Next Article in Journal
Performance of Harvesting Residue Treatment Methods in South African Pine Plantations
Previous Article in Journal
Effects of Shading on the Growth and Photosynthetic Fluorescence Characteristics of Castanopsis hystrix Seedlings of Top Community-Building Species in Southern Subtropical China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 14
Issue 8
10.3390/f14081660
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterisation of Chrysoporthe cubensis and Chrysoporthe deuterocubensis, the Stem Canker Diseases of Eucalyptus spp. in a Forest Plantation in Malaysia

by
Norida Hanim Awing
1,
Annya Ambrose
1,2,
Arifin Abdu
1,
Affendy Hassan
3 and
Razak Terhem
1,*
1
Laboratory of Forest Pathology and Tree Health, Department of Forestry Science and Biodiversity, Faculty of Forestry and Environment, Universiti Putra Malaysia, Serdang 43400, Malaysia
2
Industrial Forest Research Centre, Restoration and Industrial Forest Division, Sarawak Forest Department, Kuching 93250, Malaysia
3
Faculty of Tropical Forestry, Universiti Malaysia Sabah, Kota Kinabalu 88400, Malaysia
*
Author to whom correspondence should be addressed.
Forests 2023, 14(8), 1660; https://doi.org/10.3390/f14081660
Submission received: 6 April 2023 / Revised: 23 June 2023 / Accepted: 6 July 2023 / Published: 17 August 2023
(This article belongs to the Section Forest Health)
Browse Figures
Versions Notes

Abstract

:
Commercial plantations of Eucalyptus species have been established in Malaysia, especially during the past 10 years, with the aim of sustaining the supply of wood and timber products for industrial use in Malaysia. As part of an assessment of fungal diseases affecting Eucalyptus species in four regions in Malaysia, including Kelantan, Pahang, Sabah, and Selangor, stem canker disease was discovered to be a widespread disease infecting Eucalyptus species in Malaysia. This study aimed to identify the fungus-causing stem canker disease, test its pathogenicity in Eucalyptus, and determine the mating type of isolates from the infected trees. The fungi were identified based on morphology and through comparisons of DNA sequence data from the ITS, β-tubulin 2 gene, and TEF-1α gene regions. Phylogenetic analyses showed that the causal agent of the stem canker was Chrysoporthe cubensis infecting Eucalyptus plantations in Pahang and Chrysoporthe deuterocubensis infecting Eucalyptus plantations in Kelantan, Sabah, and Selangor. We believe this is the first report of Chrysoporthe cubensis-infected Eucalyptus in Malaysia and Southeast Asia, while Chrysoporthe deuterocubensis is the first-reported species infecting Eucalyptus pellita in Malaysia. Moreover, the fact that the mating-type MAT1-1 and MAT1-2 genes and the pheromone genes ppg1, ppg2, pre1, and pre2 were identified in all isolates indicates that Chrysoporthe cubensis and Chrysoporthe deuterocubensis are homothallic mating systems. Pathogenicity was tested on a 3-year-old standing tree, 1-year-old seedling, and detached healthy leaves, which were re-isolated for fulfilling Koch’s postulates. In pathogenicity trials, both Chrysoporthe cubensis and Chrysoporthe deuterocubensis gave rise to lesions on wounded Eucalyptus. Both Chrysoporthe spp. were equally pathogenic to Eucalyptus urograndis and Eucalyptus pellita and should be regarded as a biosecurity concern in Malaysia’s forest plantation industry.

1. Introduction

The genus Eucalyptus L.’Her., Corymbia K.D.Hill and L.A.S. Johnson and Angophora Cav., a unique tree group, represents more than 900 species [1,2,3]. Due to the fast-growing and desirable wood properties, Eucalyptus was chosen as a species for forest plantation. Over the past 30 years, the establishment of Eucalyptus plantations was recorded across the world with about 22.57 million hectares established [4].
The establishment of Eucalyptus plantations significantly increases the emergence of pathogens worldwide. Important diseases in Eucalyptus plantations include stem canker caused by species of Chryphonecteriaceae [5,6] and Botryosphaericeae [6,7,8]; leaf spots or blight caused Mycosphaerellaceae and Teratosphariaceae species [9,10,11]; and bacterial wilt caused by Burkholderiaceae [12,13]. Stem canker caused by Chryphonecteriaceae is considered to be one of the most important diseases in Eucalyptus plantations. Chrysoporthe deuterocubensis and its sibling species, Chrysoporthe cubensis, known as Chrysoporthe canker, are common in many tropical and subtropical parts of the world. Chrysoporthe deuterocubensis commonly present in South East Asia [13] and Chrysoporthe cubensis is commonly present in South Africa. Both diseases are known to kill significant numbers of trees, particularly those in young plantations. As reported, the genus Chrysoporthe is an important plant pathogen infecting more than 335 plant species, distributed by nearly 100 plant families of Chryphonecteriaceae [5].
The study by the authors of [14] showed that Chrysoporthe cubensis and Chrysoporthe deuterocubensis have a homothallic mating system and can complete the sexual cycle without a compatible mate. Since the species has a homothallic mating system, both MAT1-1 and MAT1-2 idiomorphs are present in the same nucleus, allowing the ability to complete the sexual cycle without a mate. The sexual reproduction of Chrysoporthe cubensis and Chrysoporthe deuterocubensis plays a role in the disease under natural conditions [15].
Previous research results indicated that a relatively large number of Chrysoporthe species are distributed in Eucalyptus plantations worldwide. However, the presence of Chrysoporthe spp. in Eucalyptus plantations in Malaysia is poorly described. Therefore, the understanding of Chrysoporthe stem canker diseases in Eucalyptus plantations in Malaysia is limited and results in poor disease management. The objectives were (i) to identify fungi associated with canker diseases in Eucalyptus plantations in four regions in Malaysia, (ii) to analyse and develop a phylogenetic tree based on a multi-gene locus, (iii) to characterize the mating system of Chrysoporthe isolates in this study, (iv) to confirm the pathogenicity of Chrysoporthe canker on leaves, seedlings and standing Eucalyptus trees for both Eucalyptus urograndis and Eucalyptus pellita trees, and (v) to test the pathogenicity of Chrysoporthe canker of a non-host plant.

2. Materials and Methods

2.1. Study Sites and Sampling

The disease survey was conducted on 11-year-old planted Eucalyptus urophylla x Eucalyptus grandis hybrid genotypes (known as Eucalyptus urograndis) in a forest plantation in Sabah (E117°42′58.7″ N4°33′16.3″), and 3-year-old Eucalyptus urograndis planted in Pahang (E101°39′7.8102″ N2°59′10.51152″), Kelantan (E101°69476″ N4°86494″) and in Selangor (E102°7′18.04404″ N3°20′36.86064″). In Selangor, Eucalyptus pellita was included in the disease survey.
Diseased outer and inner barks with a conidiomata structure present on infected trees were sampled, placed in zip lock plastic bags, and brought to the laboratory for isolation and morphological examination. The conidia masses were collected, transferred onto 2% (v/v) malt extract agar (MEA) (Thermo Scientific Oxoid, UK) with sterile needles, and incubated for 7 days. Pure cultures were obtained via a single hyphal tip method isolated from each culture, transferred onto 2% MEA plates, and incubated at room temperature for 14 days. The pure cultures were kept in stock culture in the culture collection in Plant Pathology Laboratory, University Putra Malaysia (UPM), Serdang, Malaysia, for further analysis.

2.2. DNA Extraction, PCR Amplification, and Molecular Phylogeny

DNA was extracted from 7-day-old cultures and mycelia were collected using a sterilised scalpel and transferred to 2 mL Eppendorf tubes. Total genomic DNA was exacted following the Favorgreen Fungi Kits protocol. DNA concentration was measured with Nano-Drop 2000 Spectrometer (Thermo Fisher Scientific, Waltham, MA, USA).
PCRs were carried out in a volume of 50 μL, with 5 μLv of the DNA template, 25 μL of exTEN PCR MasterMix, 1 μL of each primer (10 μM), and a top up of 18 μL of nuclease-free water. PCR products were amplified using BioRad MyCycler Thermal Cycler (Marshall Scientific LLC Hampton, NH, USA). The internal transcribed spacer regions and intervening 5.8S rRNA gene (ITS) were amplified using the primer of the ITS1/ITS4 region [16], a part of the translation elongation factor 1-alpha (tef1) gene was amplified using the primers EF1-728F/EF1-986R [17], and one region of the β-tubulin (tub2) gene was amplified with primers BT2a and BT2b [18]. Specific primers targeted genes encoded at the mating-type locus (MAT1-1-1, MAT1-1-2, MAT1-1-3, and MAT1-2-1) gene were amplified using the primers mat1QL/mat1QR, mat2QL/mat2QR, mat112QL/mat112QR, and mat113QL/mat113QR, as well as the specifically targeted primers the genes encoded at the pheromone (ppg1 and ppg2-1) and pheromone receptor (pre-1 and pre-2) genes [19,20,21] (Table 1).
Cycling conditions consisted of initial denaturation at 94 °C (5 m), followed by 32 cycles of denaturation at 94 °C (15 s), annealing at 56 °C (15 s), and extension at 72 °C (40 s) for primer sets ITS1/4. Standard PCR conditions were used for all reactions with the annealing temperature for each specific primer pair obtained from primer synthesis reports. PCR products were separated using 1% agarose gel in a 1× TAE buffer (90 mM Tris-acetate and 2 nM EDTA, pH8), stained with Florosafe and documented using FluroChem™ (Alpha Innotech, USA). PCR products were sent for sequencing using MyCyclerTM (Bio-Rad, USA) at the First Base Laboratory Sdn. Bhd., Selangor, Malaysia. Forward and reverse sequences of ITS, tef1, β-tub, MAT locus, pheromone, and pheromone receptor gene regions were deposited in GenBank (https://www.ncbi.nlm.nih.gov (accessed on 31 March 2023).
All published species’ sequences were retrieved from GenBank after a BLASTN search and were used for sequence comparisons and phylogenetic analyses. The datasets of [22] were used as templates for analyses. The alignments were visualised in MEGA 7 [23]. Phylogenetic trees were viewed using MEGA 7, and the sequence data of Endothia gyrosa was used as outgroups.

2.3. Pathogenicity Tests

Chrysoporthe cubensis isolated from Pahang and Chrysoporthe deuterocubensis isolated from Kelantan, Selangor, and Sabah, respectively, were used for determining pathogenicity and Koch’s postulates. Pathogenicity tests were conducted on a 3-year-old standing tree, 1-year-old seedling, and detached leaves, as described below.

2.3.1. Three-Years-Old Standing Tree

A portable electric drill (5 mm diam) was used to drill and wound a 3-year-old standing tree stand approximately 1.5 m above the ground. Agar plugs taken from the edges of actively growing cultures were placed into the wounds with the mycelial surface facing the cambium. Cambium surfaces were sprayed with sterile distilled water to allow the optimum growth of the mycelium of the test pathogen. The inoculated stems were wrapped with parafilm to reduce contamination and desiccation. In total, 20 isolates of Chrysoporthe cubensis and Chrysoporthe deuterocubensis isolated from four different regions were used for the pathogenicity test. The setup is shown in Table 2. In total, 3 technical replicates of each isolate were used for each individual inoculated tree. Non-inoculated malt extract agar (MEA) was used as a control. However, only one strain of Chrysoporthe cubensis (NHASUL1) and one strain of Chrysoporthe deuterocubensis (NHATWU9, the most virulent strain) was plugged to the tree stand of Eucalyptus deglupta and Aqualaria sinensis, respectively. The data from the inoculation were subjected to a one-way analysis of variance (ANOVA) and Tukey’s test to determine if there was a significant difference in the pathogenicity of the isolates on the different hosts. The analysis was performed using Statistical Analysis Systems (SAS) software version 9.2 (SAS Institute Inc., Cary, NC, USA). Figure 1 shows the replication of the inoculated tree. Lesion development was measured using a digital caliper 8 weeks after inoculation.

2.3.2. Seedling

On seedling trial test, 1-year-old potted Eucalyptus urograndis (approximately in 100 cm tall and grown in 20 cm diameter plastic pot) was used for the pathogenicity. The most virulent isolate based on field trial result were applied on seedlings test. The isolate NHASUL1:OQ581890 of Chrysoporthe cubensis and NHATWU9:OQ581908 of Chrysoporthe deuterocubensis were used for the pathogenicity test (Table 3). A blank agar was used as control.

2.3.3. Pathogenicity Testing Using Detached Leaves

Leaves obtained from 17 selected tree species were used for the pathogenicity test on Chrysoporthe deuterocubensis. Detached leaves for conducting the pathogenicity test were from tree species listed as follows. (1) Eucalyptus spp. tree: Eucalyptus urophylla, Eucalyptus camaldulensis, Eucalyptus urograndis, Eucalyptus deglupta, Eucalyptus grandis and Eucalyptus pellita; (2) crop plants: Syzygium aromaticum, Nephelium lappaceum, Durio zibenthinus and Mangifera indica; (3) wild herbs: Melastoma marianum and Melastoma malabathricum; (4) dipterocarp trees: Aquilaria sinensis, Dyera costulata, Neobalanorpus heimii and Hopea odorata, which were were tested to conduct the study.
The leaf surface was washed with sterilised water and wounded before inoculation with Chrysoporthe deuterocubensis isolates from Sabah (NHATWU9:OQ581908). Inoculations were conducted with a 5 mm diameter mycelia plug from 7-day-old seedling. Mycelia plugs of the isolate were inoculated on ten leaves and each test sample was placed upside down on the abaxial surface of the leaflets. To allow sufficient humidity, the test leaves were kept in plastic boxes (length and height: 20 cm; width: 10 cm) in stable climatic conditions (temperature, 24–26 °C; humidity, 60%–70%). The mycelial plug inoculations were monitored each day, and the length of lesions produced was measured. Leaf disease severity was assessed by estimating the percentage of the lesion area on each leaf with a scale from 0 to 5, where 0 indicated no lesions, 1 indicated that 1 to 10% of the area of the leaf was lesioned, 2 indicated a lesion, 4 indicated that 51 to 75% of the area of the leaf was lesioned, and 5 indicated that 76 to 100% of the area of the leaf was lesioned. For re-isolations, small pieces of the discoloured leaf (approximately 0.04 cm2) from the edges of the resultant lesions were cut and placed on 2% MEA at room temperature.

3. Results

3.1. Fungal Isolations

A total of 212 isolates belonging to Chrysoporthe deuterocubensis were isolated from the bark covering cankers on Eucalyptus urograndis and 43 isolates of Chrysoporthe deuterocubensis were isolated from Eucalyptus pellita. In total, 45 isolates were collected at Pahang and are known as Chrysoporthe cubensis. The results are summarised and recorded in the following Table 4.

3.2. Disease Symptoms and Morphology

3.2.1. Chrysoporthe deuterocubensis

Stem cankers caused by Chrysoporthe deuterocubensis were localised on dead, cracked and sunken areas of the trunk of infected trees, which may have caused tree fall (die back) (Figure 2A). Massive Chrysoporthe deuterocubensis fruiting bodies were observed to have developed on the outer layer of the bark. The tissues underneath the depressed bark were brown and apparently dead. The bark later split around the infected area and gummosis was generally observed on cankers, as is usually associated with older cankers (Figure 2B,C). The area was infected via the formation of a callus around the site of infection, leading to the bulging of the outer layer of the bark (Figure 2D). A cross-section through the infected trunk showing the gummosis (kino bleeding) caused by Chrysoporthe deuterocubensis can be clearly seen (Figure 2E).
The layer was eventually shed resulting in a canker. On certain trees, an infected outer bark may be sloughed off before the cambium is killed. On others, typical cankers are produced as the cambium is killed. Multiple cankers are occasionally found on trunks and become confluent to form long cankerous areas. The cankers usually develop above ground level but occasionally at the base. Large above-ground and basal cankers are responsible for the mortality of trees due to the complete girdling of the phloem. On diseased stumps, fewer sprouted clumps and multiple copy shoots develop. Shoots remained stunted and weak in comparison to those on healthy stumps (Figure 2F). The yellowish conidia on the black long conidiomata of Chrysoporthe deuterocubensis developed around the bark surface (Figure 2G) and long golden-coloured asexual fruiting structures (Figure 2H). The culture that grew on MEA is usually white when young and becomes pale yellow-brown in the centre with age with the optimal temperature for growth being 30 °C. Figure 2I shows the living culture of Chrysoporthe deuterocubensis after growing for 14 days on MEA at room temperature (Figure 2J) with sexual fruiting structures of Chrysoporthe deuterocubensis in culture.

3.2.2. Chrysoporthe cubensis

The severe cases of stem canker disease caused by Chrysoporthe cubensis can result in tree death. The pathogen kills the cambium, which is cracked and sunken on the trunk of infected trees (Figure 3A). The cankers are usually found at the base or on the lower stems of trees and bark cracking and swelling can be seen in Figure 3B. Conidiomata of Chrysoporthe cubensis around bark surface Figure 3C). Fresh and dried gummosis with yellowish conidia of Chrysoporthe cubensis was developed around the bark surface (Figure 3D). (Figure 3E) The pyriform conidiomata and extending perithecia necks were covered in dark tissue (Figure 3F). The pulvinate conidiomata and perithecia necks extending from the stromatal surface were covered in orange tissue (Figure 3G). Isolations from single conidia were made from the fruiting structures using malt extract agar MEA and Chrysoporthe cubensis grew optimally at 30 °C. Figure 3H shows the culture colour and development of the conidiomata.

3.3. Phylogenetic Analysis

A total of 17 isolates of Eucalyptus urograndis from four region; Kelantan, Pahang, Sabah and Selangor, respectively were subjected to DNA sequence analysis of ITS sequence. BLAST analysis of Genbank showed all 17 isolates from Pahang had 100% similarity with the reference sequence of Chrysoporthe cubensis MH858337. While all 17 isolates from Kelantan, Pahang, and Sabah showed 100% similarity with the reference sequence of Chrysoporthe deuterocubensis MH465621. Supplementary Figure S1 showed polymorphism of Chrysoporthe cubensis obtained from Pahang and Chyrsoporthe deuterocubensis obtained from Kelantan, Sabah and Selangor of ITS sequence with reference sequence of Chrysoporthe cubensis MH858337 and Chrysoporthe deuterocubensis MH465621, respectively.
For further analysis β-tubulin 2 and TEF-1α gene regions were used. All 17 isolates of Chrysoporthe cubensis from Pahang and 17 isolates of Chrysoporthe deuterocubensis from Kelantan, Sabah and Selangor showed 100% similarity with the reference sequence of TEF-1α of Chrysoporthe cubensis Q290141 and Chrysoporthe deuterocubensis CQ290148, respectively. For β-tubulin 2 all representative isolates showed 100% similarity with the reference sequences of Chrysoporthe cubensis HM142129 and Chrysoporthe deuterocubensis MH550155. Sequences from isolates were submitted to the Genbank database with ID numbers OQ581870-OQ581919 for ITS, OR096050-OR096059 (Chrysoporthe cubensis) and OR120063-OR120102 (Chrysoporthe deuterocubensis) for β-tubulin 2, and OR096060-OR096069 (Chrysoporthe cubensis) and OR096010-OR096049 (Chrysoporthe deuterocubensis) for TEF-1α gene regions. Supplementary Figure S2A showed molecular phylogenetic analysis of the combined data set ITS, β-tubulin 2 and TEF-1α confirmed the distinction of Chrysoporthe cubensis and Chrysoporthe deuterocubensis. For single sequence molecular phylogenetic tree, all data set showed that Chrysoporthe cubensis and Chrysoporthe deuterocubensis in different clade (Supplementary Figure S2B,C) except for data set sequence of TEF-1α (Supplementary Figure S2D).

3.4. MAT Gene Amplification and Mating Types Assignment

The mating type idiomorphs were successfully amplified in all Chrysoporthe cubensis and Chrysoporthe deuterocubensis isolates. Each isolate was positive amplification by MAT1-1 locus consists of MAT1-1-1 gene on 824 bp, MAT1-1-2 gene on 912 bp and MAT1-1-3 gene on 467 bp while MAT1-2-1 on 536 bp gene, respectively. All amplifies isolates of Chrysoporthe. cubensis and Chrysoporthe deuterocubensis had both the MAT1-1 and MAT1-2 mating types, confirming that they are homothallic mating species system. Supplementary Figure S3 shows of MAT1-1-1, MAT1-1-2, MAT1-1-3 and MAT1-2-1 amplicons in selected isolates. In addition the pheromone (ppg1 and ppg2-1) and pheromone receptor (pre-1 and pre-2) were successfully amplified in both Chrysoporthe cubensis and Chrysoporthe deuterocubensis.

3.5. Pathogenicity Tests

3.5.1. 3 Years Old Standing Tree

A total of 20 isolates representing Chrysoporthe cubensis and 20 isolates representing Chrysoporthe deuterocubensis isolated from Kelantan, Sabah and Selangor were selected and inoculated on 3 years old standing trees of two Eucalyptus urograndis and Eucalyptus pellita using mycelia plugs (Figure 4). The mycelia plugs of all tested isolates produced lesions on bark surface while no lesions were observed on the negative control. The longest and the shortest average lesion were 2.9 and 6.9 cm, respectively (Figure 5). Chrysoporthe cubensis (NHASUL1:OQ581890) induced an average lesion length of 3.5–5.5 cm, while Chrysoporthe deuterocubensis induced an average lesion length of 4.9–6.9 cm. Chrysoporthe deuterocubensis from Sabah (NHATWU9:OQ581908) was most aggressive on the tested stands of Eucalyptus urograndis followed by Chrysoporthe deuterocubensis from Selangor (NHAPCH2:OQ581881) with an average of 2.9–6.2 cm and Chrysoporthe deuterocubensis from Kelantan (NHAUMW2:OQ581911), with an average of 5.2–5.9 cm, with a value of <0.001 at the 95% confidence level. The Chrysopothe cubensis and Chrysoporthe deuterocubensis with the same characteristics as those of the originally inoculated fungi were successfully re-isolated from diseased bark, but none were isolated from the negative control, thus fulfilling the requirements of Koch’s postulates. Furthermore, Chrysoporthe cubensis (NHASUL1:OQ581890) and Chrysoporthe deuterocubensis (NHATWU9:OQ581908) were tested on Eucalyptus deglupta and the non-host tree Aqualaria sinensis. Lesions developed on Eucalyptus deglupta infected by Chrysoporthe cubensis (NHASUL1:OQ581890) and did not develop for Chrysoporthe deuterocubensis (NHATWU9:OQ581908). No lesions developed on Aquilaria sinensis for both Chrysoporthe cubensis (NHASUL1:OQ581890) and Chrysoporthe deuterocubensis (NHATWU9:OQ581908), respectively. Figure 6 shows 3-year-old standing tree stands after 8 weeks of inoculation.

3.5.2. One-Year-Old Seedling

The isolates of Chrysoporthe cubensis (NHASUL1:OQ581890) and Chrysoporthe deuterocubensis (NHATWU9:OQ581908, NHAPCH2:OQ581881 and NHAUMW1:OQ581910) were tested on a 1-year-old potted seedling of Eucalyptus urograndis. After four weeks, all leaves on the upper part and at inoculant points wilted and dried (Figure 7). A seedling also produced few coppices as a response to the death area resulting from infection (Figure 7B). A significant difference was found between both isolates of two Chrysoporthe cubensis and Chrysoporthe deuterocubensis tested (p < 0.0001). No necroses or lesions were caused on the control plants. The isolate Chrysoporthe deuterocubensis from Sabah (NHATWU9:OQ581908) showed longer a lesion length on seedlings (0.6–1.1 cm). Conidiomata were collected to be re-isolated to fulfil the requirements of Koch’s postulates. Figure 8 shows a fruiting structure that developed on the infected area.
The pathogenicity test was also carried out on a 1-year-old seedling of a non-host tree. The tested trees were Hopea odorata (Merawan Siput Jantan), Shorea leprosula (Meranti Tembaga), Neobalanocarpus heimii (Cengal), Gonystylus bancanus (Ramin), Casuarina equisetifolia (Rhu Pantai), and Dipterocarpus elongatus (Keruing). The tested isolates were Chrysoporthe cubensis (NHASUL1:OQ581890), and Chrysoporthe deuterocubensis (NHATWU9:OQ581908, NHAPCH2:OQ581881, and NHAUMW1:OQ581910). After four weeks, only the Neobalanocarpus heimii (Cengal) seedling responded to the infection. All leaves above the inoculant points wilted and dried (Figure 9B) and the seedling also produced a coppice as a response to the death area caused by the infection (Figure 9B). Perithecia on crack and sunken (developed on inoculation area) (Figure 9C) were collected to fulfil the requirements of Koch’s postulates. No necrosis or lesions were produced on control plants.

3.5.3. Detached Leaves

Chrysoporthe deuterocubensis isolated from Sabah (NHATWU9:OQ581908) was selected and inoculated on detached leaves. Lesions developed on the leaf surface after 7 days from inoculation (Figure 10) except for Dyera costulata, Neobalanorpus heimii, and Hopea odorata, for which no symptoms were recorded. No lesions were observed on the negative control. Chrysoporthe deuterocubensis with the same morphological characteristics as those of the originally inoculated fungi was successfully re-isolated from diseased tissues on the inoculated leaves, but never from the negative control, thus fulfilling the requirements of Koch’s postulates. For this test, experiments were repeated twice and showed that lesions were produced. Three (3) dipterocarp leaves (Figure 10N–P) showed that no lesions were developed on the leaves’ surface.

4. Discussions

The emergence of Chrysoporthe cubensis and Chrysoporthe deuterocubensis pathogens is a threat to the vitality of Eucalyptus spp. plantations in Malaysia. These pathogens are notorious pathogens that have been identified in many countries growing Eucalyptus trees for forest plantation, including Australia, Cameroon, Tanzania, Democratic Republic of Congo, Southeast Asia, South, Central and North America, Africa, and Hawaii [6,24,25]. In combination with the results from a previous study, this species was isolated from a Eucalyptus hybrid, namely Eucalyptus urograndis, in Malaysia [22], and this is the first recorded case of Chrysoporthe cubensis infecting Eucalyptus spp. in Malaysia and in the tropics. Stem disease with the typical symptoms caused by Chrysoporthe species was observed in four regions of Eucalyptus spp. plantations in Sabah, Pahang, Kelantan, and Selangor. A relatively large number of Chrysoporthe isolates were isolated from the diseased bark of two Eucalyptus genotypes sampled from trees in the plantation.
The isolates obtained in this study were identified mainly based on DNA sequence comparisons of single and combined ITS, β-tubulin 2 gene and TEF-1α gene regions. The sequences of the three genes have been widely used to clearly distinguish between the intra- and inter-specific divergence of the Chryphonectriaceae genus [26]. Recently, Ref. [6] conducted a comprehensive phylogenetic analysis of the Chryphonectriaceae genus based on DNA sequences of eight gene regions; the results showed that tef1, and tub2 sequences had the strongest ability to correctly identify species. Results confirmed the importance of multi-gene sequence phylogeny in species clarification and identification in Chryphonectriaceae.
The whole-genome MAT1-1 and MAT1-2 mating system in Chrysoporthe deuterocubensis and Chrysoporthe cubensis was analysed by the authors of [14], providing first description of mating type gene. In this study, the homothallism in Chrysoporthe deuterocubensis and Chrysoporthe cubensis was confirmed by the ability to detect the MAT1-1 and MAT1-2 locus amplicion isolation of individual isolates from single-hypha culture. A homothallic fungus such as Chrysoporthe deuterocubensis might have evolved in a similar pattern to that of asexual organisms with the appearance of clonal meiotic reproduction events that do not lead to the recombination of new alleles. The development and formation of a fruiting body is predominant in all cankers caused by Chrysoporthe deuterocubensis and Chrysoporthe cubensis, irrespective of the host [27]. Similarly to other homothallic microorganisms from the same phylum (Ascomycetes), the mating type locus of Chrysoporthe deuterocubensis contains Sordariomycete MAT genes MAT1-1 and MAT1-2 [19,28,29]. These genes were shown to be involved in sexual development [29].
The results of the pathogenicity tests based on mycelial plug inoculations in this study showed that all tested isolates were pathogenic for the two tested Eucalyptus species. In comparing both Chrysoporthe species, Chrysoporthe deuterocubensis has more virulence compared to Chrysoporthe cubensis. This was unsurprising for Chrysoporthe deuterocubensis, since inoculations in previous studies by the authors of [22] indicated that Chrysoporthe deuterocubensis is highly pathogenic in tested Eucalyptus species and is considered to be an important pathogen in Eucalyptus as well as many other plants [26]. The study conducted by the authors of [5] also showed that Chrysoporthe deuterocubensis is the most aggressive and highly pathogenic species among the different eight species in the family of Cryphonecteriaceae identified in China. As shown in this study, the severity rates of disease differ between trees, especially according to tree age. In the early stage, the disease could be detected on Eucalyptus urograndis three years after it was planted. Factors that influence different severity rates of Chrysoporthe deuterocubensis remain unknown. Disease severity could be caused by environmental factors or virulence genes such as CAZymes expressed via the degradation of plant cell walls [30] by the fungus during infection. The weak pathogenicity of other fungi from the Cryphonectriaceae family may be facilitated by environmental conditions, such as abiotic stress on the host or disturbance of the host microbiome [30]. Base on field observations, both Chrysoporthe spp discovered in this study enter the tree through natural openings and wounds, leading to infection in the inner bark and cambium layers.
This study conducted the first pathogenicity test for Eucalytus deglupta and Aquilaria sinensis with both Chrysoporthe cubensis and Chrysoporthe cubensis. Chrysoporthe deuterocubensis was pathogenic to all tested plants, which is a cause for concern due to its potential outbreak in another dipterocarp. Various canker pathogens of Chrysoporthe are known to undergo host jumps and may be considered latent pathogens that are similar to some endophyte jumps [31,32] between families and genera in Myrtales (Myrtaceae and Melastomataceae). In Colombia, Miconia rubiginosa (Melastomataceae) caused disease in exotic species of Eucalyptus that grew alongside each other. The origin of Chrysoporthe cubensis is not known but could have originated in native Melastomataceae or Myrtaceae in Pahang. These plants are common in the area and could represent a ready source of potential fungal pathogens capable of host jumps.

5. Conclusions

This study expanded our understanding of the species diversity, host range, mating strategy, genetic diversity, and pathogenicity of Chrysoporthe in Eucalyptus spp. plantations. Further studies are necessary to increase the knowledge of fungi’s ecology, the propagation pathway for these species, and the pathogenesis of the species. The inoculation results further indicated that the tolerance of different Eucalyptus genotypes is different, which highlights the importance of selecting disease-resistant Eucalyptus genotypes in the future.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/f14081660/s1, Figure S1: Alignment of a region of partial ITS sequence single polymorphism between Chrysoporthe cubensis and Chrysoporthe deuterocubensis; Figure S2: (A) Phylogram from a maximum likehood of six Chrysoporthe spp. and Endothia gyrosa as outgroup based on the combined ITS, β-tubulin 2 gene and TEF-1α. (B) Phylogram from a maximum likehood of six Chrysoporthe spp. and Endothia gyrosa as outgroup based on the ITS regions. (C) Phylogram from a maximum likehood search of six Chrysoporthe spp. and Endothia gyrosa as outgroup based on the β-tubulin 2 region. (D) Phylogram from a maximum likehood of six Chrysoporthe spp. and Endothia gyrosa as outgroup based on the TEF-1α; Figure S3: Amplicon of MAT1-1 locus genes and MAT1-2 locus gene. a. MAT1-1-1 842 bp, b MAT1-1-2 912 bp, c. MAT1-1-3 467 bp and d. MAT1-2-1 536 bp.

Author Contributions

Methodology, N.H.A., A.A. (Annya Ambrose) and R.T.; Formal analysis, R.T.; Investigation, N.H.A.; Resources, A.A. (Arifin Abdu); Data curation, N.H.A.; Writing—original draft, N.H.A.; Writing—review & editing, A.H. and R.T.; Supervision, R.T.; Project administration, A.A. (Annya Ambrose), A.H. and R.T.; Funding acquisition, R.T. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the key program of the Transdisciplinary Research Grant Scheme (TRGS 2018-1), reference code TRGS/1/2018/UPM/01/2/1, Ministry of Higher Education Malaysia.

Data Availability Statement

Not applicable.

Acknowledgments

Special thanks go to Pahang Department of Forestry, Kelantan Department of Forestry, Sabah Softwood Berhad and Institute of Tropical Forestry and Forest Products, Universiti Putra Malaysia, for allowing access to the Eucalyptus forest plantation plot.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Brooker, M.I.H. A new classification of the genus Eucalyptus L’Her. (Myrtaceae). Aust. Syst. Bot. 2000, 13, 79–148. [Google Scholar] [CrossRef]
  2. Keane, P.J.; Kile, G.A.; Podger, F.D.; Brown, B.N. (Eds.) Diseases and Pathogens of Eucalypts; CSIRO: Melbourne, Australia, 2000. [Google Scholar]
  3. Nicolle, D. A classification and census of regenerative strategies in the eucalypts (Angophora, Corymbia and Eucalyptus—Myrtaceae), with special reference to the obligate seeders. Aust. J. Bot. 2006, 54, 391–407. [Google Scholar] [CrossRef]
  4. Yahya, A.Z. Planting of Eucalyptus in Malaysia. Acta Sci. Agric. 2020, 4, 139. [Google Scholar] [CrossRef]
  5. Wang, W.; Li, G.Q.; Liu, Q.L.; Chen, S.F. Cryphonectriaceae on Myrtales in China: Phylogeny, host range, and pathogenicity. Persoonia–Mol. Phylogeny Evol. Fungi 2020, 45, 101–131. [Google Scholar] [CrossRef]
  6. Chen, S.; Gryzenhout, M.; Roux, J.; Xie, Y.; Wingfield, M.J.; Zhou, X.D. Identification and pathogenicity of Chrysoporthe cubensis on Eucalyptus and Syzygium spp. in South China. Plant Dis. 2010, 94, 1143–1150. [Google Scholar] [CrossRef]
  7. Li, G.; Slippers, B.; Wingfield, M.J.; Chen, S. Variation in Botryosphaeriaceae from Eucalyptus plantations in YunNan Province in southwestern China across a climatic gradient. IMA Fungus 2020, 11, 22. [Google Scholar] [CrossRef]
  8. Li, G.; Liu, F.; Li, J.; Liu, Q.; Chen, S. Botryosphaeriaceae from Eucalyptus plantations and adjacent plants in China. Persoonia–Mol. Phylogeny Evol. Fungi 2018, 40, 63–95. [Google Scholar] [CrossRef]
  9. Burgess, T.I.; Wingfield, M.J.; Drenth, A. Quambalaria species associated with plantation and native eucalypts in Australia. Plant Pathol. 2008, 57, 702–714. [Google Scholar]
  10. Burgess, T.I.; Barber, P.A.; Sufaati, S.; Xu, D.; Hardy, G.S.J.; Dell, B. Mycosphaerella spp. on Eucalyptus in Asia: New species, new hosts and new records. Fungal Divers. 2007, 24, 135–157. [Google Scholar]
  11. Burgess, T.I.; Andjic, V.; Hardy, G.S.; Dell, B.; Xu, D. First report of Phaeophleospora destructans in China. J. Trop. For. Sci. 2006, 18, 144–146. [Google Scholar]
  12. Carstensen, G.D.; Venter, S.N.; Wingfield, M.J.; Coutinho, T.A. Two Ralstonia species associated with bacterial wilt of Eucalyptus. Plant Pathol. 2017, 66, 393–403. [Google Scholar]
  13. Old, K.M.; Wingfield, M.J.; Yuan, Z.Q. A Manual of Diseases of Eucalyptus in South-East Asia; Centre for International Forestry Research: Jakarta, Indonesia, 2003. [Google Scholar]
  14. Kanzi, A.M.; Steenkamp, E.T.; Van der Merwe, N.A.; Wingfield, B.D. The mating system of the Eucalyptus canker pathogen Chrysoporthe austroafricana and closely related species. Fungal Genet. Biol. 2019, 123, 41–52. [Google Scholar] [CrossRef] [PubMed]
  15. Myburg, H.; Gryzenhout, M.; Heath, R.; Roux, J.; Wingfield, B.D.; Wingfield, M.J. Cryphonectria canker on Tibouchina in South Africa. Mycol. Res. 2002, 106, 1299–1306. [Google Scholar] [CrossRef]
  16. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar]
  17. Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
  18. Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef]
  19. Lee, J.; Lee, T.; Lee, Y.-W.; Yun, S.-H.; Turgeon, B.G. Shifting fungal reproductive mode by manipulation of mating type genes: Obligatory heterothallism of Gibberella zeae. Mol. Microbiol. 2003, 50, 145–152. [Google Scholar] [CrossRef]
  20. Kim, H.; Borkovich, K.A. Pheromones Are Essential for Male Fertility and Sufficient to Direct Chemotropic Polarized Growth of Trichogynes during Mating in Neurospora crassa. Eukaryot. Cell 2006, 5, 544–554. [Google Scholar] [CrossRef]
  21. Mayrhofer, S.; Weber, J.M.; Poggeler, S. Pheromones and Pheromone Receptors Are Required for Proper Sexual Development in the Homothallic Ascomycete Sordaria macrospora. Genetics 2006, 172, 1521–1533. [Google Scholar] [CrossRef]
  22. Rauf, H.T.; Saleem, B.A.; Lali, M.I.U.; Khan, M.A.; Sharif, M.; Bukhari, S.A.C. A citrus fruits and leaves dataset for detection and classification of citrus diseases through machine learning. Data Brief 2019, 26, 104340. [Google Scholar] [CrossRef]
  23. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar]
  24. Gryzenhout, M.; Wingfield, B.D.; Wingfield, M.J. Taxonomy, Phylogeny, and Ecology of Bark-Inhabiting and Tree-Pathogenic Fungi in the Cryphonectriaceae; American Phytopathological Society (APS Press): St. Paul, MN, USA, 2009. [Google Scholar]
  25. Gryzenhout, M.; Myburg, H.; Van der Merwe, N.A.; Wingfield, B.D.; Wingfield, M.J. Chrysoporthe, a new genus to accommodate Cryphonectria cubensis. Stud. Mycol. 2004, 50, 119–142. [Google Scholar]
  26. Wu, W.; Chen, S. Species diversity, mating strategy and pathogenicity of Calonectria species from diseased leaves and soils in the Eucalyptus plantation in southern China. J. Fungi 2021, 7, 73. [Google Scholar] [CrossRef] [PubMed]
  27. Van Heerden, S.W.; Wingfield, M.J. Genetic diversity of Cryphonectria cubensis isolates in South Africa. Mycol. Res. 2001, 105, 94–99. [Google Scholar] [CrossRef]
  28. Pöggeler, S. MAT and its role in the homothallic ascomycete Sordaria macrospora. In Sex in Fungi: Molecular Determination and Evolutionary Implications; Wiley: Hoboken, NJ, USA, 2007; pp. 171–188. [Google Scholar]
  29. Klix, V.; Nowrousian, M.; Ringelberg, C.; Loros, J.J.; Dunlap, J.C.; Pöggeler, S. Functional Characterization of MAT1-1—Specific Mating-Type Genes in the Homothallic Ascomycete Sordaria macrospora Provides New Insights into Essential and Nonessential Sexual Regulators. Eukaryot. Cell 2010, 9, 894–905. [Google Scholar] [CrossRef] [PubMed]
  30. Stauber, L.; Prospero, S.; Croll, D. Comparative Genomics Analyses of Lifestyle Transitions at the Origin of an Invasive Fungal Pathogen in the Genus Cryphonectria. mSphere 2020, 5, e00737-20. [Google Scholar] [CrossRef] [PubMed]
  31. Granados, G.M.; McTaggart, A.R.; Rodas, C.A.; Roux, J.; Wingfield, M.J. Species of Cryphonectriaceae occupy an endophytic niche in the Melastomataceae and are putative latent pathogens of Eucalyptus. Eur. J. Plant Pathol. 2020, 156, 273–283. [Google Scholar] [CrossRef]
  32. Slippers, B.; Stenlid, J.; Wingfield, M.J. Emerging pathogens: Fungal host jumps following anthropogenic introduction. Trends Ecol. Evol. 2005, 20, 420–421. [Google Scholar] [CrossRef]
Forests 14 01660 g001
Figure 1. Inoculated stand tree. (1) Isolation for replicate no. 1 and 2; isolation for replicate no. 2 and 3; isolation for replicate no. 3; and (C) control.
Figure 1. Inoculated stand tree. (1) Isolation for replicate no. 1 and 2; isolation for replicate no. 2 and 3; isolation for replicate no. 3; and (C) control.
Forests 14 01660 g001
Forests 14 01660 g002
Figure 2. (A) Chrysoporthe deuterocubensis affected on Eucalyptus urograndis in plantation. (B) Canker caused by Chrysoporthe deuterocubensis on trunk fall down. (C) Trunk canker showing gummosis. (D) Swollen/callus leading to bulging of outer layer of bark. (E) Section through trunk canker showing gummosis (kino bleeding). (F) Coppices develop on the stem of Eucalyptus urograndis. (G) Conidiomata of Chrysoporthe deuterocubensis on bark surface. (H) Long golden-coloured cirrhi fruiting bodies of Chrysoporthe deuterocubensis. (I) Chrysoporthe deuterocubensis grown on MEA agar. (J) Fruiting body developed on MEA agar.
Figure 2. (A) Chrysoporthe deuterocubensis affected on Eucalyptus urograndis in plantation. (B) Canker caused by Chrysoporthe deuterocubensis on trunk fall down. (C) Trunk canker showing gummosis. (D) Swollen/callus leading to bulging of outer layer of bark. (E) Section through trunk canker showing gummosis (kino bleeding). (F) Coppices develop on the stem of Eucalyptus urograndis. (G) Conidiomata of Chrysoporthe deuterocubensis on bark surface. (H) Long golden-coloured cirrhi fruiting bodies of Chrysoporthe deuterocubensis. (I) Chrysoporthe deuterocubensis grown on MEA agar. (J) Fruiting body developed on MEA agar.
Forests 14 01660 g002
Forests 14 01660 g003
Figure 3. (A) Chrysoporthe cubensis affecting Eucalyptus urograndis in plantation. (B) Bark cracking and swelling. (C) Conidiomata of Chrysoporthe cubensis around bark surface. (D) Asexual fruiting structures in form of long golden-coloured cirrhi. (E) Conidiomata of Chrysoporthe cubensis on bark surface. (F) Long golden-coloured cirrhi fruiting bodies of Chrysoporthe cubensis. (G) Living culture of Chrysoporthe cubensis after growing for 14 days on MEA at room temperature. (H) Asexual fruiting structures of Chrysoporthe deuterocubensis in culture.
Figure 3. (A) Chrysoporthe cubensis affecting Eucalyptus urograndis in plantation. (B) Bark cracking and swelling. (C) Conidiomata of Chrysoporthe cubensis around bark surface. (D) Asexual fruiting structures in form of long golden-coloured cirrhi. (E) Conidiomata of Chrysoporthe cubensis on bark surface. (F) Long golden-coloured cirrhi fruiting bodies of Chrysoporthe cubensis. (G) Living culture of Chrysoporthe cubensis after growing for 14 days on MEA at room temperature. (H) Asexual fruiting structures of Chrysoporthe deuterocubensis in culture.
Forests 14 01660 g003
Forests 14 01660 g004
Figure 4. (A) Standing tree of Eucalyptus urograndis with copies appears below tested area after 8 months. (B) Cracks and sunken appearance. (C) Perithecia on outer bark. (D) Inserted inoculum area wrapped by parafilm. (E) Fresh and dried kino/gummosis. (F) Perithecia (yellow mark), a drilled area for agar plugs (red mark).
Figure 4. (A) Standing tree of Eucalyptus urograndis with copies appears below tested area after 8 months. (B) Cracks and sunken appearance. (C) Perithecia on outer bark. (D) Inserted inoculum area wrapped by parafilm. (E) Fresh and dried kino/gummosis. (F) Perithecia (yellow mark), a drilled area for agar plugs (red mark).
Forests 14 01660 g004
Forests 14 01660 g005
Figure 5. Column chart indicating the lesion length (mm) in the stand trial. The mycelia plug inoculation trials of two Eucalyptus urograndis was tested with selected pathogen strains of Chrysoporthe isolates and the controls. Bars topped by different letters indicate treatment means that are significantly different (p = 0.05).
Figure 5. Column chart indicating the lesion length (mm) in the stand trial. The mycelia plug inoculation trials of two Eucalyptus urograndis was tested with selected pathogen strains of Chrysoporthe isolates and the controls. Bars topped by different letters indicate treatment means that are significantly different (p = 0.05).
Forests 14 01660 g005
Forests 14 01660 g006
Figure 6. Lesions resulting from inoculations. (A) Eucalyptus urograndis. (B) Eucalyptus pellita. (C) Eucalyptus deglupta. (D) Aqualaria sinensis after 8 weeks inoculations of Chrysoporthe deuterocubensis. (E) Eucalyptus urograndis. (F) Eucalyptus pellita. (G) Eucalyptus deglupta. (H) Aqualaria sinensis 8 weeks after inoculation affected by Chrysoporthe cubensis.
Figure 6. Lesions resulting from inoculations. (A) Eucalyptus urograndis. (B) Eucalyptus pellita. (C) Eucalyptus deglupta. (D) Aqualaria sinensis after 8 weeks inoculations of Chrysoporthe deuterocubensis. (E) Eucalyptus urograndis. (F) Eucalyptus pellita. (G) Eucalyptus deglupta. (H) Aqualaria sinensis 8 weeks after inoculation affected by Chrysoporthe cubensis.
Forests 14 01660 g006
Forests 14 01660 g007
Figure 7. (A) Innoculation test from four isolates conducted on Eucalyptus urograndis one-year-old seedlings. (B) Positive symptoms shown after for 4 weeks of application. (i) Control, (ii,iii) NHATWU9:OQ581908, (iv,v) NHAPCH2:OQ581881, (vi,vii) NHAUMW1:OQ581910, and (viii,ix) NHASUL1:OQ581890. Arrow shows copies.
Figure 7. (A) Innoculation test from four isolates conducted on Eucalyptus urograndis one-year-old seedlings. (B) Positive symptoms shown after for 4 weeks of application. (i) Control, (ii,iii) NHATWU9:OQ581908, (iv,v) NHAPCH2:OQ581881, (vi,vii) NHAUMW1:OQ581910, and (viii,ix) NHASUL1:OQ581890. Arrow shows copies.
Forests 14 01660 g007
Forests 14 01660 g008
Figure 8. (A) Seedling after 4 weeks inoculation test with Chrysoporthe deuterocubensis (NHATWU9:OQ581908) (B) Conidiomata developed on seedling stem (C,D) Positive symptomatic shown development of conidiomata on inoculation site.
Figure 8. (A) Seedling after 4 weeks inoculation test with Chrysoporthe deuterocubensis (NHATWU9:OQ581908) (B) Conidiomata developed on seedling stem (C,D) Positive symptomatic shown development of conidiomata on inoculation site.
Forests 14 01660 g008
Forests 14 01660 g009
Figure 9. (A) Seedling of Neobalanocarpus heimii. (B) Coppices develop below inoculation area, after 4 weeks of inoculation with Chrysoporthe deuterocubensis (NHATWU9:OQ581908). (C) Conidiomata developed on stem showing positive symptoms.
Figure 9. (A) Seedling of Neobalanocarpus heimii. (B) Coppices develop below inoculation area, after 4 weeks of inoculation with Chrysoporthe deuterocubensis (NHATWU9:OQ581908). (C) Conidiomata developed on stem showing positive symptoms.
Forests 14 01660 g009
Forests 14 01660 g010
Figure 10. Pathogenicity on leaf under control condition of (A) Eucalyptus urophylla, (B) Eucalyptus camaldulensis, (C) Eucalyptus urograndis, (D) Eucalyptus. deglupta, (E) Eucalyptus grandis, (F) Eucalyptus pellita, (G) Syzygium aromaticum, (H) Nephelium lappaceum, (I) Melastoma marianum, (J) Durio zibenthinus, (K) Melastoma malabathricum, (L) Mangifera indica, (M) Aquilaria sinensis, (N) Dyera costulata, (O) Neobalanorpus heimii, and (P) Hopea odorata. Pictures show positive symptoms of leaves after days 7 inoculated by Chrysoporthe deuterocubensis, NHATWU9:OQ581908 (most virulent strain), for except N, O and P, for which no symptoms were recorded.
Figure 10. Pathogenicity on leaf under control condition of (A) Eucalyptus urophylla, (B) Eucalyptus camaldulensis, (C) Eucalyptus urograndis, (D) Eucalyptus. deglupta, (E) Eucalyptus grandis, (F) Eucalyptus pellita, (G) Syzygium aromaticum, (H) Nephelium lappaceum, (I) Melastoma marianum, (J) Durio zibenthinus, (K) Melastoma malabathricum, (L) Mangifera indica, (M) Aquilaria sinensis, (N) Dyera costulata, (O) Neobalanorpus heimii, and (P) Hopea odorata. Pictures show positive symptoms of leaves after days 7 inoculated by Chrysoporthe deuterocubensis, NHATWU9:OQ581908 (most virulent strain), for except N, O and P, for which no symptoms were recorded.
Forests 14 01660 g010
Table 1. Oligonucleotide sequences as primers used to amplify translation elongation factor 1-alpha, (tef1), ß-tubulin (tub2), and internal transcribed spacer (ITS) regions ITS1 and ITS4, and mating-type, pheromone, and pheromone receptor genes.
Table 1. Oligonucleotide sequences as primers used to amplify translation elongation factor 1-alpha, (tef1), ß-tubulin (tub2), and internal transcribed spacer (ITS) regions ITS1 and ITS4, and mating-type, pheromone, and pheromone receptor genes.
PrimerPrimer Sequence (5′-3′)Annealing Temp. (°C)Region AmplifiedAmplicon SizeReference
ITS1TCCGTAGGTGAACCTCGCG59.55.8S nrRNA~600[16]
ITS4TCCTCCGCTTATTGATATGC52.1
Bt2aFGGTAACCAAATCGGTGCTGCTTTC58.8Bt2a~400[18]
Bt2bRACCCTCAGTGTAGTGACCCTTGGC62.5Bt2b
EF1-728FCATCGAGAAGTTCGAGAAGG52.6EF1-728F300–400[17]
EF1-986RTACTTGAAGGAACCCTTACC51.3EF1-986R
acdmat111FCGGGTGTGGACGTTTATC53.2MAT1-1-1700–800[19]
acdmat111RCGGGTGTGGACGTTTATC53.6
acdmat112FTTGAAAGCAACMCTGACCGA55.9MAT1-1-2800–900[19]
acdmat112RGCCGTGGAGAATATGCAGAA55.1
mat113qFTTCATCATTGCACGTACCGA53.2MAT1-1-3400–700[19]
acdmat113RGTACTTTGCTTGGTGTTGAT53.6
acdmat121FAACCGTCTTCTTGTTGGTC52.6MAT1-2-1500–700[20]
acdmat121RGTGGTAGTCTTCTTGGAACG52.8
pre1Q1_LGCTCTTGAACATCCGTCTC53.1pre1~200[20]
pre1Q1_RTAGTCTCCTTGGTGGTGGT55.1
pre2Q1_LGACAATGACACCGAAGACC53.3pre2100–200[20]
pre2Q1_RCCAGGAGGAGTTGAAGTAGAC54.3[21]
cappg1Q1LCCGAGATCTCCAACATGCG55.8ppg1100–200[21]
cappg1Q1RCCGAACTTGGACAGGATGG55.6
ppg2Q1_LTCTTCCTCCTCATCCACGTC56.0ppg2~200[21]
ppg2Q1_RCTGCAGAGCTGCAAAGAGG56.4
Table 2. Pathogenicity test of 3-year-old seedling of Eucalyptus urograndis and Eucalyptus pellita.
Table 2. Pathogenicity test of 3-year-old seedling of Eucalyptus urograndis and Eucalyptus pellita.
No.IsolateNumber of Tested IsolatesOrigin of IsolateNumber of Tested Trees
Eucalyptus urograndisEucalyptus pellita
1Chrysoporthe cubensis20Pahang2020
2Chrysoporthe deuterocubensis20Kelantan2020
3Chrysoporthe deuterocubensis20Sabah2020
4Chrysoporthe deuterocubensis20Selangor2020
Table 3. Pathogenicity test of 1-year-old seedling of Eucalyptus urograndis.
Table 3. Pathogenicity test of 1-year-old seedling of Eucalyptus urograndis.
No.IsolateNumber of Tested IsolatesOrigin of IsolateNumber of Tested Trees
Eucalyptus urograndis
1Chrysoporthe cubensis2Pahang2
2Chrysoporthe deuterocubensis2Kelantan2
3Chrysoporthe deuterocubensis2Sabah2
4Chrysoporthe deuterocubensis2Selangor2
Table 4. Planting area of Eucalyptus spp.
Table 4. Planting area of Eucalyptus spp.
SpeciesPlanted (ha)Spacing
(m × m)		Planted
(year)		Number of Infected TreesPathogen
Eucalyptus urograndis
(Sabah)		13.633.0 × 3.0
(1111 stem/ha)		201552Chrysoporthe deuterocubensis
Eucalyptus urograndis
(Sabah)		23.983.0 × 3.0
(1111 stem/ha)		201358Chrysoporthe deuterocubensis
Eucalyptus urograndis
(Sabah)		11.373.0 × 3.0
(1111 stem/ha)		200854Chrysoporthe deuterocubensis
Eucalyptus
urograndis
(Kelantan)		10.383.0 × 3.0
(1111 stem/ha)		201836Chrysoporthe deuterocubensis
Eucalyptus urograndis
(Pahang)		47.203.0 × 3.0
(1111 stem/ha)		201645Chrysoporthe cubensis
Eucalyptus urograndis
(Selangor)		0.863.0 × 3.0
(1111 stem/ha)		201812Chrysoporthe deuterocubensis
Eucalyptus pellita
(Selangor)		1.923.0 × 3.0
(1111 stem/ha)		201843Chrysoporthe deuterocubensis
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Awing, N.H.; Ambrose, A.; Abdu, A.; Hassan, A.; Terhem, R. Characterisation of Chrysoporthe cubensis and Chrysoporthe deuterocubensis, the Stem Canker Diseases of Eucalyptus spp. in a Forest Plantation in Malaysia. Forests 2023, 14, 1660. https://doi.org/10.3390/f14081660

AMA Style

Awing NH, Ambrose A, Abdu A, Hassan A, Terhem R. Characterisation of Chrysoporthe cubensis and Chrysoporthe deuterocubensis, the Stem Canker Diseases of Eucalyptus spp. in a Forest Plantation in Malaysia. Forests. 2023; 14(8):1660. https://doi.org/10.3390/f14081660

Chicago/Turabian Style

Awing, Norida Hanim, Annya Ambrose, Arifin Abdu, Affendy Hassan, and Razak Terhem. 2023. "Characterisation of Chrysoporthe cubensis and Chrysoporthe deuterocubensis, the Stem Canker Diseases of Eucalyptus spp. in a Forest Plantation in Malaysia" Forests 14, no. 8: 1660. https://doi.org/10.3390/f14081660

APA Style

Awing, N. H., Ambrose, A., Abdu, A., Hassan, A., & Terhem, R. (2023). Characterisation of Chrysoporthe cubensis and Chrysoporthe deuterocubensis, the Stem Canker Diseases of Eucalyptus spp. in a Forest Plantation in Malaysia. Forests, 14(8), 1660. https://doi.org/10.3390/f14081660

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop