Next Article in Journal
Allometric Models to Estimate the Biomass of Tree Seedlings from Dry Evergreen Forest in Thailand
Next Article in Special Issue
The Potential of Paulownia fortunei L. for the Phytoremediation of Pb
Previous Article in Journal
Effects of Exogenous ALA on Leaf Photosynthesis, Photosynthate Transport, and Sugar Accumulation in Prunus persica L.
Previous Article in Special Issue
Impact of Silica Addition on Alleviating Cadmium Stress: Case Studies of Three Afforestation Tree Species Seedlings in Southern China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 14
Issue 4
10.3390/f14040724
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Litsea Males Are Better Adapted to Pb Stress Than Females by Modulating Photosynthesis and Pb Subcellular Distribution

by
Simeng Li
1,2,
Qinyi Wang
1,
Wenjun Li
1,2,
Yan Yang
2,* and
Lijuan Jiang
1,*
1
College of Life Science and Technology, Central South University of Forestry and Technology, Changsha 410004, China
2
State Key Laboratory of Woody Oil and Charateristic Horticultural Crop Resources Utilization, Hunan Academy of Forestry, Changsha 410018, China
*
Authors to whom correspondence should be addressed.
Forests 2023, 14(4), 724; https://doi.org/10.3390/f14040724
Submission received: 22 February 2023 / Revised: 22 March 2023 / Accepted: 24 March 2023 / Published: 1 April 2023
(This article belongs to the Special Issue Soil Contamination in Forest Ecosystem)
Browse Figures
Review Reports Versions Notes

Abstract

:
Litsea cubeba Pers., a dioecious species, is an important tree species for the bioenergy industry with great potential for lead (Pb)-polluted soil phytoremediation. However, the sex-specific morphological and physiological characteristics of L. cubeba under Pb stress remain largely unknown. In this study, L. cubeba was used as a study model to identify sex differences in leaf traits, chlorophyll, photosynthetic gas parameters, chlorophyll fluorescence, Pb subcellular distribution, and photosynthesis-related nutrient contents in chloroplasts and cell nuclei under three different Pb concentrations [0 (CK), 1 (P1), 2 (P2), and 3 (P3) mmol/kg]. The results indicate that Pb stress significantly decreases photosynthetic leaf pigments in both sexes, mainly caused by changes in Ca, Mg, and Mn contents. Furthermore, L. cubeba male plants exhibited greater adaptability to Pb stress by enlarging their leaf area, enhancing photosynthesis and excess light energy in the form of heat dissipation when compared to female plants. Notably, we observed that more Pb reached the organelle fraction and damaged chloroplasts and mitochondria in female leaves under high-level Pb treatments compared to those of the opposite sex. Transcriptome analysis demonstrated that Pb stress could significantly up-regulate more genes involved in photosynthetic antenna proteins and photosynthesis pathways in male leaves than in female leaves. Taken together, L. cubeba male plants are clearly more resistant to Pb toxicity than female plants—at least under the described Pb treatments—which is most likely due to differences in Pb allocation. This research offers a theoretical foundation for the utilization of male and female L. cubeba as suitable plants for the remediation of Pb-polluted soil.

1. Introduction

Lead (Pb) is one of the most hazardous environmental poisons and a non-essential metal element in plants, as well as having highly carcinogenic effects in humans [1]. Pb ions enter plants and accumulate, consequently posing risks to the environment and human health through the food chain [2,3]. According to recent studies, the concentration of Pb in soil ranges from 10 to 50 mg/kg in the natural context [4,5]. Unfortunately, Pb cannot be degraded and mostly accumulates in the soil. Therefore, it is urgently necessary to conduct research on the remediation of Pb-contaminated soil.
To remove heavy metals (HMs) from polluted areas, phytoremediation techniques have been widely applied [6]. Due to their substantial biomass and extensive root systems, trees have a high potential for utilization in the rehabilitation of heavy metal-contaminated soil [7]. However, plant morphological features, plant growth, and photosynthesis can all be negatively impacted by HMs. Problems with plant growth and curled, faded leaves might be linked to a variety of metabolic disorders, especially those related to photosynthesis [8,9,10,11]. Photosynthesis is affected by physiological processes due to alterations in pigment levels and PSII activity [12,13]. A substantial amount of research has been carried out to investigate the effects of Pb on plant development and photosynthesis in recent years. These studies revealed that Pb stress causes damage to root systems, inhibits plant growth, decreases the synthesis of chlorophyll pigments, and reduces the net photosynthetic rate (Pn) by suppressing the activities of photosystem II (PSII) and photosystem I (PSI) [3,14,15,16]. Additionally, HM-tolerant plants suffer from reduced adverse effects on their chlorophyll content, gas exchange, electron transport, light conversion, and PSII activity than HM-sensitive plants, according to a number of studies [11,17,18,19]. However, few studies have illustrated the sexual differences in photosynthetic response to Pb toxicity.
The subcellular distribution of HMs is the key internal mechanism affecting HM migration, accumulation characteristics, and phytotoxicity in plants [20]. To demonstrate how heavy metals accumulate and are distributed in plants—which may be related to their adaptation and detoxification—it is essential to understand their subcellular behaviors. For example, the vacuoles and cell walls are the main fixation sites for Pb accumulation in the leaves of Brassica chinensis L. and Neyraudia reynaudiana, while the organelles and cell membranes have a small amount of Pb, allowing for mitigation or avoidance of the damage caused by Pb toxicity to the functional tissues of plants [21,22]. Recent research has shown that many Pb ions may penetrate cells, possibly as a result of the saturation of Pb contents bound to cell walls [23]. Plants can store heavy metals in their cells in low-toxic, non-toxic forms through compartmentalization of the cell wall or other detoxification processes [24,25]. Comparing the changes in photosynthetic processes with the amount of ion contents in chloroplasts might be advantageous [26]; for example, magnesium (Mg) is an inorganic ion that is indispensable for plant growth and photosynthetic pigments [27]. Excess HMs inhibited the uptake of Mg2+ and its activity in plants, thus hindering the synthesis of photosynthetic pigments and reducing photosynthesis [28]. However, nothing is known about the potential connection between different subcellular distributions of nutrient elements and chlorophyll contents in female and male leaves of L. cubeba regarding Pb stress.
Litsea cubeba Pers., a popular essential oil plant of the Lauraceae family, is a dioecious, fast-growing, and deciduous tree species native to and widely distributed in the southern regions of China and other areas of Southeast Asia [29]. Hu et al. [30] pointed out that L. cubeba could provide a useful option for phytoremediation, as it has a high tolerance to combined stresses of Pb and Zn. Wang et al. [31] found that the male buds of L. cubeba performed better under Pb-Zn mine tailing areas. Little information is available on the sex-specific manifestations and mechanisms involved in the Pb toxicity tolerance of L. cubeba. Based on previous studies, we hypothesized that different concentrations of Pb stress would result in significant sexual differences in plant tolerance between female and male plants through the different degrees of changes in leaf photosynthesis and subcellular Pb distribution. In order to test this hypothesis, we used L. cubeba as a study model to investigate the influence of Pb stress on leaf traits, photosynthesis, and the Pb subcellular distribution in the leaves of L. cubeba females and males. Furthermore, transcriptome analysis was performed to explore the sex differences in gene expression related to photosynthesis between female and male L. cubeba. This study was conducted with the aim of determining the sex-specific differences in the Pb tolerance mechanism, with respect to photosynthesis and Pb subcellular distribution, in female and male L. cubeba plants. The results provide a theoretical basis for optimizing the sexual ratio and selecting resistant dioecious plants for growth in Pb-polluted soils. Meanwhile, our study is to offer the fundamental knowledge for gene cloning and gene mapping in further studies.

2. Materials and Methods

2.1. Experimental Design and Pot Experiments

Two-year-old L. cubeba plants (mean tree height, 68.6 cm; mean stem diameter, 0.7 cm) were purchased from a local nursery. Seedling roots were surface sterilized with 0.01% carbendazim and transferred to bottom-perforated pots with 14 kg soil per pot. The sample plot for pot soil collection was located at the Hunan Academy of Forestry, Changsha, Hunan, China (28°07′10.38″ N, 113°02′53.16″ E, and 94.5 m). For the pot soil samples, we used topsoil from a depth of 5–20 cm.
Pot experiments were set up in a controlled plant growth house (air temperature range, 20–25 °C; relative humidity range, 45%–85%; light/dark photoperiod, 14/10 h). Pb-treated soil samples, established by adding lead chloride (PbCl2) solution into air-dried soil (without Pb addition), were kept in the dark for 3 months to reach Pb2+ concentrations of 1, 2, and 3 mmol/kg dry soil as Pb treatments. The concentration of Pb in the soil we used was 26.42 mg/kg (as CK treatment), which was below the background value in Hunan (29.7 mg/kg) [32] and within the ranges of natural values (10–50 mg/kg) [4,5]. Physicochemical characterization of the soil we used indicated that it was slightly acidic (pH 5.62) with concentrations of total nitrogen (TN), total phosphorus (TP), total potassium (TK), and organic matter (OM) at 1.3, 0.37, 14.6, and 21.6 g/kg dry soil, respectively. Seedlings were regularly monitored and irrigated. After a plant adaptation period of 60 days, 80 healthy seedlings exhibiting similar plant height and stem base diameter (10 female seedlings or 10 male seedlings for each treatment) were transplanted into growth pots under different Pb concentration treatments. We measured all parameters after growing for 185 days in control or Pb-treated pots.

2.2. Leaf Traits

The standardized leaf functional trait approaches of Perez-Harguindeguy et al. [33] were employed to analyze leaf area (LA), specific leaf area (SLA), and leaf dry matter content (LDMC). Three fully expanded and exposed fifth leaves from each plant (10 female seedlings or 10 male seedlings for each treatment) were collected. LA was measured using a Li-3000C portable leaf area meter (LI-COR, Inc., Lincoln, NE, USA). For fresh weight measurements, leaves were immediately weighed after harvesting. Leaves were then placed in an oven at 70 °C for 2 days to constant dry weight. SLA and LDMC were calculated according to the dry weight, fresh weight, and LA. The ImageJ v.1.51 software was used for leaf thickness (Lth) analysis. All trait values were averaged by seedlings of each treatment.

2.3. Pigment Content and Gas Exchange

The leaves selected for the determination of chlorophylls and carotenoid contents were the same as those used for the leaf trait evaluation. The leaves were ground into a homogenate using 80% (v/v) acetone. Then, the absorbance of the pigments was measured at 470, 649, and 665 nm, according to a previously reported method [34].
To measure four key indicators of photosynthesis, a Li-6400 portable photosynthesis system (LI-COR, Inc., Lincoln, NE, USA) was used between 9.00 a.m. and 11.00 a.m. For the measurement of indicators, the following conditions were provided: Photosynthetic photon flux density (PPFD) of 1000 μmol m−2 s−1 and external CO2 concentration of 400 μmol mol−1. Three replicates were carried out for each treatment, and measurements were recorded five times to obtain valid data.

2.4. Chlorophyll Fluorescence Measurements

The same leaves used for gas exchange parameters were used for the analysis of chlorophyll a fluorescence. The leaves were adapted to the dark for 30 min. For each experiment, five seedlings per treatment were measured. A MINI-PAM (Walz, Effeltrich, Germany) was used to determine the initial fluorescence value and maximum fluorescence value after dark adaptation, following which 2 parameters (the steady-state fluorescence and maximum fluorescence) were measured at a light intensity of 1000 μmol m2 s1 (PFD). The whole parameters of chlorophyll fluorescence—maximal photochemical efficiency of PSII in the dark (Fv/Fm), photochemical efficiency of PSII in the light (Fv’/Fm’), the electron transportation rate (ETR), non-photochemical quenching (NPQ) photochemical quenching (qP) and the effective photochemical quantum yield (YII), non-photochemical quenching (NPQ), and regulatory energy dissipation (YNPQ) of PSII—considered in this study were calculated in accordance with Kramer et al. [35].

2.5. Extraction of Pb in Subcellular Distribution

To analyze the Pb distribution in leaves and contents of 6 nutritional elements related to photosynthesis in chloroplast and cell nuclei fractions, the methods previously described by Pan et al. [36] were used. Leaf samples were the same as those used for leaf trait assessment, and all operations were performed at 4 °C. Using a pre-cooled (4 °C) extraction buffer (250 mmol/L sucrose, 1.0 mmol/L dithioerythritol, and 50 mmol/L Tris-HCl at pH 7.5) and a mortar, fresh leaves were homogenized and transferred into a 50 mL tube. The F1 fraction (enriched in cell walls and cell wall debris) was the residue from the homogenate obtained by centrifuging at 300 g for 15 min. The F2 fraction (enriched in chloroplasts and cell nuclei) was the residue from the supernatant solution obtained by a second centrifugation at 2000 g for 15 min. The F3 fraction (enriched in mitochondria fraction) was obtained by further centrifuging the supernatant solution at 12,000 g for 20 min. The F4 fraction (enriched in ribosomes) was the final supernatant solution. The subcellular fractions were placed in an oven at 70 °C for 2 days to constant dry weight, then acid-digested with HNO3–HClO4 (5:3, v/v) [36]. The final operation involved using an inductively coupled plasma optical emission spectrometer (ICP-OES; Perkin Elmer, Optima 5300 DV, USA) to determine the contents of Pb and six nutrient elements—namely, calcium (Ca), iron (Fe), potassium (K), magnesium (Mg), manganese (Mn), and zinc (Zn)—in all treatments.

2.6. Leaf RNA Extraction and Transcriptome Sequencing

Based on the results of the leaf trait and physiological analyses, we selected the Pb treatment with the most significant sex differences. Seedling fresh leaves from CK-Female (CKF), CK-Male (CKM), P2-Female (P2F), and P2-Male (P2M) plants were collected for transcriptome sequencing. Three replicates were used for each treatment, and leaves from five pots of plants were mixed together as biological replicates. RNA extraction, library construction, sequencing, and data processing were conducted with the help of the Gene Denovo Biotechnology Company (Guangzhou, China), similar to the process described in a previous study [37]. The RNA quality and concentration were checked through RNase-free agarose gel electrophoresis using an Agilent 2100 bioanalyzer (Santa Clara, CA, USA). cDNA library construction and sequencing were performed using an Illumina HiSeqTM 2000 platform (Illumina Inc., San Diego, CA, USA). The adapter sequences and low-quality reads with over 50% of bases with quality scores of 5 or lower and/or over 10% unknown bases were removed. Then, the clean reads were assembled using Trinity package 39 to construct unique consensus sequences as reference sequences. In the transcriptome analysis, we used FPKM (fragments per kilobase exon Model per Million) mapped reads to calculate the expression level of each gene [38]. Differentially expressed genes (DEGs) showing a false discovery rate of ≤0.05 and |log2FoldChange| > 1 were utilized to perform KEGG pathway enrichment analyses.

2.7. Quantitative Real-Time PCR (qRT-PCR) Validation

Six DEGs were validated by qRT-PCR. In brief, RNA was extracted, denatured, and first-strand cDNA was synthesized using a HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). PCR was performed using a Step One Plus RealTime PCR System (ABI, San Diego, CA, USA). The relative expression levels of genes were normalized using the 2−ΔΔCT method. All samples were examined in three technical replicates, using three biological replicates for each treatment. The sequences of all primer pairs are listed in Table A1. Tubulin beta chain (TUBB1) was used as the internal reference gene.

2.8. Statistical Analysis

One-way ANOVA followed by Duncan’s tests were used to analyze the obtained morphological and physiological traits. Different letters in the experimental results denote significant differences at the p < 0.05 level. For the analysis of different sexes, Pb levels, and their interactions in those parameters, the experimental data were tested by two-way ANOVA. The numerical data in the tables and figures are presented as means ± standard errors (SEs) of three independent biological replicates for each treatment. Analyses were conducted using the SPSS v20.0 software (SPSS Inc., Chicago, IL, USA). Principal component analysis (PCA) was carried out using the CANOCO v5.0 software. Correlation effects were assessed by the genescloud tools (https://www.genescloud.cn) (accessed on 18 January 2023). The GraphPad Prism v9.0 software was used to process the data and generate the tables.

3. Results

3.1. Leaf Functional Traits

To explore the effects of Pb on leaf functional traits in both sexes of L. cubeba, we determined the LA, SLA, LDMC, and Lth. Two-way ANOVA was performed to study the possible interactions between sex and Pb treatments (Table A2). The results indicated that the interaction of sex with Pb treatment was statistically meaningful in LA, SLA, and Lth for both sexes of L. cubeba (p < 0.01), with the only exception being LDMC in leaves. In this case, we observed that L. cubeba males possessed higher LA, SLA, and Lth than females under control conditions, while no sex-related differences were observed in LDMC (Figure 1). Interestingly, LA was significantly increased in both sexes under Pb stress, whereas SLA was increased in females and decreased in males, while there was no influence on Lth for both sexes under all Pb treatments. When comparing the two sexes, LA and Lth presented significant sexual differences under treatment P2, whereas the SLA of the two sexes presented the most significant differences under treatment P3. These results pointed out SLA as a more sensitive parameter for sex-induced stress than LA and Lth.

3.2. Chlorophyll Pigments and Gas Exchange Parameters

To unveil the mechanism of Pb stress-induced photosynthetic inhibition in L. cubeba females and males, we analyzed four chlorophyll parameters. The results of two−way ANOVA highlighted a significant interaction between sex and Pb treatment for chlorophyll content (p < 0.05; Table A2). When comparing the two sexes, males presented significantly higher Chl a, Chl b, and total chlorophyll content (TChl) values than the opposite sex under CK and P1 treatments, while the opposite trend was observed under treatment P2. Treatment P3 significantly increased Carotenoid (Caro) contents in females but presented no change in males. With an increase in Pb concentration, the Chl a, Chl b, and TChl values for females showed a decreasing trend; however, these traits for males (except for Caro) reduced from treatment P1 to P2, then increased with later Pb concentrations. The reduction in chlorophyll contents for males under treatments P2 and P3, compared to CK, was far greater than that for females (Figure 2A–D).
Furthermore, we calculated four physiological parameters related to the light phase of plant photosynthesis. As mentioned above, Pn, Gs, and Tr changed as a consequence of the double interaction between sex and treatments (p < 0.01; Table A2), whereas there were no changes in Ci. Under CK, no significant differences based on sex were observed for all traits. Under Pb stress, sex−specific responses were detected, of which Pn and Tr for males increased from P1 to P2 and then decreased under P3, but the differences in traits were not significant for females (Figure 2E–H).

3.3. Chlorophyll Fluorescence

To examine the effects of Pb on chlorophyll fluorescence in both sexes of L. cubeba, we focused on the changes in eight chlorophyll fluorescence parameters (Table A2). Without Pb stress, sex−specific differences were detected in Fv’/Fm’ and NPQ between females and males. Females presented remarkable decreases in Fv/Fm and Fv’/Fm’ under treatment P1, compared to males at the same concentration of Pb stress (Figure 3A,B). There were no significant differences in all chlorophyll fluorescence parameters under treatments P2 and P3 between females and males. Additionally, Pb stress strongly reduced Fv’/Fm’, ETR, and qP for both sexes, whereas the NPQ value of both sexes was improved (Figure 3B–E).
As shown in Figure 3F, the changes in energy distribution parameters for the PSII reaction center of male leaves caused by Pb toxicity were clearly larger than those for female leaves. For females, the reduction of Y(II) was significant under P1 and P3 when compared with CK (p < 0.05), whereas Y(NPQ) and Y(NO) did not change significantly under Pb stress. However, for males, Pb stress induced a decrease in Y(II) and an increase in Y(NPQ) under all Pb concentrations, as well as a decrease in Y(NO) under treatments P1 and P2 (p < 0.05).

3.4. Principal Component Analysis

PCA was conducted to understand how Pb stress affects the various photosynthetic characteristics, including pigments, photosynthetic parameters, and chlorophyll fluorescence parameters, of leaves in both sexes (Figure 4). Under treatment P1, pigments (Chl a, Chl b, Caro, and TChl), Gs, and chlorophyll fluorescence parameters (Fv/Fm and Fv’/Fm’) were the most influential factors in PC1. Under treatment P2, pigments (Chl a, Chl b and TChl) and photosynthetic parameters (Gs, Tr and Pn) were the most influential factors in PC1, while Y(NO) and Fv’/Fm’ were the most influential factors in PC2. Under treatment P3, Y(II), Y(NPQ), and Chl b were the most influential factors in PC1, while Gs was the most influential factor in PC2. Evidently, the plants presented sex−specific differences under all Pb treatments. In addition, Chl b and Gs were influential in all treatments, such that they may be regarded as the main tolerance factors for both female and male L. cubeba.

3.5. Extraction of Pb in Subcellular Distribution

To further determine the impacts of Pb stress on Pb subcellular distribution in both sexes of L. cubeba leaves, we measured the Pb concentration in the cell wall, chloroplast and cell nucleus, mitochondria, and ribosome fractions from leaf cells. In this case, we observed that the changes in Pb subcellular distribution were due to the double interaction of sex with Pb treatment (Table A2). The Pb concentrations in cell walls for females were not significantly affected under Pb stress when compared to CK; however, for males, significantly higher Pb concentrations in the cell walls were observed under treatments P2 and P3, compared to that under CK (p < 0.05; Figure 5A). Notably, we found higher Pb concentrations in the chloroplasts and cell nuclei of females under treatment P2 compared to those under CK (p < 0.05) and lower Pb concentrations in the chloroplasts and cell nuclei of males under treatment P1 compared with those under CK (p < 0.05; Figure 5B). Meanwhile, under the same concentration of Pb, these values showed minor differences between female and male leaves. As shown in Figure 5C, with an increase in Pb concentration, the Pb concentrations in the mitochondria showed an increasing trend in females (p < 0.05) but did not change significantly for males. It can be seen, from Figure 5D, that significantly higher ribosome Pb concentrations were observed in females under treatment P2 and males under treatments P1 and P3, as compared with leaves from the same sex under CK (p < 0.05). Considering the Pb subcellular distribution in leaves, the results indicated that the higher proportions of Pb in the cell wall and ribosomes approximately balanced the lower proportions of Pb in the chloroplasts, cell nuclei, and mitochondria (Figure 5E). In addition, the proportions in chloroplasts, cell nuclei, and mitochondria were significantly higher for females under treatments P2 and P3 compared to those of their counterparts in males at the same concentration of Pb (p < 0.05).

3.6. Concentration of Nutritional Elements in Chloroplasts and Cell Nuclei

To further understand the difference among the concentrations of some essential elements in the chloroplasts and cell nuclei, we tested the presence of contents of six nutrients associated with photosynthesis in chloroplasts and cell nuclei. Two-way ANOVA demonstrated that the sex—Pb treatment interaction was statistically meaningful with respect to all nutritional elements (p < 0.05; Table A2). As shown in Table 1, under CK, female leaves presented higher levels of all elements than males (p < 0.05). Compared to the CK, Pb stresses induced an increased Ca concentration under all treatments, except for a significant decrease observed in females under treatment P3 (p < 0.05). Fe concentration was found at decreased levels in females under treatments P1 and P2, as well as an increased level under treatment P3, whereas all Pb treatments induced a significantly higher concentration of Fe in males (p < 0.05). A similar response to that of Fe was observed for K concentration in males and females, except for a reduction in K level in both sexes under treatment P3 (p < 0.05). The Mg levels for females increased from P1 to P2, then decreased under treatment P3, while its level remarkably increased at all concentrations for males (p < 0.05). High levels of Mn were detected for both sexes at all concentrations, as compared to CK (p < 0.05), Zn concentrations were found to be at decreased levels for females under treatments P2 and P3, as well as for males under treatments P1 and P2 (p < 0.05). Overall, Pb stress had a powerful influence on nutritional elements in chloroplasts and cell nuclei for both sexes. In particular, male leaves presented a better ability to accumulate nutritional elements in chloroplasts and cell nuclei under Pb stress.

3.7. Correlation Coefficients among Elemental Contents

Next, the contents of the considered elements (i.e., Pb, Ca, Fe, K, Mg, Mn, and Zn) in chloroplasts and cell nuclei were analyzed to determine the correlation between pigments and the contents of the six nutrients in chloroplasts and cell nuclei under Pb stress (Figure 6). Pearson’s correlation analysis indicated that the photosynthetic leaf pigments (Chl a, Chl b, and TChl) had significant positive correlations with Ca and Mn contents for females (Figure 6A). In contrast, for males, the photosynthetic leaf pigments presented negative correlations with Ca and Mn contents (p < 0.01; Figure 6B). Meanwhile, Caro also presented a significant negative correlation with Mg content in both sexes (p < 0.01).

3.8. KEGG Enrichment Analyses and the DEGs Related to Photosynthesis

Comparative analysis of the DEGs among the four pairs of treatments (i.e., CKF vs. CKM, P2F vs. P2M, CKF vs. P2F, and CKM vs. P2M) was conducted to provide potential information for exploring the molecular mechanisms of plant resistance under Pb stress. Mapping to the top 20 KEGG database revealed that metabolic pathways and biosynthesis of secondary metabolites were involved in the responses of L. cubeba plants to Pb stress. In addition, “Photosynthesis” was enriched in the DEGs identified in the CKF vs. CKM comparison and “Photosynthesis antenna proteins” was significantly enriched in the CKF vs. P2F comparison (Figure 7A,C). As the results of the KEGG enrichment analysis were consistent with those of the morphological and physiological analyses, we focused on photosynthesis and photosynthesis antenna proteins for further investigation.
The levels of genes involved in photosynthesis presented sexual differences among the different comparisons (Figure 7E). The heatmap shows that most genes were expressed at relatively higher levels in male leaves than in female leaves under control and Pb treatments. The expression levels of PsaB, Psb28, PsbD, FDC2, ATPD, and ATPB presented up-regulated trends in female leaves when compared with male leaves under Pb treatment. Moreover, PsaN, Os07g0147900, and SEND33 genes showed clear down-regulation in the CKF vs. P2F comparison, while other genes were up-regulated. In addition, the analysis of photosynthetic antenna proteins revealed an increase in the expression of all DEGs in the P2F vs. P2M comparison. Interestingly, fewer DEGs were observed in the CKM vs. P2M comparison.
To validate the stability and accuracy of RNA-Seq results, qRT-PCR was utilized to quantify the expression of six genes. The qRT-PCR results for these DEGs were mostly compatible with the RNA-Seq data, as shown in Figure A1. The correlation coefficient (R2 = 0.5127, p-value < 0.01) indicated that the DEG expression patterns obtained according to the RNA-seq and qRT-PCR results were in good concordance, thus validating the reliability of the RNA-seq data.

4. Discussion

We studied the influences of Pb stress on male and female leaves of L. cubeba. We chose concentrations with different effects on plant growth that were comparable—namely, 1, 2, and 3 mmol/kg Pb (see Results and Figure 1). Overall, plants with L. cubeba male leaves were found to be more Pb stress-resistant than those with female leaves, indicating that L. cubeba leaves have specific sex-related roles in stress responses.

4.1. Sexual Differences in Leaf Morphology

Plants respond to environmental factors by regulating their growth and development. When plants suffer from HM stresses, many plant leaves have been shown to present significant changes in leaf functional traits [8,26]. SLA usually represents the investment in leaf dry mass per unit of leaf area for the interception of light [39,40]. In this study, compared with CK, there was a strong sex-specific difference in SLA under the highest Pb treatment (P3), as suggested by the increase in females and the decrease in males. Moreover, male plants adapted to Pb stress by reducing Lth and increasing LA, in agreement with the results of Hussain et al. [41]. The higher SLA in females might indicate that the reduction in plant growth induced by high Pb concentration was not only ascribable to changes in leaves but probably also to those in other organs, such as the roots and stems. As no change in LDMC was observed among all Pb concentrations, the leaves presented the same tissue density when compared to CK [42]. Collectively, we believe that L. cubeba males may invest more in leaf growth in order to enhance their Pb resistance.

4.2. Sexual Difference in Photosynthesis and Chlorophyll Pigments

The reduction of TChl and Caro contents with increasing Pb levels in male leaves demonstrated that Pb stress caused damage to the photosynthetic apparatus in male L. cubeba. The reason for the reduction of chlorophyll pigments might be due to the HMs affecting the absorption of Fe2+ and Mg2+, which are essential ions involved in chlorophyll synthesis [43,44]. In this case, Pb stress resulted in significantly higher Chl a, Caro, and TChl in females. Under Pb stress, the decline of chlorophyll pigments in male leaves was higher than that in female leaves, suggesting that males are more sensitive to Pb stress in terms of leaf chlorophyll than the opposite sex. Consistent with previous research, Chl b seemed to be more sensitive to Pb than Chl a [45]. As such, Xiong et al. [46] and Zhang et al. [47] have suggested that Chl b could be considered as an indicator of Pb stress. This finding was supported by the fact that Chl b was more affected under all Pb treatments for both sexes in the PCA analysis (Figure 4). Additionally, we observed that the chlorophyll content was degraded to a higher degree than Caro content under Pb stress. The results of this study were consistent with the previous studies of Zhang et al. [16] and Amir et al. [48], in which Chl a and Chl b were found to be relatively more susceptible to HM toxicity when compared to Caro.
In addition, the reduction of photosynthetic-related parameters due to increased HMs has been reported in previously published papers [49,50,51]. Meanwhile, some researchers observed the superior environmental resistance of one sex in dioecious plants, resulting in lower declines in gas exchange [52,53,54]. In this study, males presented remarkably higher gas exchange parameters than females under all treatments. There was only a slight change under treatments P1 and P3 for both sexes when compared with the same sex in the CK, indicating that both sexes of L. cubeba reached light saturation at the set light intensity values [55]. Additionally, the higher Pn in male leaves under treatment P2 may have been due to the higher contents of reaction centers, electron transporters, and carbon-assimilating enzymes, which are key components of the photosynthetic structure [56]. Collectively, these results support the notion that L. cubeba leaves have good adaptability to Pb stress and that males are more tolerant to Pb than females.

4.3. Sexual Difference in PSII under Pb Stress

It has been previously illustrated that HMs have negative effects on PSII activity [8]. In our study, the results demonstrated that Pb toxicity did not significantly influence the Fv/Fm value for both sexes, except for the reduction of Fv/Fm for females at a low Pb level (P1). These results show that, while Pb stress-induced photoinhibition in females at low Pb levels, the PSII reaction center has efficient regulatory and repair functions [57]. These results are in agreement with a previous study declaring that the ETR of Brassica chinensis L. leaves reduced with increasing Pb toxicity [58]. Reduced ETR led to excess excitation energy and serious photoinhibition [59,60]. However, only the ETR of male leaves under treatments P2 and P3 showed an increasing trend compared to the P1 treatment, indicating that males suffered from less photoinhibition of PSII under Pb stress than females. Taken together, the NPQ at different Pb concentrations was significantly improved in male leaves when compared to the CK, corresponding to the qP reduction observed for males. A higher NPQ is critical for reducing excess excitation energy in PSII under stressful environments [61,62], alleviating the photoinhibition of leaves under HM stresses.
In terms of the light energy distribution of the PSII reaction center, YII decreased significantly in this case, while YNPQ increased significantly for both sexes under all Pb concentrations. This result indicates that L. cubeba leaves could effectively dissipate the excess light energy (in the form of heat) through self-regulation, thus reducing the extent of damage to the PSII reaction center, further demonstrating that L. cubeba is highly resistant to Pb. Therefore, our results showed that Pb stress declined PSII activities but did not cause serious photoinhibition of PSII in L. cubeba leaves; again, males may have better regulation capacities under Pb stress than females.

4.4. Sexual Difference in Subcellular Distribution of Nutritional Ions

The subcellular distribution of HMs is closely related to plant adaptability and tolerance to HMs, where some less-active sections in plants (e.g., the cell wall and soluble fraction) can help plants to reduce the hazardous effects of HMs by storing them [63,64]. Some previous studies found that males had increased HMs accumulation capacities compared to females [65,66]. In our study, a higher level of Pb accumulated in the cell wall of leaves in males, when compared with CK, while that in females did not change with Pb treatment. These results indicate that a large amount of Pb was stored in the cell wall, reducing the trans-membrane transport of metal ions and, thus, reducing the toxic effects on the organelles. Furthermore, it was detected that a higher fraction of Pb was stored in the F4 fraction for both sexes of L. cubeba leaves with increasing Pb concentration. Wang et al. [67] found that the vacuole is the major ingredient of the soluble fraction, which protects cellular organelles against toxicity by accumulating excess HMs ions. With rising Pb concentrations, the ability of the cell wall and soluble fraction to sequester Pb was clearly reduced under treatment P3 for females, allowing more Pb ions to reach the organelle fraction and damage chloroplasts and mitochondria, consequently affecting the photosynthetic physiology and other functions. Based on the subcellular Pb concentrations in the four fractions, our results indicated that the cell wall and soluble fraction are the main storage sites for preferential Pb distribution in L. cubeba leaves and that male leaves were more tolerant to Pb toxicity than female leaves.
In addition, the correlations between photosynthetic pigments and elemental contents in chloroplasts and cell nuclei in female and male leaves under Pb stress (Figure 6) revealed that photosynthetic pigments were significantly related to the Ca, Mg, and Mn contents and that there existed sex-specific responses regarding the pigments. Additionally, we found that Mg is the main element regulating changes in pigments. As one of the key nutritional elements for plant growth and development, Mg interacts with other ions, such as K and Ca, to regulate the ion balance in cells [68]. A study by Trankner et al. [69] found that a moderate content of Mg improved photosynthesis—especially for pigments—but lacking or excess Mg content caused a reduction in pigment levels. Our results revealed similar consequences. A previous study considered Mn as a “chloroplastic” metal, demonstrating that Mn has slight effects on plant physiology as excess Mn can be directed to the storage sites [26]. Furthermore, Mn may have a synergistic effect with Ca and Mg. Taken together, the Pb subcellular distribution and the correlations between photosynthetic pigments and ion contents in chloroplasts and cell nuclei support the notion that L. cubeba leaf responses to Pb stress are sex-specific. Moreover, L. cubeba males are clearly more Pb-tolerant than the opposite sex.

4.5. Sexual Difference in Activity of Genes Involved in Photosynthetic Antenna Proteins and Photosynthesis

Males and females exhibit significant differences in differential gene enrichment pathways [70]. In our study, according to the top 20 KEGG enrichment analyses, “photosynthesis” and “photosynthetic antenna protein” were the most-regulated pathways in two groups: CKF vs. CKM and CKF vs. P2F (Figure 7). Most DEGs involved in photosynthetic antenna proteins and the photosynthesis pathway were up-regulated in the CKF vs. CKM and P2F vs. P2M comparisons. More specifically, most of the photosynthesis-related genes changed significantly in the three comparisons; meanwhile, those in CKM vs. P2M were concentrated in the PSII and PSI complexes. This finding is similar to that of a previous study [71]. Moreover, the number of DEGs related to photosynthesis for female leaves was significantly higher than that for male leaves, and the number of DEGs in the PSI reaction center was also clearly lower than that in PSII. These results indicate that L. cubeba leaf PSII and PSI are more sensitive to Pb stress during the process of photosynthetic electron transfer; furthermore, the effect of Pb on female leaves, regarding PSII and PSI activity, is significantly greater than that for males. Overall, the effect of Pb stress on L. cubeba leaf PSII activity is greater than that for PSI. In the photosynthesis antenna protein pathway, the genes that encode the six antenna proteins constituting LHCII and the two antenna proteins that constitute LHCI were up-regulated, while the down-regulated genes all encode the LHCII antenna protein. Leaves of both sexes presented a greater impact on LHCII than LHCI, and again the impact was greater for females than for males.

5. Conclusions

Our research revealed that Pb stress had sex-specific effects on leaf functional traits, photosynthesis, Pb subcellular distribution, and accumulation of nutrient contents in chloroplasts and cell nuclei between female and male leaves of L. cubeba. Furthermore, the reduction in chlorophyll content for both sexes may be related to the nutrient contents in chloroplasts and cell nuclei, especially Ca, Mg, and Mn. Male leaves presented better phytoremediation capacity, regarding Pb accumulation, with less damage to the organelle fraction, less inhibited PSII activity, and higher leaf area under Pb stresses. Additionally, PSII and LHCII were more susceptible to Pb stress for both sexes, while the expression levels of genes involved in photosynthesis for male leaves were higher than those in females under Pb stress. According to these results, it is predicted that L. cubeba males will grow better than the opposite sex in Pb-contaminated soil. This finding suggests that Pb stress has distinct mechanisms of toxicity in male and female L. cubeba plants, which should be fascinating to further elucidate.

Author Contributions

L.J. conceptualized the research program; L.J., Y.Y. and S.L. designed and finished the study; S.L., Q.W. and W.L. planted the seedlings and performed the whole experiments; L.J. and Y.Y. revised the manuscript. All authors discussed the results and approved the submitted version. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Innovation of Forestry Science and Technology Project (XLKY202205); Key Research and Development Project of Hunan Province (2016SK20-31); Key Research and Development Project of Changsha local government (kq1801080); and the Scientific Innovation Fund for Post-graduates of Central South University of Forestry and Technology (CX20191007).

Data Availability Statement

The original contributions presented in this study are publicly available. The raw sequence data reported in this paper have been deposited in the Genome Sequence Archive in National Genomics Data Center (Nucleic Acids Res 2022), China National Center for Bioinformation/Beijing Institute of Genomics, Chinese Academy of Sciences (GSA: CRA008382) that are publicly accessible at https://ngdc.cncb.ac.cn/gsa (accessed on 10 October 2022).

Acknowledgments

We thank the following people for their assistance in laboratory chemical analysis: Peiyi Yu, Xiao Zhou, Jingyi Liu, Sijia Tan and Chenbo Zhang.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Forests 14 00724 g0a1 550
Figure A1. Correlations between the DEG expression patterns obtained by RNA-Seq and qRT-PCR (A–F); and relative expression levels of six DEGs under Pb stress as determined by qRT-PCR (G). Comparison between the log2 of gene expression ratios obtained from RNA-Seq data and qRT-PCR value. The qRT-PCR value of the expression (x-axis) was plotted against the value from the RNA-Seq (y-axis). R2 represents the correlation coefficient between qRT-PCR and RNA-Seq.
Figure A1. Correlations between the DEG expression patterns obtained by RNA-Seq and qRT-PCR (A–F); and relative expression levels of six DEGs under Pb stress as determined by qRT-PCR (G). Comparison between the log2 of gene expression ratios obtained from RNA-Seq data and qRT-PCR value. The qRT-PCR value of the expression (x-axis) was plotted against the value from the RNA-Seq (y-axis). R2 represents the correlation coefficient between qRT-PCR and RNA-Seq.
Forests 14 00724 g0a1
Table
Table A1. Primers used for qRT-PCR.
Table A1. Primers used for qRT-PCR.
Gene IDGene NameSense PrimerTm1 (°C)Antisense PrimerTm2 (°C)
Lc0063017PALATGTTCTGCGAGGTGATGCT57.8GTTTGGGCTTGGTCAGTGGA60.5
Lc0064810HCTCCTCTCCCTCCCTTAGACACC59.3CACAGGAGAAGCGGTTGAGT57.4
Lc0053527CYP707A1TATTGGGGTGTCCTTGTGTGA58.4TCGCTTTGTGGAAGAGGGTC59.9
Lc0027922COMT1CTCCCCACAGAAAACCCAGA59.6CAACACCTCCACCCACATCA59.2
Lc0036038CAT1GCACAGTTTGTTCGGGCT56.3TTGCTATGATGGTGGGGCTC60.6
Lc0008270trpB2GGCGTCCCAAAGTGAGAGAA59.9TACATCCAAACGGCACCCAG61.5
Lc0039444TUBB1CCATTCCCCCGTCTTCACTT61.1GCCATTTTCAACCCCTTCGG64
Table
Table A2. The significance test for the effects of sex, Pb treatment, and their interaction on the parameters considered in this study. ns, non-significant; *, p < 0.05; **, p < 0.01; Fs, sex effect; Fp, Pb content effect; Fsxp, interaction effect of sex and Pb content.
Table A2. The significance test for the effects of sex, Pb treatment, and their interaction on the parameters considered in this study. ns, non-significant; *, p < 0.05; **, p < 0.01; Fs, sex effect; Fp, Pb content effect; Fsxp, interaction effect of sex and Pb content.
P:FsP:FpP:Fsxp
LA******
SLA******
LDMCnsnsns
Lth******
Chl a**ns**
Chl b******
Caro*****
TChl*****
Pn**ns**
Gs******
Cinsnsns
Tr******
Fv/Fmnsnsns
Fv’/Fm’****ns
ETRns**ns
NPQ*ns*
qPns**ns
Y(II)ns**ns
Y(NPQ)******
Y(NO)nsns*
F1******
F2******
F3******
F4******
Ca******
Fe******
K******
Mg******
Mn******
Zn******
Table
Table A3. Abbreviations used for DEGs involved in photosynthetic antenna proteins and photosynthesis.
Table A3. Abbreviations used for DEGs involved in photosynthetic antenna proteins and photosynthesis.
AbbreviationGene Name
CAB7chlorophyll a-b binding protein 7
LHCA6photosystem I chlorophyll a/b-binding protein 6
LHCB4.2chlorophyll a-b binding protein CP29.1
CAB8chlorophyll a-b binding protein 8
LHCA1chlorophyll a-b binding protein 6
CAB13hypothetical protein B296_00038081
CAP10Achlorophyll A-B binding protein
CAB40chlorophyll a-b binding protein of LHCII type 1-like protein
CAB215chlorophyll a-b binding protein
PHYPADRAFT_124625chlorophyll a-b binding protein
LHCSR1stress-related chlorophyll a b binding 2
psaDPSI reaction center subunit II
PSALphotosystem I reaction center subunit XI
PSAKphotosystem I reaction center subunit psaK
PSAHphotosystem I reaction center subunit VI
PSANphotosystem I reaction center subunit N
PSAFhypothetical protein HHK36_000716
psaBphotosystem I P700 apoprotein A1
PSBSphotosystem II protein
PSBYphotosystem II core complex proteins psbY
PSBQ1oxygen-evolving enhancer protein 3-2, chloroplastic-like protein
PSB27-1photosystem 2 family protein
PNSL3photosystem II PsbQ
PPL1psbP-like protein 1
PSB28photosystem II reaction center PSB28 protein
psbBphotosystem II CP47 reaction center-like protein
PSBPoxygen-evolving enhancer protein 2
psbDphotosystem II protein D2
psbCphotosystem II 43 kDa protein
psbAphotosystem II Q(b) protein D1
PETHferredoxin--NADP reductase, leaf isozyme
PETEplastocyanin, chloroplastic
AP1ferredoxin
Os07g0147900ferredoxin--NADP reductase
SEND33ferredoxin-like protein
FDC22Fe-2S ferredoxin-like superfamily protein
ATPDhypothetical protein HHK36_001355
ATPCATP synthase gamma chain 1
atpBATP synthase subunit beta
petCcytochrome b6-f complex iron-sulfur subunit 1
petC2cytochrome b6-f complex iron-sulfur subunit 2
petAcytochrome f-like

References

  1. Duan, D.C.; Tong, J.H.; Xu, Q.; Dai, L.Y.; Ye, J.E.; Wu, H.X.; Xu, C.; Shi, J.Y. Regulation mechanisms of humic acid on Pb stress in tea plant (Camellia sinensis L.). Environ. Pollut. 2020, 267, 5546. [Google Scholar] [CrossRef]
  2. Jin, Z.M.; Deng, S.Q.; Wen, Y.C.; Jin, Y.F.; Pan, L.; Zhang, Y.F.; Black, T.; Jones, K.C.; Zhang, H.; Zhang, D.Y. Application of Simplicillium chinense for Cd and Pb biosorption and enhancing heavy metal phytoremediation of soils. Sci. Total Environ. 2019, 697, 4178. [Google Scholar] [CrossRef]
  3. Meng, L.D.; Yang, Y.P.; Ma, Z.W.; Jiang, J.W.; Zhang, X.M.; Chen, Z.R.; Cui, X.J.; Yin, X.J. Integrated physiological, transcriptomic and metabolomic analysis of the response of Trifolium pratense L. to Pb toxicity. J. Hazard. Mater. 2022, 436, 129128. [Google Scholar] [CrossRef]
  4. Bamagoos, A.A.; Alharby, H.F.; Abbas, G. Differential uptake and translocation of cadmium and lead by quinoa: A multivariate comparison of physiological and oxidative stress responses. Toxics 2022, 10, 68. [Google Scholar] [CrossRef]
  5. Oorts, K.; Smolders, E.; Lanno, R.; Chowdhury, M.J. Bioavailability and ecotoxicity of lead in soil: Implications for setting ecological soil quality standards. Environ. Toxicol. Chem. 2021, 40, 1948–1961. [Google Scholar] [CrossRef]
  6. Chen, L.H.; Hu, X.W.; Yang, W.Q.; Xu, Z.F.; Zhang, D.J.; Gao, S. The effects of arbuscular mycorrhizal fungi on sex-specific responses to Pb pollution in Populus cathayana. Ecotoxicol. Environ. Saf. 2015, 113, 460–468. [Google Scholar] [CrossRef]
  7. Pulford, I.D.; Watson, C. Phytoremediation of heavy metalcontaminated land by trees—A review. Environ. Int. 2003, 29, 529–540. [Google Scholar] [CrossRef]
  8. Huang, X.H.; Zhu, F.; He, Z.X.; Chen, X.Y.; Wang, G.J.; Liu, M.S.; Xu, H.Y. Photosynthesis performance and antioxidative enzymes response of Melia azedarach and Ligustrum lucidum plants under Pb–Zn mine tailing conditions. Front. Plant Sci. 2020, 11, 1157. [Google Scholar] [CrossRef]
  9. Mishra, S.; Tripathi, R.D.; Srivastava, S.; Dwivedi, S.; Trivedi, P.K.; Dhankher, O.P.; Khare, A. Thliol metabolism play significant role during cadmium detoxification by Ceratophyllum demersum L. Bioresour. Technol. 2009, 99, 2155–2161. [Google Scholar] [CrossRef]
  10. Gupta, D.K.; Huang, H.G.; Yang, X.E.; Razafindrabe, B.H.N.; Inouhe, M. The detoxification of lead in Sedum alfredii H. is not related to phytochelatins but the glutathione. J. Hazard. Mater. 2010, 177, 437–444. [Google Scholar] [CrossRef]
  11. Huang, X.H.; Zhu, F.; Yan, W.D.; Chen, X.Y.; Wang, G.J.; Wang, R.J. Effects of Pb and Zn toxicity on chlorophyll fluorescence and biomass production of Koelreuteria paniculata and Zelkova schneideriana young plants. Photosynthetica 2019, 57, 688–697. [Google Scholar] [CrossRef] [Green Version]
  12. Fontenele, N.B.; Oliveira Otoch, M.D.L.; Gomes-Rochette, N.F.; Cecilia, M.S.A.; Annderson, G.C.B.A.; Dalton, B.D.O.F.; Costa, J.H.; Borges, S.D.S.S.; Ferreira, D.N.R.; Fernandes, D.M.D. Effect of lead on physiological and antioxidant responses in two Vigna unguiculata cultivars differing in Pb-accumulation. Chemosphere 2017, 176, 397–404. [Google Scholar] [CrossRef]
  13. Li, T.; Liu, Y.J.; Shi, L.; Jiang, C.D. Systemic regulation of photosynthetic function in field-grown sorghum. Plant Physiol. Biochem. 2015, 94, 86–94. [Google Scholar] [CrossRef]
  14. Xu, Z.F.; Chen, L.H.; Tang, S.S.; Zhuang, L.Y.; Yang, W.Q.; Tu, L.H.; Tan, B.; Zhang, L. Sex-specific responses to Pb stress in Populus deltoides: Root architecture and Pb translocation. Trees 2016, 30, 2019–2027. [Google Scholar] [CrossRef]
  15. Fattahi, B.; Arzani, K.; Souri, M.K.; Barzegar, M. Morphophysiological and phytochemical responses to cadmium and lead stress in coriander (Coriandrum sativum L.). Ind. Crops Prod. 2021, 171, 113979. [Google Scholar] [CrossRef]
  16. Zhang, H.H.; Li, X.; Xu, Z.S.; Wang, Y.; Teng, Z.Y.; An, M.J.; Zhang, Y.H.; Zhu, W.X.; Xu, N.; Sun, G. Toxic effects of heavy metals Pb and Cd on mulberry (Morus alba L.) seedling leaves: Photosynthetic function and reactive oxygen species (ROS) metabolism responses. Ecotoxicol. Environ. Saf. 2020, 195, 469. [Google Scholar]
  17. Guo, P.; Qi, Y.P.; Cai, Y.T.; Yang, T.Y.; Yang, L.T.; Huang, Z.R.; Chen, L.S. Aluminum effects on photosynthesis, reactive oxygen species and methylglyoxal detoxification in two citrus species differing in aluminum tolerance. Tree Physiol. 2018, 38, 1548–1565. [Google Scholar] [CrossRef] [Green Version]
  18. Sorrentino, M.C.; Capozzi, F.; Amitrano, C.; Giordano, S.; Arena, C.; Spagnuolo, V. Performance of three cardoon cultivars in an industrial heavy metal contaminated soil: Effects on morphology, cytology and photosynthesis. J. Hazard. Mater. 2018, 351, 131–137. [Google Scholar] [CrossRef]
  19. Shi, W.G.; Li, J.; Kan, D.X.; Yu, W.J.; Chen, X.; Zhang, Y.H.; Ma, C.F.; Deng, S.R.; Zhou, J.; Fayyaz, P.; et al. Sulfur metabolism, organic acid accumulation and phytohormone regulation are crucial physiological processes modulating the different tolerance to Pb stress of two contrasting poplars. Tree Physiol. 2022, 42, 1799–1811. [Google Scholar] [CrossRef]
  20. Kuang, X.S.; Wang, W.Y.; Hu, J.Y.; Liu, W.S.; Zeng, W.B. Subcellular distribution and chemical forms of manganese in Daucus carota in relation to its tolerance. Front. Plant Sci. 2022, 13, 947882. [Google Scholar] [CrossRef]
  21. Wu, Z.P.; McGrouther, K.; Chen, D.L.; Wu, W.D.; Wang, H.L. Subcellular distribution of metals within Brassica chinensis L. in response to elevated lead and chromium stress. J. Agric. Food. Chem. 2013, 61, 4715–4722. [Google Scholar] [CrossRef]
  22. Zhou, C.F.; Huang, M.Y.; Li, Y.; Luo, J.W.; Cai, L.P. Changes in subcellular distribution and antioxidant compounds involved in Pb accumulation and detoxification in Neyraudia reynaudiana. Environ. Sci. Pollut. Res. 2016, 23, 21794–21804. [Google Scholar] [CrossRef]
  23. Li, Y.; Zhou, C.F.; Huang, M.Y.; Luo, J.W.; Hou, X.L.; Wu, P.F.; Ma, X.Q. Lead tolerance mechanism in Conyza canadensis: Subcellular distribution, ultrastructure, antioxidative defense system, and phytochelatins. J. Plant Res. 2016, 129, 251–262. [Google Scholar] [CrossRef]
  24. Crist, R.H.; Martin, J.R.; Crist, D.L.R. Heavy metal uptake by lignin: Comparison of biotic ligand models with an ion-exchange process. Environ. Sci. Technol. 2002, 36, 1485–1490. [Google Scholar] [CrossRef]
  25. Sheng, Y.B.; Yan, X.X.; Huang, Y.; Han, Y.Y.; Zhang, C.; Ren, Y.B.; Fan, T.T.; Xiao, F.M.; Liu, Y.S.; Cao, S.Q. The WRKY transcription factor, WRKY13, activates PDR8 expression to positively regulate cadmium tolerance in Arabidopsis. Plant Cell Environ. 2019, 42, 891–903. [Google Scholar] [CrossRef]
  26. Eugene, A.L.; Alexander, A.K.; Alexander, V.K.; Victor, V.K. Specificity of Cd, Cu, and Fe effects on barley growth, metal contents in leaves and chloroplasts, and activities of photosystem I and photosystem II. Plant Physiol. Biochem. 2020, 147, 191–204. [Google Scholar]
  27. Li, J.; Yokosho, K.; Liu, S.; Cao, H.R.; Yamaji, N.; Zhu, X.G.; Liao, H.; Ma, J.F.; Chen, Z.C. Diel magnesium fluctuations in chloroplasts contribute to photosynthesis in rice. Nat. Plants 2020, 6, 848–859. [Google Scholar] [CrossRef]
  28. Pittman, J.K. Managing the manganese: Molecular mechanisms of manganese transport and homeostasis. New Phytol. 2005, 167, 733–742. [Google Scholar] [CrossRef]
  29. Xu, Z.L.; Wang, Y.D.; Chen, Y.C.; Yin, H.F.; Wu, L.W.; Zhao, Y.X.; Wang, M.Y.; Gao, M. A model of hormonal regulation of stamen abortion during pre-meiosis of Litsea cubeba. Genes 2019, 11, 48. [Google Scholar] [CrossRef] [Green Version]
  30. Hu, W.L. The Research on the Response of Litsea cubeba (Lour.) Pers Seedlings to Lead and Zinc Stress. Master Dissertation, Central South University of Forestry and Technology, Changsha, China, 2019. [Google Scholar]
  31. Wang, Q.Y. Physiological and Biochemical Changes during Flower Bud Development of Male and Female Litsea cubeba in Pb and Zn Contaminated Soils. Master Dissertation, Central South University of Forestry and Technology, Changsha, China, 2021. [Google Scholar]
  32. Yu, P.Y.; Sun, Y.P.; Huang, Z.L.; Zhu, F.; Sun, Y.J.; Jiang, L.J. The effects of ectomycorrhizal fungi on heavy metals’ transport in Pinus massoniana and bacteria community in rhizosphere soil in mine tailing area. J. Hazard. Mater. 2020, 381, 121203. [Google Scholar] [CrossRef]
  33. Perez-Harguindeguy, N.; Diaz, S.; Garnier, E.; Lavorel, S.; Poorter, H.; Jaureguiberry, P.; Bret-Harte, M.S.; Cornwell, W.K.; Craine, J.M.; Gurvich, D.E.; et al. New handbook for standardised measurement of plant functional traits worldwide. Aust. J. Bot. 2013, 61, 167–234. [Google Scholar] [CrossRef]
  34. Dai, Y.J.; Shen, Z.G.; Liu, Y.; Wang, L.L.; Hannaway, D.; Lu, H.F. Effects of shade treatments on the photosynthetic capacity, chlorophyll fluorescence, and chlorophyll content of Tetrastigma hemsleyanum Diels et Gilg. Environ. Exp. Bot. 2009, 65, 177–182. [Google Scholar] [CrossRef]
  35. Kramer, D.M.; Johnson, G.; Kiirats, O.; Edwards, G.E. New fluorescence parameters for the determination of QA redox state and excitation energy fluxes. Photosynth. Res. 2004, 79, 209–218. [Google Scholar] [CrossRef]
  36. Pan, G.; Yan, W.D.; Zhang, H.P.; Xiao, Z.H.; Li, X.H.; Liu, W.S.; Zheng, L. Subcellular distribution and chemical forms involved in manganese accumulation and detoxification for Xanthium strumarium L. Chemosphere 2019, 237, 4531. [Google Scholar] [CrossRef]
  37. Qiao, Y.; Cheng, Q.M.; Zhang, Y.T.; Yan, W.; Yi, F.Y.; Shi, F.L. Transcriptomic and chemical analyses to identify candidate genes involved in color variation of sainfoin flowers. BMC Plant Biol. 2021, 21, 61. [Google Scholar] [CrossRef]
  38. Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef]
  39. Wright, I.J.; Reich, P.B.; Westoby, M.; Ackerly, D.D.; Baruch, Z.; Bongers, F.; Cavender-Bares, J.; Chapin, T.; Cornelissen, J.H.C.; Diemer, M. The worldwide leaf economics spectrum. Nature 2004, 428, 821–827. [Google Scholar] [CrossRef]
  40. Poorter, L. Leaf traits show different relationships with shade tolerance in moist versus dry tropical forests. New Phytol. 2009, 181, 890–900. [Google Scholar] [CrossRef]
  41. Hussain, S.; Li, S.X.; Mumtaz, M.; Shafiq, I.; Iqbal, N.; Brestic, M.; Shoaib, M.; Qin, S.S.; Wang, L.; Yang, W.Y.; et al. Foliar application of silicon improves stem strength under low light stress by regulating lignin biosynthesis genes in soybean (Glycine max (L.) Merr.). J. Hazard. Mater. 2020, 401, 3256. [Google Scholar] [CrossRef]
  42. Colzi, I.; Renna, L.; Bianchi, E.; Castellani, M.B.; Coppi, A.; Pignattelli, S.; Loppi, S.; Gonnelli, C. Impact of microplastics on growth, photosynthesis and essential elements in Cucurbita pepo L. J. Hazard. Mater. 2021, 7, 7238. [Google Scholar] [CrossRef]
  43. Vera-Estrella, R.; Gómez-Méndez, M.F.; Amezcua-Romero, J.C.; Barkla, B.J.; Rosas-Santiago, P.; Pantoja, O. Cadmium and zinc activate adaptive mechanisms in Nicotiana tabacum similar to those observed in metal tolerant plants. Planta 2017, 246, 433–451. [Google Scholar] [CrossRef]
  44. Rana, S. Plant response towards cadmium toxicity: An overview. Ann. Plant Sci. 2015, 7, 1162–1172. [Google Scholar]
  45. Jayasri, M.A.; Suthindhiran, K. Effect of zinc and lead on the physiological and biochemical properties of quatic plant Lemna minor: Its potential role in phytoremediation. Appl. Water Sci. 2017, 7, 1247–1253. [Google Scholar] [CrossRef] [Green Version]
  46. Xiong, Z.T. Bioaccumulation and physiological effects of excess lead roadside pioneer species Sonchus oleraceus. Environ. Pollut. 1997, 97, 275–279. [Google Scholar] [CrossRef]
  47. Zhang, L.L.; Zhu, X.M.; Kuang, Y.W. Responses of Pinus massoniana seedlings to lead stress. Biol. Plant 2017, 61, 785–790. [Google Scholar] [CrossRef]
  48. Amir, W.; Farid, M.; Ishaq, H.K.; Farid, S.; Zubair, M.; Alharby, H.F.; Bamagoos, A.A.; Rizwan, M.; Raza, N.; Hakeem, K.R.; et al. Accumulation potential and tolerance response of Typha latifolia L. under citric acid assisted phytoextraction of lead and mercury. Chemosphere 2020, 157, 127247–127261. [Google Scholar] [CrossRef]
  49. Gill, S.S.; Khan, N.A.; Tuteja, N. Cadmium at high dose perturbs growth, photosynthesis and nitrogen metabolism while at low dose it up regulates sulfur assimilation and antioxidant machinery in garden cress (Lepidium sativum L.). Plant Sci. 2012, 182, 112–120. [Google Scholar] [CrossRef]
  50. Deng, G.; Li, M.; Li, H.; Yin, L.Y.; Li, W. Exposure to cadmium causes declines in growth and photosynthesis in the endangered aquatic fern (Ceratopteris pteridoides). Aquat. Bot. 2014, 112, 23–32. [Google Scholar] [CrossRef]
  51. Tang, L.; Yao, A.J.; Yuan, M.; Tang, Y.T.; Liu, J.; Liu, X.; Qiu, R.L. Transcriptional up-regulation of genes involved in photosynthesis of the Zn/Cd hyperaccumulator Sedum alfredii in response to zinc and cadmium. Chemosphere 2016, 164, 190–200. [Google Scholar] [CrossRef]
  52. Juvany, M.; Munné-Bosch, S. Sex-related differences in stress tolerance in dioecious plants: A critical appraisal in a physiological context. J. Exp. Bot. 2015, 66, 6083–6092. [Google Scholar] [CrossRef] [Green Version]
  53. Liao, J.; Cai, Z.Y.; Song, H.F.; Zhang, S. Poplar males and willow females exhibit superior adaptation to nocturnal warming than the opposite sex. Sci. Total Environ. 2020, 717, 7179. [Google Scholar] [CrossRef]
  54. Zhang, S.; Chen, L.G.; Duan, B.L.; Korpelainen, H.; Li, C.Y. Populus cathayana males exhibit more efficient protective mechanisms than females under drought stress. For. Ecol. Manag. 2012, 275, 68–78. [Google Scholar] [CrossRef]
  55. Ferrero-Serrano, Á.; Assmann, S.M. The α-subunit of the rice heterotrimeric G protein, RGA1, regulates drought tolerance during the vegetative phase in the dwarf rice mutant d1. J. Exp. Bot. 2016, 67, 3433–3443. [Google Scholar] [CrossRef] [Green Version]
  56. Miller, M.A.E.; O’Cualain, R.; Selley, J.; Knight, D.; Karim, M.F.; Hubbard, S.J.; Johnson, G.N. Dynamic acclimation to high light in Arabidopsis thaliana involves widespread reengineering of the leaf proteome. Front. Plant Sci. 2017, 8, 1239. [Google Scholar] [CrossRef] [Green Version]
  57. Tikkanen, M.; Mekala, N.R.; Aro, E.M. Photosystem II photoinhibition-repair cycle protects Photosystem I from irreversible damage. Biochim. Biophys. Acta 2014, 1837, 210–215. [Google Scholar] [CrossRef] [Green Version]
  58. Fu, W.G.; Wang, F.K. Effects of high soil lead concentration on photosynthetic gas exchange and chlorophyll fluorescence in Brassica chinensis L. Plant Soil Environ. 2015, 61, 316–321. [Google Scholar] [CrossRef] [Green Version]
  59. Lanna, A.C.; Mitsuzono, S.T.; Terra, T.G.R.; Vianello, R.P.; Carvalho, M.A.D.F. Physiological characterization of common bean (Phaseolus vulgaris L.) genotypes: Water stress induced with contrasting response towards drought. Aust. J. Crop Sci. 2016, 10, 1–6. [Google Scholar]
  60. Rudzani, M.; Diana, M.; Joachim, M.S. The effect of drought stress on yield, leaf gaseous exchange and chlorophyll fluorescence of dry beans (Phaseolus vulgaris L.). Agric. Water Manag. 2017, 180, 118–125. [Google Scholar]
  61. Li, X.P.; Bjorkman, O.; Shih, C.; Grossman, A.R.; Rosenquist, M.; Jansson, S.; Niyogi, K.K. A pigment-binding protein essential for regulation of photosynthetic light harvesting. Nature 2000, 403, 391–395. [Google Scholar] [CrossRef]
  62. Xu, N.; Zhang, H.H.; Zhong, H.X.; Wu, Y.N.; Li, J.B.; Xin, L.; Yin, Z.P.; Zhu, W.X.; Qu, Y.; Sun, G.Y. The response of photosynthetic functions of F1 cutting seedlings from Physocarpus amurensis Maxim (♀) × Physocarpus opulifolius “Diabolo” (♂) and the parental leaves to salt stress. Front. Plant Sci. 2018, 9, 714. [Google Scholar]
  63. Wang, Y.; Shen, H.; Xu, L.; Zhu, X.W.; Li, C.; Zhang, W.; Xie, Y.; Gong, Y.Q.; Liu, L.W. Transport, ultrastructural localization, and distribution of chemical forms of lead in radish (Raphanus sativus L.). Front. Plant Sci. 2015, 6, 293. [Google Scholar] [CrossRef] [Green Version]
  64. Xin, J.L.; Huang, B.F. Subcellular distribution and chemical forms of cadmium in two hot pepper cultivars differing in cadmium accumulation. J. Agric. Food Chem. 2014, 62, 508–515. [Google Scholar] [CrossRef]
  65. Zou, J.Z.; Zhang, Y.X.; Li, X.; Ma, X.D.; Liu, J.X.; Peng, X.Y.; Sun, Z.Y. Sexual differences in root growth and antioxidant characteristics in Salix viminalis exposed to cadmium stress. Int. J. Phytoremed. 2021, 23, 1466–1475. [Google Scholar] [CrossRef]
  66. Li, X.Y.; Yang, Z.J.; Li, Y.C.; Zhao, H.X. Different responses to joint exposure to cadmium and zinc depends on the sex in Populus cathayana. Ecotoxicol. Environ. Saf. 2022, 248, 114297. [Google Scholar] [CrossRef]
  67. Wang, Q.Y.; Liu, J.S.; Hu, B. Integration of copper subcellular distribution and chemical forms to understand copper toxicity in apple trees. Environ. Exp. Bot. 2016, 123, 125–131. [Google Scholar] [CrossRef]
  68. Guo, W.L.; Nazim, H.; Liang, Z.S.; Yang, D.F. Magnesium deficiency in plants: An urgent problem. Crop J. 2016, 4, 83–91. [Google Scholar] [CrossRef] [Green Version]
  69. Trankner, M.; Jaghdani, S.J. Minimum magnesium concentrations for photosynthetic efficiency in wheat and sunflower seedlings. Plant Physiol. Biochem. 2019, 144, 234–243. [Google Scholar] [CrossRef]
  70. Xu, H.X.; He, J.; Yi, H.; Wang, L. Sex specific response mechanism of transcriptome in both male and female Marchantia polymorpha under cadmium stress. Chin. Boll. Bot. 2022, 57, 182–196. [Google Scholar]
  71. Wang, Y.; Yu, Y.T.; Zhang, H.B.; Huo, Y.Z.; Liu, X.Q.; Che, Y.H.; Wang, J.C.; Sun, G.Y.; Zhang, H.H. The phytotoxicity of exposure to two polybrominated diphenyl ethers (BDE47 and BDE209) on photosynthesis and the response of the hormone signaling and ROS scavenging system in tobacco leaves. J. Hazard. Mater. 2022, 426, 128012. [Google Scholar] [CrossRef]
Forests 14 00724 g001 550
Figure 1. The leaf area (A), specific leaf area (B), leaf dry matter content (C), and leaf thickness (D) of L. cubeba female and male leaves under control and Pb treatments. Leaf area, the projected area of a leaf; Specific leaf area, the leaf dry−mass per unit of the leaf area. CK, P1, P2, and P3 represent 0, 1, 2, and 3 mmol Pb/kg dry soil, respectively. Values are the mean of three replicates ± SE. Values followed by different lowercase letters significantly differed, according to Duncan’s test (p < 0.05).
Figure 1. The leaf area (A), specific leaf area (B), leaf dry matter content (C), and leaf thickness (D) of L. cubeba female and male leaves under control and Pb treatments. Leaf area, the projected area of a leaf; Specific leaf area, the leaf dry−mass per unit of the leaf area. CK, P1, P2, and P3 represent 0, 1, 2, and 3 mmol Pb/kg dry soil, respectively. Values are the mean of three replicates ± SE. Values followed by different lowercase letters significantly differed, according to Duncan’s test (p < 0.05).
Forests 14 00724 g001
Forests 14 00724 g002 550
Figure 2. Chlorophyll pigments and photosynthetic parameters in L. cubeba female and male leaves under control and Pb treatments: (A) Chl a, chlorophyll a; (B) Chl b, chlorophyll b; (C) Caro, carotenoids; (D) TChl, total chlorophyll; (E) Pn, net photosynthetic rate; (F) Gs, stomatal conductance; (G) Ci, intercellular CO2 concentration; and (H) Tr, transpiration rate. CK, P1, P2, and P3 represent 0, 1, 2, and 3 mmol Pb/kg dry soil, respectively. Values are the mean of three replicates ± SE. Values followed by different lowercase letters significantly differed, according to Duncan’s test (p < 0.05).
Figure 2. Chlorophyll pigments and photosynthetic parameters in L. cubeba female and male leaves under control and Pb treatments: (A) Chl a, chlorophyll a; (B) Chl b, chlorophyll b; (C) Caro, carotenoids; (D) TChl, total chlorophyll; (E) Pn, net photosynthetic rate; (F) Gs, stomatal conductance; (G) Ci, intercellular CO2 concentration; and (H) Tr, transpiration rate. CK, P1, P2, and P3 represent 0, 1, 2, and 3 mmol Pb/kg dry soil, respectively. Values are the mean of three replicates ± SE. Values followed by different lowercase letters significantly differed, according to Duncan’s test (p < 0.05).
Forests 14 00724 g002
Forests 14 00724 g003 550
Figure 3. The Fv/Fm (A), Fv’/Fm’ (B), ETR (C), NPQ (D), qP (E), and PSII reaction center energy distribution parameters (F) of L. cubeba female and male leaves under control and Pb treatments. CK, P1, P2, and P3 represent 0, 1, 2, and 3 mmol Pb/kg dry soil, respectively. Values are the mean of three replicates ± SE. Values followed by different lowercase letters significantly differed, according to Duncan’s test (p < 0.05).
Figure 3. The Fv/Fm (A), Fv’/Fm’ (B), ETR (C), NPQ (D), qP (E), and PSII reaction center energy distribution parameters (F) of L. cubeba female and male leaves under control and Pb treatments. CK, P1, P2, and P3 represent 0, 1, 2, and 3 mmol Pb/kg dry soil, respectively. Values are the mean of three replicates ± SE. Values followed by different lowercase letters significantly differed, according to Duncan’s test (p < 0.05).
Forests 14 00724 g003
Forests 14 00724 g004 550
Figure 4. Principal component analysis (PCA) of leaf pigments, photosynthetic parameters, and chlorophyll fluorescence parameters of L. cubeba female and male leaves under treatments (A) P1, (B) P2, and (C) P3. CK, P1, P2, and P3 represent 0, 1, 2, and 3 mmol Pb/kg dry soil, respectively.
Figure 4. Principal component analysis (PCA) of leaf pigments, photosynthetic parameters, and chlorophyll fluorescence parameters of L. cubeba female and male leaves under treatments (A) P1, (B) P2, and (C) P3. CK, P1, P2, and P3 represent 0, 1, 2, and 3 mmol Pb/kg dry soil, respectively.
Forests 14 00724 g004
Forests 14 00724 g005 550
Figure 5. Pb subcellular distribution in L. cubeba female and male leaves under control and Pb treatments. The concentration of Pb in cell walls (A), chloroplasts and cell nuclei (B), mitochondria (C), ribosomes (D), and the proportion of Pb subcellular distribution in leaves (E). CK, P1, P2, and P3 represent 0, 1, 2, and 3 mmol Pb/kg dry soil, respectively. Values are the mean of three replicates ± SE. Values followed by the different lowercase letters significantly differed, according to Duncan’s test (p < 0.05).
Figure 5. Pb subcellular distribution in L. cubeba female and male leaves under control and Pb treatments. The concentration of Pb in cell walls (A), chloroplasts and cell nuclei (B), mitochondria (C), ribosomes (D), and the proportion of Pb subcellular distribution in leaves (E). CK, P1, P2, and P3 represent 0, 1, 2, and 3 mmol Pb/kg dry soil, respectively. Values are the mean of three replicates ± SE. Values followed by the different lowercase letters significantly differed, according to Duncan’s test (p < 0.05).
Forests 14 00724 g005
Forests 14 00724 g006 550
Figure 6. Correlation coefficients between nutritional elements in the chloroplast and cell nuclei fraction and photosynthetic pigments of L. cubeba female (A) and male (B) leaves under the control and Pb treatments. *, p < 0.05; **, p < 0.01.
Figure 6. Correlation coefficients between nutritional elements in the chloroplast and cell nuclei fraction and photosynthetic pigments of L. cubeba female (A) and male (B) leaves under the control and Pb treatments. *, p < 0.05; **, p < 0.01.
Forests 14 00724 g006
Forests 14 00724 g007 550
Figure 7. Transcriptome differences between L. cubeba female and male leaves under control and Pb treatments: (A–D) The top 20 pathways of the KEGG enrichment analysis of DEGs in CKF vs. CKM (A), P2F vs. P2M (B), CKF vs. P2F (C), and CKM vs. P2M (D) induced by Pb stress; and (E) expression heatmap of genes involved in photosynthetic antenna proteins and photosynthetic electron transport proteins. CK and P2 represent 0 and 2 mmol Pb/kg dry soil. “*” indicates a statistically significant difference in expression (p < 0.05). Abbreviations and gene names are listed in Table A3.
Figure 7. Transcriptome differences between L. cubeba female and male leaves under control and Pb treatments: (A–D) The top 20 pathways of the KEGG enrichment analysis of DEGs in CKF vs. CKM (A), P2F vs. P2M (B), CKF vs. P2F (C), and CKM vs. P2M (D) induced by Pb stress; and (E) expression heatmap of genes involved in photosynthetic antenna proteins and photosynthetic electron transport proteins. CK and P2 represent 0 and 2 mmol Pb/kg dry soil. “*” indicates a statistically significant difference in expression (p < 0.05). Abbreviations and gene names are listed in Table A3.
Forests 14 00724 g007
Table
Table 1. Elemental concentrations in the chloroplast and cell nuclei fractions of L. cubeba female and male leaves under control and Pb treatments.
Table 1. Elemental concentrations in the chloroplast and cell nuclei fractions of L. cubeba female and male leaves under control and Pb treatments.
TreatmentSexPb
(μg g−1 FW)		Ca
(μg g−1 FW)		Fe
(μg g−1 FW)		K
(μg g−1 FW)		Mg
(μg g−1 FW)		Mn
(μg g−1 FW)		Zn
(μg g−1 FW)
CKFemale1.17 ± 0.17 bc219.25 ± 3.49 e30.73 ± 0.26 d425.64 ± 1.51 a44.31 ± 0.23 c8.57 ± 0.04 g11.76 ± 0.06 a
Male1.53 ± 0.29 abc154.39 ± 1.08 g19.97 ± 0.01 h225.44 ± 2.23 f27.91 ± 0.89 f5.94 ± 0.02 h7.41 ± 0.10 c
P1Female0.95 ± 0.03 cd274.71 ± 2.90 d24.06 ± 0.21 g166.53 ± 3.93 h34.48 ± 0.87 e11.64 ± 0.07 e11.91 ± 0.09 a
Male0.51 ± 0.10 d281.85 ± 2.43 cd44.71 ± 0.64 a323.04 ± 5.66 c44.22 ± 0.44 c15.28 ± 0.06 d6.22 ± 0.04 e
P2Female1.86 ± 0.26 a660.13 ± 7.03 a37.91 ± 0.40 c253.31 ± 4.21 e91.61 ± 1.20 a21.33 ± 0.20 a7.78 ± 0.04 b
Male1.62 ± 0.12 ab311.44 ± 2.43 b24.80 ± 0.09 f264.63 ± 1.38 d52.80 ± 0.98 b20.16 ± 0.21 b6.64 ± 0.03 d
P3Female1.17 ± 0.05 bc199.61 ± 2.50 f42.16 ± 0.29 b359.07 ± 1.13 b29.26 ± 1.34 f10.20 ± 0.08 f4.02 ± 0.05 f
Male1.20 ± 0.05 bc286.97 ± 1.31 c26.38 ± 0.42 e203.93 ± 1.88 g38.90 ± 0.30 d16.74 ± 0.04 c7.32 ± 0.18 c
Notes: CK, P1, P2, and P3 represent 0, 1, 2, and 3 mmol Pb/kg dry soil, respectively. Values are the mean of three replicates ± SE. Values followed by different lowercase letters significantly differed, according to Duncan’s test (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, S.; Wang, Q.; Li, W.; Yang, Y.; Jiang, L. Litsea Males Are Better Adapted to Pb Stress Than Females by Modulating Photosynthesis and Pb Subcellular Distribution. Forests 2023, 14, 724. https://doi.org/10.3390/f14040724

AMA Style

Li S, Wang Q, Li W, Yang Y, Jiang L. Litsea Males Are Better Adapted to Pb Stress Than Females by Modulating Photosynthesis and Pb Subcellular Distribution. Forests. 2023; 14(4):724. https://doi.org/10.3390/f14040724

Chicago/Turabian Style

Li, Simeng, Qinyi Wang, Wenjun Li, Yan Yang, and Lijuan Jiang. 2023. "Litsea Males Are Better Adapted to Pb Stress Than Females by Modulating Photosynthesis and Pb Subcellular Distribution" Forests 14, no. 4: 724. https://doi.org/10.3390/f14040724

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop