7. Li, A.; Yu, X.; Cao, B.B.; Peng, L.X.; Gao, Y.; Feng, T.; Li, H.; Ren, Z.Y. LkAP2L2, an AP2/ERF transcription factor gene of Larix kaempferi, with pleiotropic roles in plant branch and seed development. Russ. J. Genet. 2017, 53, 1335–1342. [Google Scholar] [CrossRef]
  8. Pâques, L.E.; Millier, F.; Rozenberg, P. Selection perspectives for genetic improvement of wood stiffness in hybrid larch (Larix x eurolepis Henry). Tree Genet. Genomes 2010, 6, 83–92. [Google Scholar] [CrossRef]
  9. Christenhusz, M.J.; Reveal, J.L.; Farjon, A.; Gardner, M.F.; Mill, R.R.; Chase, M.W. A new classification and linear sequence of extant gymnosperms. Phytotaxa 2011, 19, 55–70. [Google Scholar] [CrossRef]
  10. Boss, P.K.; Bastow, R.M.; Mylne, J.S.; Dean, C. Multiple pathways in the decision to flower: Enabling, promoting, and resetting. Plant Cell 2004, 16, S18–S31. [Google Scholar] [CrossRef]
  11. Srikanth, A.; Schmid, M. Regulation of flowering time: All roads lead to Rome. Cell. Mol. Life Sci. 2011, 68, 2013–2037. [Google Scholar] [CrossRef] [PubMed]
  12. Rashid, M.; Guangyuan, H.; Guangxiao, Y.; Hussain, J.; Xu, Y. AP2/ERF transcription factor in rice: Genome-wide canvas and syntenic relationships between monocots and eudicots. Evol. Bioinform. 2012, 8, 321–355. [Google Scholar] [CrossRef] [PubMed]
  13. Akhter, S.; Westrin, K.J.; Zivi, N.; Nordal, V.; Kretzschmar, W.W.; Delhomme, N.; Street, N.R.; Nilsson, O.; Emanuelsson, O.; Sundström, J.F. Cone-setting in spruce is regulated by conserved elements of the age-dependent flowering pathway. New Phytol. 2022, 236, 1951–1963. [Google Scholar] [CrossRef] [PubMed]
  14. Hao, J.F.; Wang, C.; Gu, C.R.; Xu, D.X.; Zhang, L.; Zhang, H.G. Anatomical observation and transcriptome analysis of buds reveal the association between the AP2 gene family and reproductive induction in hybrid larch (Larix kaempferi × Larix olgensis). Tree Physiol. 2023, 43, 118–129. [Google Scholar] [CrossRef] [PubMed]
  15. An, P.; Qin, R.; Zhao, Q.; Li, X.; Wang, C.; Cao, Q.; Zhang, H.; Zhang, L. Genetic transformation of LoHDZ2 and analysis of its function to enhance stress resistance in Larix olgensis. Sci. Rep. 2022, 12, 12831. [Google Scholar] [CrossRef] [PubMed]
  16. Nole-Wilson, S.; Krizek, B.A. DNA binding properties of the Arabidopsis floral development protein AINTEGUMENTA. Nucleic Acids Res. 2000, 28, 4076–4082. [Google Scholar] [CrossRef] [PubMed]
  17. Jofuku, K.D.; Den Boer, B.G.; Van Montagu, M.; Okamuro, J.K. Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant Cell 1994, 6, 1211–1225. [Google Scholar]
  18. Nakano, T.; Suzuki, K.; Fujimura, T.; Shinshi, H. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol. 2006, 140, 411–432. [Google Scholar] [CrossRef]
  19. Yamaguchi-Shinozaki, K.; Shinozaki, K. A novel cis-acting element in an Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high-salt stress. Plant Cell 1994, 6, 251–264. [Google Scholar]
  20. Zhuang, J.; Cai, B.; Peng, R.H.; Zhu, B.; Jin, X.F.; Xue, Y.; Gao, F.; Fu, X.Y.; Tian, Y.S.; Zhao, W. Genome-wide analysis of the AP2/ERF gene family in Populus trichocarpa. Biochem. Biophys. Res. Commun. 2008, 371, 468–474. [Google Scholar] [CrossRef]
  21. Zhao, Y.; Ma, R.; Xu, D.; Bi, H.; Xia, Z.; Peng, H. Genome-wide identification and analysis of the AP2 transcription factor gene family in wheat (Triticum aestivum L.). Front. Plant Sci. 2019, 10, 1286. [Google Scholar] [CrossRef]
  22. Nilsson, L.; Carlsbecker, A.; Sundås-Larsson, A.; Vahala, T. APETALA2 like genes from Picea abies show functional similarities to their Arabidopsis homologues. Planta 2007, 225, 589–602. [Google Scholar] [CrossRef] [PubMed]
  23. Sharoni, A.M.; Nuruzzaman, M.; Satoh, K.; Shimizu, T.; Kondoh, H.; Sasaya, T.; Choi, I.; Omura, T.; Kikuchi, S. Gene structures, classification and expression models of the AP2/EREBP transcription factor family in rice. Plant Cell Physiol. 2011, 52, 344–360. [Google Scholar] [CrossRef] [PubMed]
  24. Zhang, J.; Shi, S.Z.; Jiang, Y.; Zhong, F.; Liu, G.; Yu, C.; Lan, B.; Chen, Y. Genome-wide investigation of the AP2/ERF superfamily and their expression under salt stress in Chinese willow (Salix matsudana). PeerJ 2021, 9, e11076. [Google Scholar] [CrossRef] [PubMed]
  25. Okamuro, J.K.; Caster, B.; Villarroel, R.; Van Montagu, M.; Jofuku, K.D. The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis. Proc. Natl. Acad. Sci. USA 1997, 94, 7076–7081. [Google Scholar] [CrossRef] [PubMed]
  26. Zhou, Y.; Zhou, W.; Liu, H.; Liu, P.; Li, Z. Genome-wide analysis of the soybean DREB gene family: Identification, genomic organization and expression profiles in response to drought stress. Plant Breed. 2020, 139, 1158–1167. [Google Scholar] [CrossRef]
  27. Samir, A.S.E.-Y.; Mohamed, A.S.E.-Y.; Emad, F.D.; Mostafa, M.R. Phytohormone crosstalk research: Cytokinin and its crosstalk with other phytohormones. Curr. Protein Pept. Sci. 2015, 16, 395–405. [Google Scholar]
  28. Davies, P.J. Plant Hormones and Their Role in Plant Growth and Development; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2012. [Google Scholar]
  29. Finkelstein, R.R.; Wang, M.L.; Lynch, T.J.; Rao, S.; Goodman, H.M. The Arabidopsis abscisic acid response locus ABI4 encodes an APETALA2 domain protein. Plant Cell 1998, 10, 1043–1054. [Google Scholar] [CrossRef] [PubMed]
  30. Kizis, D.; Pagès, M. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway. Plant J. 2002, 30, 679–689. [Google Scholar] [CrossRef]
  31. Zhao, L.; Hu, Y.; Chong, K.; Wang, T. ARAG1, an ABA-responsive DREB gene, plays a role in seed germination and drought tolerance of rice. Ann. Bot. 2010, 105, 401–409. [Google Scholar] [CrossRef]
  32. Wang, Q.; Guan, Y.; Wu, Y.; Chen, H.; Chen, F.; Chu, C. Overexpression of a rice OsDREB1F gene increases salt, drought, and low temperature tolerance in both Arabidopsis and rice. Plant Mol. Biol. 2008, 67, 589–602. [Google Scholar] [CrossRef] [PubMed]
  33. Zhang, L.; Chen, L.; Pang, S.; Zheng, Q.; Quan, S.; Liu, Y.; Xu, T.; Liu, Y.D.; Qi, M. Function analysis of the ERF and DREB subfamilies in tomato fruit development and ripening. Front. Plant Sci. 2022, 13, 849048. [Google Scholar] [CrossRef] [PubMed]
  34. Zhang, K.; Jiang, L.; Wang, X.; Han, H.; Chen, D.; Qiu, D.; Yang, Y. Transcriptome-wide analysis of AP2/ERF transcription factors involved in regulating Taxol biosynthesis in Taxus × media. Ind. Crops Prod. 2021, 171, 113972. [Google Scholar] [CrossRef]
  35. Luukkanen, O.; Johansson, S. Effect of exogenous gibberellins on flowering in Pinus sylvestris grafts. Physiol. Plant. 1980, 50, 365–370. [Google Scholar] [CrossRef]
  36. Tompsett, P.B.; Fletcher, A.M. Promotion of flowering on mature Picea sitchensis by gibberellin and environmental treatments. The influence of timing and hormonal concentration. Physiol. Plant. 1979, 45, 112–116. [Google Scholar] [CrossRef]
  37. Kreps, J.A.; Kay, S.A. Coordination of plant metabolism and development by the circadian clock. Plant Cell 1997, 9, 1235. [Google Scholar] [CrossRef] [PubMed]
  38. Dubouzet, J.G.; Sakuma, Y.; Ito, Y.; Kasuga, M.; Dubouzet, E.G.; Miura, S.; Shinozaki, K.; Yamaguchi-Shinozaki, K. OsDREB genes in rice, Oryza sativa L., encode transcription activators that function in drought-, high-salt-and cold-responsive gene expression. Plant J. 2003, 33, 751–763. [Google Scholar] [CrossRef] [PubMed]
  39. Shen, Y.G.; Zhang, W.K.; He, S.J.; Zhang, J.S.; Liu, Q.; Chen, S.Y. An EREBP/AP2-type protein in Triticum aestivum was a DRE-binding transcription factor induced by cold, dehydration and ABA stress. Theor. Appl. Genet. 2003, 106, 923–930. [Google Scholar] [CrossRef]
  40. Hu, X.; Liang, J.; Wang, W.; Cai, C.; Ye, S.; Wang, N.; Han, F.; Wu, Z.; Zhu, Q. Comprehensive genome-wide analysis of the DREB gene family in Moso bamboo (Phyllostachys edulis): Evidence for the role of PeDREB28 in plant abiotic stress response. Plant J. 2023. [Google Scholar] [CrossRef]
  41. Gao, C.; Li, P.; Song, A.; Wang, H.; Wang, Y.; Ren, L.; Qi, X.; Chen, F.; Jiang, J.; Chen, S. Isolation and characterization of six AP2/ERF transcription factor genes in Chrysanthemum nankingense. Int. J. Mol. Sci. 2015, 16, 2052–2065. [Google Scholar] [CrossRef]
  42. Chang, C.Y.Y.; Bräutigam, K.; Hüner, N.P.; Ensminger, I. Champions of winter survival: Cold acclimation and molecular regulation of cold hardiness in evergreen conifers. New Phytol. 2021, 229, 675–691. [Google Scholar] [CrossRef] [PubMed]
Forests 14 02300 g001
Figure 1. Phylogenetic tree of DREB proteins and analysis of conserved motifs of DREB proteins.
Figure 1. Phylogenetic tree of DREB proteins and analysis of conserved motifs of DREB proteins.
Forests 14 02300 g001
Forests 14 02300 g002
Figure 2. Expression of 13 DREB genes in different organs and tissues.
Figure 2. Expression of 13 DREB genes in different organs and tissues.
Forests 14 02300 g002
Forests 14 02300 g003
Figure 3. Changes of 13 DREB genes expression in bud development. (FPKM: the fragments per kilobase of exon model per million mapped fragments.)
Figure 3. Changes of 13 DREB genes expression in bud development. (FPKM: the fragments per kilobase of exon model per million mapped fragments.)
Forests 14 02300 g003
Forests 14 02300 g004
Figure 4. Expression levels of 13 DREB genes under ABA treatment.
Figure 4. Expression levels of 13 DREB genes under ABA treatment.
Forests 14 02300 g004
Forests 14 02300 g005
Figure 5. Expression levels of 13 DREB genes under GA3 treatment.
Figure 5. Expression levels of 13 DREB genes under GA3 treatment.
Forests 14 02300 g005
Forests 14 02300 g006
Figure 6. Expression levels of 13 DREB genes under IAA treatment.
Figure 6. Expression levels of 13 DREB genes under IAA treatment.
Forests 14 02300 g006
Forests 14 02300 g007
Figure 7. Expression levels of 13 DREB genes under long-day and short-day conditions.
Figure 7. Expression levels of 13 DREB genes under long-day and short-day conditions.
Forests 14 02300 g007
Forests 14 02300 g008
Figure 8. Expression levels of 13 DREB genes in response to low-temperature exposure.
Figure 8. Expression levels of 13 DREB genes in response to low-temperature exposure.
Forests 14 02300 g008
Forests 14 02300 g009
Figure 9. Difference in expression of DREB genes related to larch cone-setting in needles and nascent buds. (CKN1: Needle Control 1, CKN2: Needle Control 2, DhN1: Needle Overcone-setting 1, DhN2: Needle Overcone-setting 2, CKB1: Nascent Bud Control 1, CKB2: Nascent Bud Control 2, DhB1: Nascent Bud Overcone-setting 1, DhB2: Nascent Bud Overcone-setting 2).
Figure 9. Difference in expression of DREB genes related to larch cone-setting in needles and nascent buds. (CKN1: Needle Control 1, CKN2: Needle Control 2, DhN1: Needle Overcone-setting 1, DhN2: Needle Overcone-setting 2, CKB1: Nascent Bud Control 1, CKB2: Nascent Bud Control 2, DhB1: Nascent Bud Overcone-setting 1, DhB2: Nascent Bud Overcone-setting 2).
Forests 14 02300 g009
Table 1. The primers used in real-time fluorescent quantitative PCR.
Table 1. The primers used in real-time fluorescent quantitative PCR.
Gene NameForward and Reverse Primers (5′-3′)
DREB1GGAATGCGTTATCTGTGCTGTTCAATGTTGGCAGTTTGTG
DREB2GAATGGCCTCCAATAGAAAAATCATCCCTCGCAGAAAG
DREB3CCCTTGACCTTGTGGAGATGGATTCATTGATTCGTTCCCT
DREB4TACGGATCAGCTTCCACAGAGTCATCGCCATTATCTCCA
DREB5TACTGTTCCTCCTTGTTCGAGACCATAATAATCATCCGTTTC
DREB6TTACGCCACAATGACTCCAAAGCTGACCCTTCTCCTCC
DREB7CACGATCACGCTCCTTTGTTGCTGTCATGGCCGTTCTGTT
DREB8GCGATTCTGGATTCACCACCCAGGTCCCAGTCTTCCGTCA
DREB9CGGCGTGTTCATCTTCCAATCGCAATCGTCCAGACCTTCA
DREB10TGCGTCTTCTCTTTCCCGTCTGAAACCGAAGCCAATCTTGA
DREB11TTCGGTTTCGGAAATGGAGTCCGCAAAGTCGGATAGAGGT
DREB12CCTTCCACTTCGCCCTCTTCGGCACCCACTGCTGTCAAAC
DREB13CCGAAGCAGATTCAGCATGTTCTTCATCGGTCTTGTAGGC
LoB80280GCCGTGCTGCTGGATAATGAGGTGTCTGGAACTCAGTCACATCAACG
Table 2. Physicochemical properties of DREB transcription factor family genes.
Table 2. Physicochemical properties of DREB transcription factor family genes.
GeneNumber of Amino AcidsMolecular Weight (Da)Theoretical PIAliphatic IndexGrand Average of HydropathicityInstability IndexSignal PeptideTransmembrane
DREB123626,114.448.6179.03−0.50157.87NonNon
DREB248754,184.425.8957.62−0.77265.79NonNon
DREB333035,118.075.0170.52−0.29249.32NonNon
DREB442444,945.485.0358.54−0.48074.05NonNon
DREB526229,494.025.8664.58−0.63445.38NonNon
DREB619021,356.988.6668.37−0.56263.52NonNon
DREB713715,801.4511.3384.67−0.32660.05OneNon
DREB817919,514.904.8069.89−0.35348.66NonNon
DREB922425,821.837.7448.04−0.88960.23NonNon
DREB1029934,025.055.4174.52−0.46359.65NonTwo
DREB1119721,891.335.3264.52−0.69566.17NonNon
DREB1221023,310.918.3458.62−0.61855.03NonNon
DREB1323326,129.165.8775.54−0.63869.49NonNon
Table 3. Secondary structure characteristics of DERB transcription factor family gene proteins.
Table 3. Secondary structure characteristics of DERB transcription factor family gene proteins.
Gene NameAlpha Helix (Hh)Extended Strand (Ee)Random Coil (Cc)
DREB139.83%8.90%49.15%
DREB223.82%15.40%55.44%
DREB331.82%11.82%53.64%
DREB424.76%13.68%56.37%
DREB541.22%13.36%39.31%
DREB637.37%11.58%47.37%
DREB727.01%27.01%37.96%
DREB821.79%13.97%59.78%
DREB923.21%10.71%62.95%
DREB1032.11%14.72%50.50%
DREB1125.38%10.66%61.42%
DREB1222.38%14.76%60.00%
DREB1331.33%9.44%57.51%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xu, D.; Hao, J.; Wang, C.; Zhang, L.; Zhang, H. Analysis of the Expression Patterns of 13 DREB Family Genes Related to Cone-Setting Genes in Hybrid Larch (Larix kaempferi × Larix olgensis). Forests 2023, 14, 2300. https://doi.org/10.3390/f14122300

AMA Style

Xu D, Hao J, Wang C, Zhang L, Zhang H. Analysis of the Expression Patterns of 13 DREB Family Genes Related to Cone-Setting Genes in Hybrid Larch (Larix kaempferi × Larix olgensis). Forests. 2023; 14(12):2300. https://doi.org/10.3390/f14122300

Chicago/Turabian Style

Xu, Daixi, Junfei Hao, Chen Wang, Lei Zhang, and Hanguo Zhang. 2023. "Analysis of the Expression Patterns of 13 DREB Family Genes Related to Cone-Setting Genes in Hybrid Larch (Larix kaempferi × Larix olgensis)" Forests 14, no. 12: 2300. https://doi.org/10.3390/f14122300

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop