Next Article in Journal
Structural and Functional Characteristics of Soil Fungal Communities near Decomposing Moso Bamboo Stumps
Previous Article in Journal
Digital vs. Analog Learning—Two Content-Similar Interventions and Learning Outcomes
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Sex-Related Differences of Ginkgo biloba in Growth Traits and Wood Properties

1
State Key Laboratory of Tree Genetics and Breeding, Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, Nanjing 210037, China
2
Department of Forest and Conservation Sciences, University of British Columbia, Vancouver, BC V6T 1Z4, Canada
*
Author to whom correspondence should be addressed.
Forests 2023, 14(9), 1809; https://doi.org/10.3390/f14091809
Submission received: 3 August 2023 / Revised: 24 August 2023 / Accepted: 2 September 2023 / Published: 5 September 2023
(This article belongs to the Section Forest Ecophysiology and Biology)

Abstract

Ginkgo biloba is one of the most widely cultivated dioecious timber trees in China. Understanding sex-related differences and how they affect growth traits and wood properties is crucial for informed management and optimal utilization of ginkgoes. In the present study, we collected 42 ginkgo samples and conducted DNA molecular identification to determine their sex. The result was a 1:1 ratio of male to female specimens. In addition, we measured 16 growth-trait and wood-property indices for these samples using advanced equipment, such as X-ray diffraction (XRD) and the Hitman ST300 standing tree tool. For growth traits, significant differences were observed between male and female ginkgoes in terms of the diameter at breast height (DBH), clear bole height (CBH), height, and volume. Significant differences were identified in wood properties between male and female ginkgoes in terms of the degree of cellulose crystallinity (DCC), cell length, cell wall thickness, and wall-to-lumen ratio. Tracheids from female trees were found to be wider, with thicker cell walls, than those from male trees. Principal component analysis (PCA) showed that there was a slight separation between the sexes in terms of all growth traits, whereas there was no separation in wood properties. The membership function value (MFV) also showed that male ginkgo exhibited a more robust phenotype than female ginkgo. The selection of male ginkgo for breeding and utilization offers distinct advantages for practical production.

1. Introduction

Sexual differentiation in plants is an important mechanism for adaptation to the environment, self-adaptation, and competition with other species, which directly or indirectly results in various morphologies [1]. The most evident distinction is dioecy, which refers to the separation of male and female reproductive functions in different individuals, with male trees producing pollen and female trees producing seeds. Seed production requires a greater allocation of resources than pollen production. Therefore, sex-related strategies demonstrate varying patterns of resource acquisition and deployment [2]. Previous studies concluded that male trees in Populus tremula and Salix suchowensis have greater height, greater diameter, and higher shoot biomass than female trees [3,4]. In Populus tremula, male trees possessed a larger leaf area and demonstrated superior photosynthetic capabilities than female trees. However, a study on Juniperus thurifera [5] revealed that female trees can grow as quickly as male trees, or even faster. Sex determination in plants is typically genetically controlled. The use of DNA markers has proven to be an effective method for identifying the sex of dioecious plants during non-reproductive periods [6].
Moreover, sex-related strategies exhibit variable effects on relative secondary growth. For instance, in J. thurifera [7], female trees outperformed male trees under more favorable hydrological conditions, whereas male trees performed better than female trees under water-limited conditions. Similarly, in Populus angustifolia [8], male trees were more responsive to drought stress and stomatal closure than female trees.
Tree-breeding programs generally prioritize improvements in growth traits, whereas comparatively less emphasis is placed on improving wood density, fiber traits, and other wood properties [9]. However, it is important to note that wood properties directly affect the quality of the end products, and their significance should not be overlooked.
Wood basic density (BD) reflects the density of wood and is a crucial indicator for assessing its physical and mechanical properties [10], impacting its uses and the timber yield [11]. The modulus of elasticity(MOE) is a measure of the stiffness and anisotropy of wood and indicates its flexibility [12]. It is also an acoustic parameter [13] that plays a role in determining the wood’s usability. The microfibril angle (MFA) refers to the angle between the long axis of the fiber and the cellulose microfibrils as they wind around the cell, and this is one of the main determinants of stiffness in wood and shrinkage during drying [14]. The degree of cellulose crystallinity (DCC) represents the tensile strength of the fibers and is defined as the ratio of crystalline cellulose (g)/cellulose (100 g). This can be determined using techniques such as nuclear magnetic resonance (NMR) spectroscopy and X-ray diffraction (XRD) [15]. The wood or secondary xylem of conifers is primarily composed of longitudinal (axial) tracheids, radially oriented ray tracheids, and ray parenchyma cells [16]. Tracheids play a significant role in providing mechanical support to the stem, and their morphology is density-related [17]. Lignin polymerizes around the framework of cellulose and hemicellulose to form the cell walls of tracheids in trees, to make wood [17,18]. The lignin, cellulose, and hemicellulose contents are crucial in determining the static and dynamic viscoelasticities of wood cell walls [19].
Ginkgo biloba L. is one of the most widely cultivated tree species in China and is valued for its unique ecological and economic benefits. It serves various purposes, including edibility, medicinal use, timber production, and ornamentation [6]. As a typical gymnosperm, ginkgo exhibits dioecious characteristics [20]. However, few studies have simultaneously analyzed growth traits and wood properties to explore sex-related differences in G. biloba. Therefore, with a specific focus on the cultivating of ginkgo trees for timber production, our objective was to gain insights into sex-related differences and their impact on both growth traits and wood properties. After conducting thorough research and analysis, and by selectively focusing on male ginkgoes in wood production, we could anticipate accelerated tree growth, resulting in a shorter harvest cycle and increased productivity. This enabled us to optimize processes such as timber harvesting, resource allocation, and yield estimation. While female ginkgoes may not exhibit the same growth advantages and wood properties as male trees in production settings, they still hold value in terms of reproduction, aesthetics, ecology, and potential uses in traditional medicine and cuisine for fruits. It was important to acknowledge and appreciate the diverse functions and benefits that both male and female ginkgoes offer within their respective contexts. Through this research, we aimed to establish a foundation for informed management and optimal utilization of ginkgo trees.

2. Materials and Methods

2.1. Study Site and Plant Material

The ginkgo plantation is situated at the Xiashu Forestry Farm of Nanjing Forestry University (119.218001° E, 32.120048° N). This area belongs to the north subtropical monsoon climate zone with an annual mean temperature of 15.2 °C, and the soil is mainly yellow-brown loam.
A total of 42 ginkgo samples with a mean age of 25 years were selected from the ginkgo plantation, which was planted in 2001 with a planting space of 2 × 2.5 m. We also recorded latitude, longitude, and altitude using GPS (Garmin Etrex20, Salem, MA, USA) and numbered each individual.

2.2. Sex Identification of Ginkgo

When identifying the sex of ginkgoes in the field, it is common knowledge that fruiting ginkgo must be female, but non-fruiting ginkgo is not necessarily male. Therefore, leaf samples must be harvested to determine the sex using molecular-marker testing. One to three leaves from each sampling tree were collected in April 2022, preserved in liquid nitrogen, brought back to the laboratory, and stored at −80 °C.
DNA was extracted from ginkgo leaves using a HiPure SF Plant DNA Mini Kit (Magen, Guangzhou, China). The DNA concentration was determined using a NanoDrop® 2000 spectrophotometer (Thermo, Waltham, MA, USA). GbMADS18 [21] was previously found to be a male-specific-expressed gene in ginkgo, and the primers could precisely and robustly amplify a 1030-bp fragment in male leaf samples. The primers (F: TATAATTGGGGATGAGCTTTA; R: GGGGTGCAAGACAATTTT) were synthesized in Tsingke (Beijing, China). PCR reaction was performed using 2 × Phanta Flash Master Mix (Dye Plus) (Vazyme #P520, Nanjing, China) with a T100 Thermal Cycler (Bio-rad, Hercules, USA). The amplification was conducted with the following program: initial denaturation at 98 °C for 30 s; 35 cycles of denaturation at 98 °C for 10 s, annealing at 57 °C for 5 s, and polymerization at 72 °C for 5 s; and a final elongation step at 72 °C for 1 min. The amplified fragments were visualized using a JS-3000 fully automatic gel imaging system (Peiqing, Shanghai, China).

2.3. Growth Traits

Growth traits were measured in November 2021, when the ginkgoes had finished shedding leaves, and the growth status was clear. The diameter at breast height was measured using a diameter tape with an accuracy of 1 mm, and the height was measured with a Blume–Leiss hypsometer with an accuracy of 0.1 m. The clear bole height and mean crown width were measured using a metric tape with an accuracy of 1 mm, and the mean crown width was the mean length of the crown projection in two directions: east–west and north–south.
The formula for calculating the standing tree volume of individual ginkgoes [22] was as follows:
lnV = 2.0135 lnd + 0.5685 lnH 9.2452   ( R 2 = 0.9819 )
V : tree volume, m3; d : diameter at breast height, cm; H : height, m.

2.4. Wood Sampling and Wood Property Determination

Wood sampling was performed in November, 2021. At 1.3 m on the tree, a growth awl was horizontally spun (5 mm) into the trunk center in the east–west direction, to obtain wood core samples of the pith, for subsequent determination of wood properties. The wound was properly treated with tree wound dressing. The wood core samples were put into an oven, kept at 60 °C for 5 h, then raised to 103 ± 2 °C until a constant weight, dried at a constant temperature for 3 days, and stored in a dry place at room temperature.

2.4.1. Wood Basic Density

Wood core segments approximately 2 cm in length from the 2nd to 7th annual rings were used to determine the wood basic density [23]. Fully dry samples were weighed on an analytical balance (accuracy of 0.0001 g), and the weight was recorded. The samples were then soaked in deionized water until saturation, and the lengths and the diameters of the water-saturated samples were measured. Wood basic density was calculated using the following formula:
D B = 4 · m π · d 2 · l
D B : the wood basic density, g/cm3; m : the weight of the fully dry sample, g; d : the diameter of the water-saturated sample, cm; l : the length of the water-saturated sample, cm.

2.4.2. Modulus of Elasticity

Following the official user guide [24], the modulus of elasticity was measured using a Hitman ST300 standing tree tool (Fibregen, Christchurch, New Zealand). The formula relating the modulus of elasticity to the acoustic velocity [25] is as follows:
M E = D B · V S W 2 / 1000
M E : the modulus of elasticity, GPa; D B : the wood basic density, kg·m−3; V S W : the acoustic velocity in the trunk of a standing tree, m·s−1.

2.4.3. Microfibril Angle

The method of XRD was used to determine microfibril angles with a multipurpose X-ray diffractometer (Ultima IV, Rigaku, Tokyo, Japan). Wood slices of approximately 1 mm thickness were cut off smoothly from the 8th annual ring of the wood cores and used as XRD samples. The instrument parameters were as follows: tube voltage, 40 kV; tube current, 30 mA; scanning range, 90°–270°; scanning speed, 72°/min; and scanning step, 0.36°. Subsequently, the diffraction curves were fitted with GaussAmp bimodal functions using Origin software (2021) and the microfibril angle was calculated using the well-established 0.6 T method [26].

2.4.4. Degree of Cellulose Crystallinity

The wood core segments from the 10th to 15th annual rings were ground into powder and sieved through a 100 mesh, and 50 mg powder was used as the XRD sample. The instrument parameters were set as follows: tube voltage, 40 kV; tube current, 30 mA; scanning range, 5°–40°; and scanning speed, 5°/min. The diffraction curves were analyzed in Origin 2021 software via θ–2θ scheme [27] for the degree of cellulose crystallinity.

2.4.5. Tracheid Morphology

Wood core segments from the 16th to 20th annual rings were used as test samples. Tracheids were separated from wood core segments using a modified G. L. Franklin maceration method [28]. We used a 95% acetic acid and 30% hydrogen peroxide mixture (1:1) to macerate the test samples in a 70 °C water bath for about 7 h, until the samples were in a white fluffy state. After gently washing the residual reagent on the surface of the samples 5 times with deionized water, the samples were rocked in evenly floccule and stained for 5 min by adding a drop of 1% safranine solution. Temporary slides were made, to observe tracheids using a DM7500 binocular microscope (Leica, Wetzlar, German) with an ICC50W camera (Leica, German).
Sixty complete tracheids from each sample were randomly selected, and the cell length, cell width, and cell lumen width were measured using Leica Application Suite EZ software (Version 3.4). The cell wall thickness and wall-to-lumen ratio were calculated using the following formulae:
L W T = ( L C W L L W ) / 2
R W L = L W T / L L W
L W T : the cell wall thickness, μm; L C W : the cell width, μm; L L W : the cell lumen width, μm; R W L : the wall-to-lumen ratio.

2.4.6. Lignin, Cellulose, and Hemicellulose Contents

Lignin, cellulose, and hemicellulose contents were determined using lignin content test kit (Solarbio BC4200, Beijing, China), cellulose content test kit (QIYBO QYS-235029, Shanghai, China), and hemicellulose content test kit (QIYBO QYS-235038, Shanghai, China), respectively. Three replicates were performed for each indicator in each sample.

2.5. Statistical Analysis and Graphing

Descriptive statistics for each index, Student’s t-test, correlation analysis, principal component analysis (PCA), and the membership function value (MFV) method [29] were performed in the R environment. The R packages used for graphing were ggplot2 [30], ggpubr [31], geneRal, Hmisc [32], corrplot [33], factoextra [34], and leaflet [35].

3. Results

3.1. Sex Identification of the Sampling Trees

The distribution of sampled ginkgo trees is shown in Figure 1. The sampled trees were distributed at an altitude of 91–103 m (Figure 1, Table S1) and located on gentle slopes. The numbers shown in Figure 1 were used in the subsequent experiments.
In this experiment, DNA molecular markers were used for ginkgo sex identification, and the gel electrophoresis pattern is shown in Figure 2. Sampled ginkgo trees 1−4, 6−8, 11, 12, 16−18, 20−23, 27, 28, 36, 41, and 42 were male trees, evidenced by electrophoretic bands of approximately 1000 bp, matching the fact that the primers specifically amplified a 1030 bp fragment in male leaf samples. The remaining 21 samples were obtained from female trees; therefore, no electrophoretic bands were observed. Furthermore, we double-checked the accuracy of the DNA molecular identification by verifying the observed fruit-bearing ginkgoes in the field, and the absence of a band also confirmed their female identity. Finally, there were 21 samples from male trees and 21 samples from female trees, with a sex ratio of 1:1.

3.2. Differences in Growth Traits between Male and Female Ginkgoes

The experimental data used for the subsequent analyses are listed in Table S1. The differences in growth traits between male and female ginkgoes are shown in Figure 3. In general, significant differences in DBH, CBH, height, and volume were found between male and female ginkgoes, with male ginkgoes showing stronger growth than females.
As for the MCW, the mean values of female and male ginkgoes were 4.07 m and 4.95 m, respectively (Table S1). Although male ginkgoes had a higher value than female ginkgoes, there was no significant difference (p > 0.05) between female and male ginkgoes using Student’s t-test (Figure 3). The density distribution is represented using a violin plot (Figure 3). The distribution curves of female ginkgoes exhibited a bimodal distribution, whereas those of male trees showed a left-skewed distribution, indicating a few female individuals around the mean value, and male individuals with smaller MCW accounted for the majority. Moreover, there was an outlier male in the top MCW.
As for the DBH, the mean values of female and male ginkgoes were 16.67 cm and 20.83 cm (Table S1), and there was a significant difference (p < 0.05) between female and male ginkgoes (Figure 3). The distribution curves of both female and male ginkgoes exhibited a mildly bimodal distribution, conforming to the general distribution pattern, in which the majority was distributed around the mean value.
As for the CBH, the mean values of female and male ginkgoes were 150.34 cm and 177.74 cm (Table S1), and there was a significant difference (p < 0.05) between female and male ginkgoes (Figure 3). The distribution curves of both female and male ginkgoes exhibited a mildly bimodal distribution. Moreover, the median value was higher than the mean value for male trees, implying that male individuals with larger CBH accounted for the majority.
As for the height, the mean values of female and male ginkgoes were 8.95 m and 10.67 m (Table S1), and there was an extremely significant difference (p < 0.01) between female and male ginkgoes (Figure 3). In general, height and DBH showed strong correlations [36]. In the present study, the height distribution curves demonstrated a pattern similar to that of DBH. The distribution curves of female ginkgoes exhibited a bimodal distribution, whereas those of male trees showed a near-normal distribution. The median value was higher than the mean value in female ginkgoes, implying that female individuals with larger heights comprised the majority.
Volume was calculated based on DBH and height. The mean values of female and male ginkgoes were 0.106881 m3 and 0.186666 m3 (Table S1), and there was an extremely significant difference (p < 0.01) between female and male ginkgoes (Figure 3). The distribution curves of both female and male ginkgoes exhibited a mild bimodal distribution. There were individuals in both female and male ginkgoes that exceeded the upper whisker limit, suggesting the existence of individuals with significantly higher volumes than the others.

3.3. Differences in Wood Properties between Male and Female Ginkgoes

The wood core samples of the pith (Figure 4a) were used to determine the subsequent wood properties, except for EM, which was determined in standing trees. Differences in wood properties between male and female ginkgoes are shown in Figure 4 and Figure 5c. In general, significance differences in DCC, cell length, cell wall thickness, and wall-to-lumen ratio were found between male and female ginkgoes.
There were no significant differences (p > 0.05) between female and male ginkgoes regarding BD, EM, and MFA using Student’s t-test (Figure 4b). Other than the distribution of female ginkgoes in BD, which showed a near-normal distribution, the distribution curves of the others exhibited a bimodal distribution. The median value was higher than the mean value of female ginkgoes in the BD and EM, and male ginkgoes in the EM and MFA and did not conform to the distribution pattern. The male ginkgo outliers in the BD and EM also indicated the same points.
As for DCC, the mean values of female and male ginkgo were 43.08% and 48.99% (Table S1), respectively, and there was a significant difference (p < 0.05) between female and male ginkgoes (Figure 4b), indicating that the tensile strength of wood fibers in male ginkgoes was higher than that in female trees. The distribution curves showed a similar pattern, with outliers in both sexes, conforming to the distribution pattern.
There were no significant differences (p > 0.05) in lignin, cellulose, and hemicellulose content between female and male ginkgoes using Student’s t-test (Figure 4b). The data were distributed uniformly over the full distribution range, and the three contents were relatively random within the ginkgo individuals.
The wood core was dissociated and stained with safranine under an optical microscope (Figure 5a,b). Under a 40× microscope, the tracheid appeared spindle-shaped, with slender ends and a swollen middle (Figure 5a). There were several grooves in the cell wall of the tracheid where the adjacent tracheids overlapped (Figure 5a). Under a 400× microscope, a remarkably thick cell wall was detected, providing the mechanical support.
As 60 tracheids were measured in each sample and we had 21 female and 21 male sample ginkgoes, each index of 1260 tracheids of each sex was visualized using raincloud plots (Figure 5c). Overall, the distributions of the four tracheid indices were consistent with the general distribution pattern; that is, the majority were distributed around the mean value. As for the cell length and width, there was an extremely significant difference (p < 0.01) between female and male ginkgoes. Additionally, the cell lengths of male tracheids were longer than those of females, whereas those of female tracheids were wider than those of males. This indicated a difference in the shape of the tracheids between the sexes, with male tracheids being longer and thinner and female tracheids being shorter and thicker. There was extremely significant difference (p < 0.01) in cell wall thickness, and the distribution curves of both female and male ginkgoes exhibited a near-normal distribution. However, there was no significant difference (p > 0.05) in wall-to-lumen ratio between the female and male ginkgoes. Although the female tracheids were wider and had thicker cell walls, the wall-to-lumen ratio did not differ significantly from that of males.

3.4. Correlation Analysis of Growth Traits and Wood Properties

Pearson’s correlation analysis was performed on the relationship between the growth traits and wood properties, and the results are shown in Figure 6. We found that the correlation coefficient absolute values of the significant correlation pairs were all greater than 0.30 (p ≤ 0.05, |r| ≥ 0.30).
Strong positive correlations (r ≥ 0.60, p ≤ 0.01) were observed between all pairs of growth traits (Figure 6a), which were volume, DBH, MCW, height, and CBH. Subsequently, these traits were clustered in the same clade (Figure 6b), wherein volume and DBH exhibited the closest relationship among all indices (r = 0.97, p ≤ 0.01). Interestingly, cell length was significantly correlated with eight indices. Except for a significant negative correlation with the MAF and wall-to-lumen ratio, it was significantly positively correlated with six other indices, including four growth traits. This indicated that ginkgoes with favorable growth traits tended to have relatively longer tracheid cell lengths. Furthermore, we found that wood properties, such as EM, wall-to-lumen ratio, and cell width exhibited significant positive correlations with growth traits, albeit with a weak correlation coefficient (r < 0.40). We also observed a strong negative correlation between the cell width and wall-to-lumen ratio. Our results suggest that by knowing either the cell width or the wall-to-lumen ratio, we can infer the other index. Additionally, we found a significant negative correlation (r = −0.33) between the lignin and cellulose contents of ginkgo wood, suggesting that ginkgo wood with a high cellulose content may have a decreased lignin content.

3.5. Comprehensive Assessment of Sex-Related Differences on Ginkgoes

To gain a more detailed understanding of the sex-related differences, we performed a PCA to further investigate the growth traits and wood properties of the female and male ginkgoes (Figure 7). Regarding growth traits, PC1 and PC2 explained 98.9% and 1.0% of the variation among the sampled ginkgoes, respectively. Thus, PC1 and PC2 contained most of the information on all growth traits and were representative of the sampled ginkgoes’ variation (Figure 7a). Our analysis of growth traits demonstrated a small degree of clustering, with a slight separation between the sexes (Figure 7a). There was also a large overlap between the two sexes, indicating differences in growth traits between female and male ginkgoes, although they did exhibit some similarities. Moreover, as for wood properties, PC1 and PC2 explained 99.1% and 0.5% of the variation among the sampled ginkgoes (Figure 7b). Our analysis of wood properties demonstrated no significant clustering or separation between the sexes (Figure 7b). The overlap between the two sexes was very large, indicating no difference in wood properties between the female and male ginkgoes. Furthermore, as for all the indices, PC1 and PC2 explained 97.9% and 1.2% of the variation among the sampled ginkgoes (Figure 7c), respectively. Our analysis of all the indices demonstrated a large degree of clustering between the sexes, with a relatively large separation between female and male ginkgoes and a relatively small amount of overlap (Figure 7c).
We utilized the MFV method to comprehensively evaluate individuals, thus enabling a direct comparison between female and male ginkgoes. The ranks were sorted based on the average MFV. We observed that four out of the top five ginkgoes (sample 41, 42, 6, and 2) were males, while four out of the last five ginkgoes (sample 33, 35, 15, and 29) were females (Table 1). The evaluation parameters of the analysis are highlighted by the Mean MFV and Total MFV. The mean MFV of females was 0.400964351, whereas that of males was slightly higher at 0.477968992. The total MFV of females was 8.420251382, whereas males scored higher with a total MFV of 10.037348853. These scores indicate that females performed worse than males, as male ginkgoes outperformed their female counterparts on the tested indices.

4. Discussion

4.1. Sex-Related Differences in Growth Traits

Previous studies have suggested that dioecious male plants have a higher inherent growth rate than dioecious female plants [3,37,38]. As expected, the results of this study showed that male ginkgoes had better growth traits (taller, higher DBH, CBH, and volume) than female ginkgoes. This disparity in growth could be attributed to the fact that female trees of woody dioecious plants usually proportionally expend more of their resources on reproduction and less on maintenance and growth than males [39], which necessitates heightened nutrient consumption and incurs a relatively higher reproductive cost. Consequently, these factors contributed to reduced growth traits in the female population. Moreover, when neighboring individuals are more robust in terms of size, this signifies a heightened intensity of competition and a more vigorous process of self-thinning, resulting in higher CBH [40]. Consistent with previous research, the present study also revealed that male individuals displayed greater growth and higher CBH than their female counterparts. The significant differences in growth traits between male and female ginkgoes can have implications for the overall health and development of the trees. Since certain growth traits may vary between sexes, it is important to consider these differences when assessing the trees’ health and development. For example, if there are significant differences in growth rates or patterns, this may indicate varying nutrient requirements or susceptibilities to certain diseases or environmental factors. Consequently, the fieldwork workload could be appropriately reduced. Understanding these differences can help guide appropriate management practices and promote the optimal growth and health of both male and female ginkgo trees. Thus, sex has a non-negligible effect on the growth of ginkgo trees, highlighting the need for further investigation into the specific mechanisms underlying sexual differentiation.
In addition, the sampled ginkgoes were located on gentle slopes facing east and west. The western side was positioned at a lower elevation, potentially resulting in poor light conditions for the sampled ginkgoes [41]. For instance, the MFV ranks (Table 1) of sampled ginkgoes 21, 22, 30, 31, 32, and 33 (Figure 1) were below the average. Given the constraints of destructive sampling and the limited availability of ginkgo plantations for selection, excluding the influence of slopes in the present study was not feasible. Therefore, selecting more level forest areas, where possible, is advisable for similar future studies.

4.2. Sex-Related Differences in Wood Properties

To our knowledge, little is known about sex-related differences in wood properties, and this study is the first to compare the wood properties of female and male G. biloba. We employed advanced techniques, including using DNA markers for sex identification, the Hitman ST300 standing tree tool for MOE, and XRD for MFA and DCC. Moreover, our study was largely based on the same range of annual rings, which ensured that each index was compared within the same year range.
Based on the results of the PCC analysis (Figure 7b), it was evident that there were no significant overall differences in wood properties between sexes. In general, this was also supported by the determined indices, as only DCC and tracheid morphology showed significant sex-related differences (p < 0.05). The differences between male and female ginkgoes in BD and cellulose, hemicellulose, and lignin contents were insignificant (p > 0.05), which is consistent with the results in Salix suchowensis [4]. Nevertheless, in Cannabis sativa [42], the cellulose and lignin contents in females were higher than that in males, and the hemicellulose content was lower than that in males, suggesting that the sex-related differentiation in wood properties varied across species. However, in the present study, we found a significant difference (p < 0.05) in the degree of cellulose crystallinity between females and males, indicating that the tensile properties of male fibers were stronger than those of females. To the best of our knowledge, no previous studies have examined this particular index in relation to sex differentiation, as this was the first time that DCC had been compared between sexes in ginkgo trees; therefore, this may serve as a valuable index for identifying the sex of ginkgo trees. Further research should be conducted to investigate the differences in the tensile properties of G. biloba between the sexes.
G. biloba is a typical gymnosperm, and its wood is mainly composed of tracheids [43]. In the present study, the cell length, cell width, and cell wall thickness of the tracheids were measured, and the wall-to-lumen ratio was calculated. The cell width and cell wall thickness of female ginkgo plants were significantly higher than those of males, whereas the cell length was significantly lower, indicating sex-related differences in tracheid morphology. Rodney found that hormones lead to tracheid differentiation in Pinus contorta [44]; thus, the possibility that hormone-induced tracheid differentiation also plays a role in G. biloba requires further exploration.
Interestingly, there was no significant difference in the wall-to-lumen ratio between the female and male ginkgoes. This indicates that the increase in cell width and wall thickness in females was proportional to the increase in lumen size, resulting in wall-to-lumen ratios similar to those observed in males. The wall-to-lumen ratio is known to correlate with hydraulic efficiency and wood density [45]. The fact that the wall-to-lumen ratio did not differ significantly between males and females in the present study suggests that both sexes have similar transport and support capabilities. This finding also suggests that the fundamental principles of tracheid function are conserved across sexes, despite differences in size and shape, which is consistent with findings in Podocarpus macrophyllus, P. annamiensis, and Fraxinus pennsylvanica [46,47]. Furthermore, there was a trade-off between cell length and cell width in ginkgo, as male tracheids were longer and thinner, whereas female tracheids were shorter and thicker.

4.3. Correlation of Growth Traits and Wood Properties

In the present study, the growth traits and wood properties of G. biloba were measured and analyzed, to shed light on the significance of sex-related differences in ginkgo. Previous studies confirmed that wood properties negatively correlate with growth traits [9,29,48]. A key finding of this study was that only a few growth traits significantly interacted with some of the wood properties considered, although a very weak correlation coefficient (|r| < 0.60) was observed. Wood properties such as MOE and wall-to-lumen ratio were negatively correlated with growth traits, whereas cell length and cell width were positively correlated with growth traits. Similarly, in Catalpa bungei and Pinus radiata, MOE and DBH were strongly negatively correlated [29,36]. These results implied that, as the growth traits increased, the MOE and wall-to-lumen ratio tended to weaken, whereas higher growth traits resulted in longer and thinner tracheids.
Interestingly, both the MOE and wall-to-lumen ratio correlated with BD, whereas BD did not significantly correlate with any growth traits. As previously reported in Douglas fir [11,49] and other coniferous species [50], the BD reduced growth traits, such as DBH, suggesting that the relationship between BD and growth traits depends on the species. The results clearly showed a strong negative relationship between the cell width and wall-to-lumen ratio, as the wall-to-lumen ratio was calculated based on the cell width and cell lumen width. Although cell width and length are commonly believed to be regulated by separate molecular mechanisms, previous research suggests a certain level of interconnection between them [51,52]. This study aligns with earlier studies that observed a positive correlation between the cell width and cell length. Hence, it appears that the cell width and length are governed by a higher-level process that integrates these two aspects of cell shape. Thus, it was unsurprising that the wall-to-lumen ratio negatively correlated with the cell length. Furthermore, our observations revealed a positive correlation between DCC and cell length. This aligns with the results of a previous study [53], which suggested that during the initial stages of secondary wall formation, increasing stress may cause higher crystallinity. Consequently, it can be inferred that as the cell length increases, the degree of cellulose crystallinity also tends to increase, providing further support for the findings of this study. In addition, the inverse relationship between the MAF and cell length was confirmed in the present study and in a previous study [14].
In the case of cell wall polymers, given the lack of correlation between hemicellulose content and any of the indices observed here, it was likely that there was no causal link with hemicellulose content, but there was a negative correlation between hemicellulose and lignin content in bamboo [54]. Further research is necessary to understand the reasons for the absence of a correlation between hemicellulose content and other cell wall polymers. Moreover, a negative correlation was found between cellulose and lignin contents, and similar observations have been reported for maize [55] and transgenic aspen [56]. These studies, along with the results presented here, collectively provide a sound theoretical basis for the interdependence of different cell wall polymers.
However, there were limitations in terms of the number of indices tested and the lack of strong correlations among them. Future studies should consider incorporating a broader range of indices, to enhance the analysis and conduct a more thorough and comprehensive investigation into the relationship between the sexes in ginkgo.

5. Conclusions

In summary, we collected 42 ginkgo samples and conducted molecular identification to determine their sex, which resulted in an equal ratio of male to female specimens (1:1). In addition, we measured 16 growth-trait and wood-property indices in these samples.
Regarding growth traits, there were significant differences in DBH, CBH, height and volume between male and female ginkgoes. Specifically, male ginkgoes exhibited more robust growth than their female counterparts. Regarding wood properties, significant differences were identified between male and female ginkgoes in terms of DCC, cell length, cell wall thickness, and wall-to-lumen ratio. Female tracheids were found to be wider with thicker cell walls than those of male tracheids. However, no significant differences were observed between the sexes in BD, MOE, MFA, lignin content, cellulose content, or hemicellulose content.
Based on the correlation analysis of each index, it was evident that strong positive correlations (r ≥ 0.60, p ≤ 0.01) were observed among all pairs of growth traits, namely volume, DBH, MCW, height, and CBH. Wood properties such as MOE, wall-to-lumen ratio, and cell width exhibited weak positive correlations with growth traits, whereas cell width and wall-to-lumen ratio, lignin content, and cellulose content showed a strongly negative correlation. Cell length showed significant correlations with eight indices, having a negative correlation with MAF and wall-to-lumen ratio, but a positive correlation with six other indices: cell width, height, MCW, DBH, volume, and DCC.
The PCA indicated a slight separation between the sexes in terms of growth traits. However, no significant clustering was observed for the wood properties. Based on the MFV, it was evident that the male ginkgoes outperformed their female counterparts on the tested indices, and the top two individuals were no. 41 and 42. In conclusion, selecting male ginkgoes for processing and utilization offers distinct advantages for practical production.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/f14091809/s1, Table S1: Experiment data.

Author Contributions

Conceptualization, F.F. and G.W.; methodology, J.L., X.S., J.G., W.X. and L.F.; writing—original draft preparation, J.L.; writing—review and editing, T.W.; visualization, J.L.; project administration, F.F.; funding acquisition, F.F. and G.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Jiangsu Provincial Key Research and Development Program (modern agriculture) (Grant No. BE2022373) and Natural Science Foundation of Jiangsu Province (Grant No. BK20200770).

Data Availability Statement

The data presented in the present study are available on request from the corresponding author.

Acknowledgments

We sincerely thank the driver Zhizhong Jiang (Nanjing Forestry University) for assistance in safely chauffeuring us to Xiashu Forestry Farm during the challenging times of the epidemic.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

BDWood Basic Density
CBHClear Bole Height
DBHDiameter at Breast Height
DCCDegree of Cellulose Crystallinity
MCWMean Crown Width
MFAMicrofibril Angle
MFVMembership Function Value
MOEModulus of Elasticity
NMRNuclear Magnetic Resonance Spectroscopy
PCAPrincipal component analysis
XRDX-ray Diffraction

References

  1. Durand, R.; Durand, B. Sexual Differentiation in Higher Plants. Physiol. Plant. 1984, 60, 267–274. [Google Scholar] [CrossRef] [Scilit]
  2. Tonnabel, J.; David, P.; Pannell, J.R. Sex-Specific Strategies of Resource Allocation in Response to Competition for Light in a Dioecious Plant. Oecologia 2017, 185, 675–686. [Google Scholar] [CrossRef] [Scilit]
  3. Randriamanana, T.R.; Nybakken, L.; Lavola, A.; Aphalo, P.J.; Nissinen, K.; Julkunen-Tiitto, R. Sex-Related Differences in Growth and Carbon Allocation to Defence in Populus tremula as Explained by Current Plant Defence Theories. Tree Physiol. 2014, 34, 471–487. [Google Scholar] [CrossRef] [Scilit]
  4. Hou, J.; Guo, Z.; Liu, H.; Yin, T. Gender Effects on Salix suchowensis Cheng Ex Zhu. Growth and Wood Properties as Revealed by a Full-Sib Pedigree. Can. J. Plant Sci. 2017, 97, 594–600. [Google Scholar] [CrossRef] [Scilit]
  5. Gauquelin, T.; Bertaudière-Montès, A.; Badri, W.; Montès, N. Sex Ratio and Sexual Dimorphism in Mountain Dioecious Thuriferous Juniper (Juniperus thurifera L., Cupressaceae). Bot. J. Linn. Soc. 2002, 138, 237–244. [Google Scholar] [CrossRef] [Scilit]
  6. Liao, L.; Liu, J.; Dai, Y.; Li, Q.; Xie, M.; Chen, Q.; Yin, H.; Qiu, G.; Liu, X. Development and Application of SCAR Markers for Sex Identification in the Dioecious Species Ginkgo biloba L. Euphytica 2009, 169, 49–55. [Google Scholar] [CrossRef] [Scilit]
  7. Olano, J.M.; García-Cervigón, A.I.; Arzac, A.; Rozas, V. Intra-Annual Wood Density Fluctuations and Tree-Ring Width Patterns Are Sex- and Site-Dependent in the Dioecious Conifer Juniperus thurifera L. Trees 2015, 29, 1341–1353. [Google Scholar] [CrossRef] [Scilit]
  8. Rood, S.B.; Ball, D.J.; Gill, K.M.; Kaluthota, S.; Letts, M.G.; Pearce, D.W. Hydrologic Linkages between a Climate Oscillation, River Flows, Growth, and Wood Δ13C of Male and Female Cottonwood Trees. Plant Cell Environ. 2013, 36, 984–993. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Wu, S.; Xu, J.; Li, G.; Risto, V.; Du, Z.; Lu, Z.; Li, B.; Wang, W. Genotypic Variation in Wood Properties and Growth Traits of Eucalyptus Hybrid Clones in Southern China. New For. 2011, 42, 35–50. [Google Scholar] [CrossRef] [Scilit]
  10. Santos, A.J.A.; Alves, A.M.M.; Simões, R.M.S.; Pereira, H.; Rodrigues, J.; Schwanninger, M. Estimation of Wood Basic Density of Acacia Melanoxylon (R. Br.) by near Infrared Spectroscopy. J. Near Infrared Spectrosc. 2012, 20, 267–274. [Google Scholar] [CrossRef] [Scilit]
  11. Johnson, G.R.; Gartner, B.L. Genetic Variation in Basic Density and Modulus of Elasticity of Coastal Douglas-Fir. Tree Genet. Genomes 2006, 3, 25–33. [Google Scholar] [CrossRef] [Scilit]
  12. Tsuchida, W.; Yamakoshi, Y.; Matsuo, S.; Asakawa, M.; Sugahara, K.; Fukaya, T.; Yamanaka, E.; Asai, Y.; Nitta, N.; Ooie, T.; et al. Application of the Novel Estimation Method by Shear Wave Elastography Using Vibrator to Human Skeletal Muscle. Sci. Rep. 2020, 10, 22248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Mania, P.; Gąsiorek, M. Acoustic Properties of Resonant Spruce Wood Modified Using Oil-Heat Treatment (OHT). Materials 2020, 13, 1962. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Barnett, J.R.; Bonham, V.A. Cellulose Microfibril Angle in the Cell Wall of Wood Fibres. Biol. Rev. 2004, 79, 461–472. [Google Scholar] [CrossRef] [Scilit]
  15. Thygesen, A.; Oddershede, J.; Lilholt, H.; Thomsen, A.B.; Ståhl, K. On the Determination of Crystallinity and Cellulose Content in Plant Fibres. Cellulose 2005, 12, 563–576. [Google Scholar] [CrossRef] [Scilit]
  16. Brändström, J. Morphology of Norway Spruce Tracheids with Emphasis on Cell Wall Organisation. Ph.D. Thesis, Swedish University of Agricultural Sciences, Uppsala, Sweden, 2002. [Google Scholar]
  17. Jones, P.D.; Schimleck, L.R.; Peter, G.F.; Daniels, R.F.; Clark, A. Non-Destructive Estimation of Pinus taeda L Tracheid Morphological Characteristics for Samples from a Wide Range of Sites in Georgia. Wood Sci. Technol. 2005, 39, 529. [Google Scholar] [CrossRef] [Scilit]
  18. Wang, J.P.; Matthews, M.L.; Williams, C.M.; Shi, R.; Yang, C.; Tunlaya-Anukit, S.; Chen, H.-C.; Li, Q.; Liu, J.; Lin, C.-Y.; et al. Improving Wood Properties for Wood Utilization through Multi-Omics Integration in Lignin Biosynthesis. Nat. Commun. 2018, 9, 1579. [Google Scholar] [CrossRef] [Scilit]
  19. Cai, S.; Huang, Y.; Li, Z. Effect of Wood Chemical Composition on Longitudinal Viscoelastic Properties of Cell Walls. For. Eng. 2022, 38, 54–62. [Google Scholar] [CrossRef]
  20. He, M.; Shi, D.; Wei, X.; Hu, Y.; Wang, T.; Xie, Y. Gender-Related Differences in Adaptability to Drought Stress in the Dioecious Tree Ginkgo biloba. Acta Physiol. Plant 2016, 38, 124. [Google Scholar] [CrossRef] [Scilit]
  21. Liao, Q.; Du, R.; Gou, J.; Guo, L.; Shen, H.; Liu, H.; Nguyen, J.K.; Ming, R.; Yin, T.; Huang, S.; et al. The Genomic Architecture of the Sex-Determining Region and Sex-Related Metabolic Variation in Ginkgo biloba. Plant J. 2020, 104, 1399–1409. [Google Scholar] [CrossRef] [Scilit]
  22. Guo, J. Effects of Fertilization on Growth and Physiological Characteristics of Ginkgo biloba. Master’s Thesis, Nanjing Forestry University, Nanjing, China, 2016. [Google Scholar]
  23. ISO 13061-2:2014, Physical and Mechanical Properties of Wood—Test Methods for Small Clear Wood Specimens—Part 2: Determination of Density for Physical and Mechanical Tests. 2014. Available online: https://www.iso.org/standard/60064.html (accessed on 31 May 2023).
  24. User Videos|See Our Tools in Action|Fibre-Gen Ltd. Available online: https://www.fibre-gen.com/user-videos (accessed on 31 May 2023).
  25. Bian, L.; Ye, D.; Chen, S.; Huang, J.; Shi, J. Variation analysis on DBH and modulus of elasticity traits preserved in elites germplasm of Cunninghamia lanceolata. J. For. Environ. 2019, 39, 102–106. [Google Scholar] [CrossRef]
  26. Hu, K.; Huang, Y.; Fei, B.; Yao, C.; Zhao, C. Investigation of the Multilayered Structure and Microfibril Angle of Different Types of Bamboo Cell Walls at the Micro/Nano Level Using a LC-PolScope Imaging System. Cellulose 2017, 24, 4611–4625. [Google Scholar] [CrossRef] [Scilit]
  27. Zavadskii, A.E. X-ray Diffraction Method of Determining the Degree of Crystallinity of Cellulose Materials of Different Anisotropy. Fibre Chem. 2004, 36, 425–430. [Google Scholar] [CrossRef] [Scilit]
  28. Franklin, G.L. Preparation of Thin Sections of Synthetic Resins and Wood-Resin Composites, and a New Macerating Method for Wood. Nature 1945, 155, 51. [Google Scholar] [CrossRef] [Scilit]
  29. Xiao, Y.; Wang, J.; Yun, H.; Yang, G.; Ma, J.; Ma, W.; Qu, G. Genetic Evaluation and Combined Selection for the Simultaneous Improvement of Growth and Wood Properties in Catalpa bungei Clones. Forests 2021, 12, 868. [Google Scholar] [CrossRef] [Scilit]
  30. Ginestet, C. Ggplot2: Elegant Graphics for Data Analysis. J. R. Stat. Soc. Ser. A: Stat. Soc. 2011, 174, 245–246. [Google Scholar] [CrossRef] [Scilit]
  31. Kassambara, A. Ggpubr:“Ggplot2” Based Publication Ready Plots, R Package Version 0.4.0. Available online: https://CRAN.R-project.org/package=ggplot2 (accessed on 19 December 2022).
  32. Harrell, F.E., Jr.; Harrell, M.F.E., Jr. Package ‘Hmisc’. Available online: https://CRAN.R-project.org/package=Hmisc (accessed on 19 December 2022).
  33. Wei, T.; Simko, V.; Levy, M.; Xie, Y.; Jin, Y.; Zemla, J. Package ‘Corrplot’. Statistician 2017, 56, e24. [Google Scholar]
  34. Kassambara, A.; Mundt, F. Package ‘Factoextra’. Available online: https://CRAN.R-project.org/package=factoextra (accessed on 19 December 2022).
  35. Graul, C.; Graul, M.C. Package ‘LeafletR.’ Interactive Web-Maps Based on the Leaflet JavaScript Library. Available online: https://github.com/chgrl/leafletR (accessed on 1 April 2016).
  36. Marini, F.; Manetti, M.C.; Corona, P.; Portoghesi, L.; Vinciguerra, V.; Tamantini, S.; Kuzminsky, E.; Zikeli, F.; Romagnoli, M. Influence of Forest Stand Characteristics on Physical, Mechanical Properties and Chemistry of Chestnut Wood. Sci. Rep. 2021, 11, 1549. [Google Scholar] [CrossRef] [Scilit]
  37. Cepeda-Cornejo, V.; Dirzo, R. Sex-Related Differences in Reproductive Allocation, Growth, Defense and Herbivory in Three Dioecious Neotropical Palms. PLoS ONE 2010, 5, e9824. [Google Scholar] [CrossRef] [Scilit]
  38. Correia, O.; Diaz Barradas, M.C. Ecophysiological Differences between Male and Female Plants of Pistacia lentiscus L. Plant Ecol. 2000, 149, 131–142. [Google Scholar] [CrossRef] [Scilit]
  39. Obeso, J.R. The Costs of Reproduction in Plants. New Phytol. 2002, 155, 321–348. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Kuprevicius, A.; Auty, D.; Achim, A.; Caspersen, J.P. Quantifying the Influence of Live Crown Ratio on the Mechanical Properties of Clear Wood. For. Int. J. For. Res. 2013, 86, 361–369. [Google Scholar] [CrossRef] [Scilit]
  41. Getzin, S.; Wiegand, K. Asymmetric Tree Growth at the Stand Level: Random Crown Patterns and the Response to Slope. For. Ecol. Manag. 2007, 242, 165–174. [Google Scholar] [CrossRef] [Scilit]
  42. Ning, W.U.; Rui, X.; Yanping, X.U.; Guanben, D.U.; Xiaoping, L.I.; Fei, S. Growth Stage and Plant Sex with Chemical Compounds of Industrial Hemp Stalks. Master’s Thesis, Zhejiang A&F University, Hangzhou, China, 2015. [Google Scholar]
  43. Byers, B.A.; DeSoto, L.; Chaney, D.; Ash, S.R.; Byers, A.B.; Byers, J.B.; Stoffel, M. Fire-Scarred Fossil Tree from the Late Triassic Shows a Pre-Fire Drought Signal. Sci. Rep. 2020, 10, 20104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Savidge, R.A. The Role of Plant Hormones in Higher Plant Cellular Differentiation. II. Experiments with the Vascular Cambium, and Sclereid and Tracheid Differentiation in the Pine, Pinus contorta. Histochem. J. 1983, 15, 447–466. [Google Scholar] [CrossRef] [Scilit]
  45. Zhang, Y.; Ding, C.; Liu, Y.; Li, S.; Li, X.; Xi, B.; Duan, J. Xylem Anatomical and Hydraulic Traits Vary within Crown but Not Respond to Water and Nitrogen Addition in Populus tomentosa. Agric. Water Manag. 2023, 278, 108169. [Google Scholar] [CrossRef] [Scilit]
  46. Deng, D. Study on Anatomical Structure of Stems and Leaves of Male and Female Plants in Three Podocarpus Plants. Master’s Thesis, Guangxi University, Nanning, China, 2018. [Google Scholar]
  47. Guo, X.; Gao, Z.; Liu, Z.; Liang, L.; Wang, G. Comparative Anatomy of Vessel Elements in Staminate and Pistillate Plants of Fraxinus pennsylvanica. Sci. Silvae Sin. 2010, 46, 51–55. [Google Scholar]
  48. Wang, F.; Zhang, Q.; Tian, Y.; Yang, S.; Wang, H.; Wang, L.; Li, Y.; Zhang, P.; Zhao, X. Comprehensive Assessment of Growth Traits and Wood Properties in Half-Sib Pinus koraiensis Families. Euphytica 2018, 214, 202. [Google Scholar] [CrossRef] [Scilit]
  49. El-Kassaby, Y.A.; Mansfield, S.; Isik, F.; Stoehr, M. In Situ Wood Quality Assessment in Douglas-Fir. Tree Genet. Genomes 2011, 7, 553–561. [Google Scholar] [CrossRef] [Scilit]
  50. Bouffier, L.; Charlot, C.; Raffin, A.; Rozenberg, P.; Kremer, A. Can Wood Density Be Efficiently Selected at Early Stage in Maritime Pine (Pinus pinaster Ait.)? Ann. For. Sci. 2008, 65, 106. [Google Scholar] [CrossRef] [Scilit]
  51. Shi, H.; Hu, Y.; Odermatt, P.D.; Gonzalez, C.G.; Zhang, L.; Elias, J.E.; Chang, F.; Huang, K.C. Precise Regulation of the Relative Rates of Surface Area and Volume Synthesis in Bacterial Cells Growing in Dynamic Environments. Nat. Commun. 2021, 12, 1975. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Ursell, T.; Lee, T.K.; Shiomi, D.; Shi, H.; Tropini, C.; Monds, R.D.; Colavin, A.; Billings, G.; Bhaya-Grossman, I.; Broxton, M.; et al. Rapid, Precise Quantification of Bacterial Cellular Dimensions across a Genomic-Scale Knockout Library. BMC Biol. 2017, 15, 17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Kataoka, Y.; Kondo, T. FT-IR Microscopic Analysis of Changing Cellulose Crystalline Structure during Wood Cell Wall Formation. Macromolecules 1998, 31, 760–764. [Google Scholar] [CrossRef] [Scilit]
  54. Yuan, T.; Huang, Y.; Zhang, T.; Wang, X.; Li, Y. Change in Micro-Morphology and Micro-Mechanical Properties of Thermally Modified Moso Bamboo. Polymers 2022, 14, 646. [Google Scholar] [CrossRef] [Scilit]
  55. Vermerris, W.; Sherman, D.M.; McIntyre, L.M. Phenotypic Plasticity in Cell Walls of Maize Brown Midrib Mutants Is Limited by Lignin Composition. J. Exp. Bot. 2010, 61, 2479–2490. [Google Scholar] [CrossRef] [Scilit]
  56. Hu, W.-J.; Harding, S.A.; Lung, J.; Popko, J.L.; Ralph, J.; Stokke, D.D.; Tsai, C.-J.; Chiang, V.L. Repression of Lignin Biosynthesis Promotes Cellulose Accumulation and Growth in Transgenic Trees. Nat. Biotechnol. 1999, 17, 808–812. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Distribution of sampling trees in Xiashu Forest Farm. The numbers on the plots represented the number of the sampled trees, and the colors of the plots were mapped with the variation in altitude.
Figure 1. Distribution of sampling trees in Xiashu Forest Farm. The numbers on the plots represented the number of the sampled trees, and the colors of the plots were mapped with the variation in altitude.
Forests 14 01809 g001
Figure 2. DNA electrophoresis pattern of 42 samples. The primers specifically amplify a 1030 bp fragment in male leaf samples. Lane M: 1500 bp marker; Lane 1, 2, 3, 4, 6, 7, 8, 11, 12, 16, 17, 18, 20, 21, 22, 23, 27, 28, 36, 41, and 42: male leave samples.
Figure 2. DNA electrophoresis pattern of 42 samples. The primers specifically amplify a 1030 bp fragment in male leaf samples. Lane M: 1500 bp marker; Lane 1, 2, 3, 4, 6, 7, 8, 11, 12, 16, 17, 18, 20, 21, 22, 23, 27, 28, 36, 41, and 42: male leave samples.
Forests 14 01809 g002
Figure 3. Comparison of growth traits between male and female ginkgoes. Inside the boxplots, the green spots indicate the mean value and the horizontal short lines indicate the median value. Student’s t-test; *: Significantly difference (p ≤ 0.05); **: Extremely significant difference (p ≤ 0.01).
Figure 3. Comparison of growth traits between male and female ginkgoes. Inside the boxplots, the green spots indicate the mean value and the horizontal short lines indicate the median value. Student’s t-test; *: Significantly difference (p ≤ 0.05); **: Extremely significant difference (p ≤ 0.01).
Forests 14 01809 g003
Figure 4. (a) Ginkgo wood core sample. (b) Comparison of wood properties between male and female ginkgoes. Inside the boxplots, the green spots indicate the mean value and the horizontal short lines indicate the median value. Student’s t-test; *: Significantly difference (p ≤ 0.05); **: Extremely significant difference (p ≤ 0.01).
Figure 4. (a) Ginkgo wood core sample. (b) Comparison of wood properties between male and female ginkgoes. Inside the boxplots, the green spots indicate the mean value and the horizontal short lines indicate the median value. Student’s t-test; *: Significantly difference (p ≤ 0.05); **: Extremely significant difference (p ≤ 0.01).
Forests 14 01809 g004
Figure 5. The tracheid morphology of ginkgoes. (a) Ginkgo tracheid under a 40× optical microscope. (b) Ginkgo tracheid under a 400× optical microscope. (c) Comparison of tracheid morphology between male and female ginkgoes. Inside the boxplots, the green spots indicate the mean value and the horizontal short lines indicate the median value. Student’s t-test; *: Significantly difference (p ≤ 0.05); **: Extremely significant difference (p ≤ 0.01).
Figure 5. The tracheid morphology of ginkgoes. (a) Ginkgo tracheid under a 40× optical microscope. (b) Ginkgo tracheid under a 400× optical microscope. (c) Comparison of tracheid morphology between male and female ginkgoes. Inside the boxplots, the green spots indicate the mean value and the horizontal short lines indicate the median value. Student’s t-test; *: Significantly difference (p ≤ 0.05); **: Extremely significant difference (p ≤ 0.01).
Forests 14 01809 g005
Figure 6. Correlation analysis of growth traits and wood properties. (a) Pearson’s correlation coefficient among growth traits and wood properties; *: Significant correlation (p ≤ 0.05); **: Extremely significant correlation (p ≤ 0.01). (b) Clustering of growth traits and wood properties using Pearson’s correlation.
Figure 6. Correlation analysis of growth traits and wood properties. (a) Pearson’s correlation coefficient among growth traits and wood properties; *: Significant correlation (p ≤ 0.05); **: Extremely significant correlation (p ≤ 0.01). (b) Clustering of growth traits and wood properties using Pearson’s correlation.
Forests 14 01809 g006
Figure 7. PCA of 42 sample ginkgoes. (a) PCA analysis based on the growth traits. (b) PCA analysis based on the wood properties. (c) PCA analysis based on all the indices.
Figure 7. PCA of 42 sample ginkgoes. (a) PCA analysis based on the growth traits. (b) PCA analysis based on the wood properties. (c) PCA analysis based on all the indices.
Forests 14 01809 g007
Table 1. Ranking of the membership functions for the sampled ginkgoes.
Table 1. Ranking of the membership functions for the sampled ginkgoes.
SampleSexAverage Membership Function ValueRankSampleSexAverage Membership Function ValueRank
1male0.4811837531022male0.41506817524
2male0.555076882523male0.38776905728
3male0.545341060624female0.5029009569
4male0.4795022531125female0.39108982627
5female0.4768223041226female0.38011755331
6male0.566770875427male0.5031858618
7male0.515035429728male0.42560836421
8male0.4757292351329female0.32724460938
9female0.4391838741930female0.36751126233
10female0.621459189331female0.34294421136
11male0.4092389742532female0.34555841335
12male0.4690897261433female0.28259283542
13female0.3729013793234female0.40908300126
14female0.4521085791635female0.32364496840
15female0.3243576773936male0.43862871420
16male0.4221742742237female0.32762722537
17male0.3478454933438female0.38354802730
18male0.3861205512939female0.44358487018
19female0.4600671421540female0.44590348317
20male0.4219160022341male0.7657339621
21male0.3131063874142male0.7132238262
Mean MFV of females0.400964351 Mean MFV of males0.477968992
Total MFV of females8.420251382 Total MFV of males10.037348853
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, J.; Su, X.; Guo, J.; Xu, W.; Feng, L.; Wang, T.; Fu, F.; Wang, G. Sex-Related Differences of Ginkgo biloba in Growth Traits and Wood Properties. Forests 2023, 14, 1809. https://doi.org/10.3390/f14091809

AMA Style

Li J, Su X, Guo J, Xu W, Feng L, Wang T, Fu F, Wang G. Sex-Related Differences of Ginkgo biloba in Growth Traits and Wood Properties. Forests. 2023; 14(9):1809. https://doi.org/10.3390/f14091809

Chicago/Turabian Style

Li, Jiaqi, Xiandi Su, Jing Guo, Wei Xu, Lei Feng, Tongli Wang, Fangfang Fu, and Guibin Wang. 2023. "Sex-Related Differences of Ginkgo biloba in Growth Traits and Wood Properties" Forests 14, no. 9: 1809. https://doi.org/10.3390/f14091809

APA Style

Li, J., Su, X., Guo, J., Xu, W., Feng, L., Wang, T., Fu, F., & Wang, G. (2023). Sex-Related Differences of Ginkgo biloba in Growth Traits and Wood Properties. Forests, 14(9), 1809. https://doi.org/10.3390/f14091809

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop