CsAFS2 Gene from the Tea Plant Intercropped with Chinese Chestnut Plays an Important Role in Insect Resistance and Cold Resistance

Abstract

α-Farnesene, a crucial secondary metabolite in sesquiterpenes, is crucial for plant biotic and abiotic stress resistance. In this study, we screened an AFS gene from transcriptome data of tea plants (Camellia sinensis) intercropped with Chinese chestnut (Castanea mollissima), resulting in the cloning of CsAFS2. CsAFS2 expression increased following treatment with MJ (Methyl jasmonate), SA (Salicylic acid), GA₃ (Gibberellin A3), and various plant growth regulators, as well as under high-salt, drought, and low-temperature conditions. The heterologous genetic transformation of tobacco with CsAFS2 led to an enhanced resistance to low-temperature stress and aphid feeding, evident from elevated levels of osmotic regulatory substances, increased protective enzyme activity, and the upregulation of cold and insect resistance-related genes. Trichomes, crucial in cold and insect resistance, exhibited significantly greater length and density in transgenic tobacco as compared to control plants. These results confirm the vital role of CsAFS2 in enhancing cold and insect resistance, providing comprehensive insights into stress regulation mechanisms in tea plants and advancing stress-resistant tea plant breeding.

1. Introduction

α-Farnesene is prevalent in leaves, flowers, and fruits of various plants, serving as a crucial aroma component and signal substance. It plays significant roles in insect induction, plant defense, and growth regulation. In apple, pear, and tea plants, α-farnesene production substantially increased when insects invaded [1,2,3]. In soybeans, it was vital for both belowground and aboveground organ defense against nematodes [4]. Additionally, α-farnesene accumulation rose notably in tea plants infested by various pests (tea tapeworm, tetranychus kanzawai, tea looper, or tea green leafhopper) [5,6]. Low-temperature apple treatments also significantly boosted α-farnesene expression [7]. In Arabidopsis, overexpressing the AFS gene enhanced cold stress tolerance through JA biosynthesis and signaling pathways [8]. Thus, high α-farnesene content generally indicated strong resistance.

Intercropping, planting multiple crops in the same field rows, is a common agricultural method to enhance production by efficiently utilizing space, improving ventilation and light transmission, and boosting light energy utilization and stress resistance of crops [9]. In Chinese tea production, a notable cultivation technique involves planting trees in tea plantations, notably intercropping tea plants with Chinese chestnut. This approach benefits tea plant growth, development, and quality compared to pure plantations. In spring, Chinese chestnut trees reduced wind speed and turbulence, thereby minimizing heat exchange between tea plants canopies, facilitating a faster temperature rise in intercropped tea plantations than in monoculture, thus promoting tea plant germination. During summer, the Chinese chestnut canopy shade effectively lowered sun radiation in intercropped plantations, protecting tea plants from high temperatures. In fall and winter, fallen chestnut leaves reduced surface long-wave radiation and soil–air heat exchange, aiding soil heat preservation [10]. However, studies on the impact of intercropping tea plants with Chinese chestnuts on tea quality, particularly concerning key genes, is limited.

Tea plants in Chinese chestnut-tea intercropped plantations outperformed those in pure tea plantations regarding cold and insect resistance, as well as quality. This superiority is attributed to two factors: Firstly, on a macro level, chestnut plants provided excellent protection and support for the growth and development of tea plants. Secondly, at the micro level, certain resistance genes within the tea plants of the Chinese chestnut-tea intercropped plantation are highly expressed, enhancing cold and insect resistance, thus elevating overall quality as compared to pure tea plantation. Previous studies suggested the significant involvement of the AFS gene in insect and cold resistance. Consequently, tea plants within the Chinese chestnut-tea intercropped plantation likely exhibited better resistance compared to those in pure tea plantations, a correlation closely linked to the AFS gene. Transcriptome [11] analysis of the Chinese chestnut-tea intercropped plantation identified four AFS genes: AFS1 (LOC114298667), AFS2 (LOC114266406), AFS3 (LOC114293286), and AFS4 (LOC114257853). After analyzing the AFS2 gene expression through qPCR following various hormone, drought, salt, and low-temperature treatments, we observed a rapid and robust induction of AFS2 expression, prompting further intensive investigation. Consequently, we successfully cloned its full length, designating it as CsAFS2. Employing heterologous genetic transformation in tobacco, we subjected CsAFS2 transgenic tobacco to low-temperature stress and aphid feeding. This approach aimed to explore alterations in osmotic regulatory substances and protective enzyme activities in transgenic tobacco under both biotic and abiotic stresses, laying the groundwork for functional analysis and expression patterns of AFS genes in tea plants intercropped with Chinese chestnut. This study contributes to a comprehensive understanding of AFS genes. Additionally, our findings reveal superior tea plant quality in the Chinese chestnut-tea intercropped plantation compared to pure tea plantations. Furthermore, we utilized the CsAFS2 gene to elucidate the resistance mechanism of tea plants in the Chinese chestnut-tea intercropped plantation.

2. Results

2.1. qRT-PCR Expression Analysis of AFS1, AFS2, AFS3, and AFS4

The relative expression of AFS2 surpassed that of AFS1, AFS3, and AFS4 across various hormone, drought, salt, and low-temperature treatments (Figure 1a–d). Therefore, we focused our research on AFS2. Following MJ, SA, and GA₃ treatments, AFS2’s relative expression increased by 8.0-, 4.7-, and 13.3-fold compared to the control, respectively. Notably, its peak relative expression, 22.4-fold higher than the control, occurred after 30 min at 4 °C (Figure 1b).

2.2. Gene Cloning and Sequence Analysis

The AFS2 gene was cloned from tea plants intercropped with Chinese chestnut. Multiple sequence alignment and phylogenetic analysis showed substantial similarity between this gene and AFS gene of Theaceae plants, leading to its designation as CsAFS2 (Figure 2a). The CsAFS2 gene (Genbank: OM888666) spanning 1683 bp features open reading frames encoding 560 amino acids (Figure 2b).

2.3. Genetic Transformation in Tobacco

Infiltrating tobacco leaves with Agrobacterium tumefaciens sap via the pCAMBIA1300-CsAFS2 overexpression vector induced resistant buds on MS 3 media containing hyg. These buds, reaching 1–2 cm, were transferred to MS 4 media for seedling reinforcement. Upon reaching 3–5 cm, tobacco seedlings were shifted to MS 5 media for rooting and plant formation (Figure 3). By the following qRT-PCR analysis, transgenic efficiency reached 85%.

2.4. Generation and Screening of Transgenic Tobacco Lines

Twenty T1 tobacco lines were acquired, and their seeds were harvested and sown. Subsequently, twenty T2 transgenic tobacco lines were generated. Transgenic tobacco DNA served as the template for PCR, utilizing primers designed for the hygromycin transferase gene. Ten positive lines were identified through PCR screening. Comparative analysis against the empty vector control revealed ten positive lines, from which three high-expression lines—CsAFS2-OE9, CsAFS2-OE26, and CsAFS2-OE31—emerged. Their expression levels exceeded those of the control by 420.26-, 370.09-, and 600.45-fold, respectively (Figure 4).

2.5. Phenotype Observation of the CsAFS2 Transgenic Lines

No significant differences were observed in plant height, leaf length, and leaf width between transgenic tobacco plants and the control. After 12 h of aphid feeding, phenotypic changes were insignificant in both plant types (Figure 5a,b). However, following exposure to low temperatures for the same duration, the control tobacco plants wilted noticeably, while transgenic ones remained upright, indicating enhanced cold resistance conferred by the CsAFS2 gene (Figure 6a(i–iv)). An examination of tobacco stem trichomes revealed that transgenic tobacco had more numerous and longer trichomes compared to the control (Figure 6b(i–iv)). Electron microscopy analysis of freehand sections showed that control plants had around 10 trichomes per field of view (20×), ranging from 0.52 to 1.13 mm in length, with an average length of ~0.83 mm. In contrast, transgenic tobacco had 20–30 trichomes ranging from 2.16 to 3.18 mm in length, with an average length of about 2.67 mm, resulting in trichome length and density three-fold higher than that of control plants (Figure 6c(i–iv)). This indicated that transgenic tobacco trichomes were denser and longer, potentially enhancing resistance to piercing-sucking insects.

2.6. Analysis of Cold Resistance of CsAFS2-Overexpressing Tobacco Plants

After 4 °C treatment, the relative conductivity increased in two transgenic tobacco lines, CsAFS2-OE9 and CsAFS2-OE31, by 1.06- and 1.22-fold, respectively, compared to 25 °C. Conversely, in CsAFS2-OE26, it decreased by 0.93-fold (Figure 7a). The MDA content in transgenic tobacco increased by 2.50-, 1.20-, and 1.40-fold after 4 °C treatment, significantly lower than in the control tobacco plant (Figure 7b), indicating stronger cold tolerance in CsAFS2 transgenic lines than in the control.

Following 4 °C treatment, compared to 25 °C, soluble protein content in transgenic tobacco increased by 1.33-, 1.11-, and 1.10-fold (Figure 7c); soluble sugar content by 1.50-, 1.54-, and 1.36-fold (Figure 7d); and proline contents by 1.67-, 2.13-, and 1.25-fold (Figure 7e). These contents in transgenic tobacco after 4 °C treatment were significantly higher than those at 25 °C and in the control tobacco plant, demonstrating stronger cold tolerance in CsAFS2 transgenic lines compared to the control tobacco plant.

Following 4 °C treatment, transgenic tobacco exhibited notable enhancements in POD, SOD, and CAT activities. Specifically, POD activity increased by 1.42-, 1.61-, and 1.50-fold (Figure 7f); SOD activity by 3.81-, 1.43-, and 1.52-fold (Figure 7g); and CAT activity by 2.19-, 1.35-, and 2.13-fold (Figure 7h). These activities were significantly higher than those observed at 25 °C and in the control tobacco plant, which indicated enhanced cold tolerance in CsAFS2 transgenic lines.

Moreover, after 12 h at 4 °C, the relative expression of four cold-resistance genes—NtCBF1, NtCBF3, NtDREB2B, and NtCOR47—significantly increased compared to 25 °C and the control tobacco plant (Figure 7i–l). This underscores CsAFS2’s positive influence on cold-resistance gene expression, thereby improving plant low-temperature resistance.

2.7. Insect Resistance Analysis of CsAFS2-Overexpressing Tobacco Plants

Following a 24 h inoculation with aphids, transgenic tobacco showed increased enzyme activities. Specifically, POD activity rose by 16%, 22%, and 33% (Figure 8a), while SOD activity increased by 19%, 21%, and 34% (Figure 8b). However, CAT activity did not significantly differ from pre-aphid feeding levels (Figure 8c). Subsequently to aphid inoculation, POD, SOD, and CAT activities in transgenic tobacco surpassed both their pre-aphid feeding levels and those observed in the control tobacco plants, indicating enhanced insect resistance in the CsAFS2-transgenic tobacco compared to controls.

Twenty-four hours post-aphid inoculation, the relative expression of four insect resistance genes—NtCPI1, NtChiA, NtCAF1, and NtTD—significantly exceeded pre-inoculation levels and surpassed expression in the control tobacco plants (Figure 8d–g).

2.8. The CsAFS2 Gene Promoter Analysis

After subjecting transgenic tobacco leaves to a 12 h low-temperature treatment at 4 °C, GUS staining revealed evident blue staining (Figure 9), confirming the low-temperature-inducible nature of the CsAFS2 promoter. This observation reinforces the resistance function of the AFS gene. The CsAFS2 promoter contained various core elements, including hormone response, light response, and defense-related elements. Notable among these are cis-acting regulatory elements responsive to plant growth regulators such as methyl jasmonate (MJ) (CGTCA-motif, TGACG-motif), gibberellic acid (GA₃) (TATC-box), salicylic acid (SA) (TCA-element), and indole-3-acetic acid (IAA) (CTTGTGT-box). Stress-related elements include MYCATRD22, MYBCORE, and LTRE1HVBLT49 (

Table 1. Prediction of cis-elements in the promoter of CsAFS2.

Possible Binding Transcription Factors	Core Sequence	Possible Functions	Name of cis-Element	Number
WRKY	TGAC	TGAC core containing W-box, transcriptional repressor of gibberellin signaling pathway	WRKY71OS	7
WRKY, ERF	TGACY	Involved in activation of ERF3 gene by wounding	WBOXNTERF3	2
WRKY	CTGACY	Involved in elicitor-responsive transcription of defense genes	WBOXNTCHN48	2
WRKY	TTGAC	Pathogen- and SA-responsive element	WBOXATNPR1	2
WRKY	TTTTTTCC	GA induction	PYRIMIDNEBOXHVEPB1	1
MYB	CNGTTR	Regulation of genes involved in water stress response	MYB-CORE	5
MYB	TAACAAAA	GA-regulated transcription factor	MYBGAHV	5
MYB	TAACAGA	GA-responsive element	GARE1OSRER1	4
MYB	MACCWAMC	Regulate phenylpropanoid and lignin biosynthesis	MYBPLANT	3
MYB	WAACCA	ABA-responsive element	MYB1AT	4
ERF	GCCGCC	Ethylene responsive element	GCC-CORE	2
ERF	WTTSSCSS	Secondary transcription factor that triggers ethylene signaling	ERFAT	4
bZIP	AACGTG	Pathogen- and JA-responsive element	T/GBOXATPIN2	3
PBF	ACACNNG	ABA-responsive element	DPBFCOREDCDC3	4
bHLH	CCGAAA	Cold-responsive elements	LTRE1HVBLT49	2
MYC	CANNTG	MYCCONSENSUSAT	MYCCONSENSUSAT	8

and

Table 2. Transcription factors from the transcriptome data of tea plants intercropped with Chinese chestnut.

Possible Binding Transcription Factors	Gene Id	Description	E-Value	Log2FC
				Pure Tea Plantation	Intercropped Tea Plantation
WRKY	LOC114289849	WRKY1	4.00 × 10−110	9.52 ± 0.33	12.08 ± 0.51
	LOC114315408	WRKY105	4.00 × 10−52	14.68 ± 0.26	19.65 ± 0.41
	LOC114314481	WRKY6	7.00 × 10−102	8.21 ± 0.17	10.43 ± 0.71
	LOC114299830	WRKY8	5.00 × 10−99	3.38 ± 0.08	5.79 ± 0.13
	LOC114256467	WRKY24	2.00 × 10−142	14.36 ± 0.63	15.01 ± 0.86
	LOC114284484	WRKY45	9.00 × 10−38	0 ± 0.00	0.06 ± 0.01
	LOC114287654	WRKY23	1.00 × 10−51	0.48 ± 0.04	0.18 ± 0.02
	LOC114299833	WRKY38	3.00 × 10−53	2.23 ± 0.07	1.08 ± 0.09
	LOC114275007	WRKY10	6.00 × 10−13	5.25 ± 0.11	5.27 ± 0.24
	LOC114259259	WRKY70	6.00 × 10−30	7.22 ± 0.37	6.84 ± 0.43
MYB	LOC114284747	MYB36	1.00 × 10−137	0.04 ± 0.01	0 ± 0.00
	LOC114271197	MYB44	5.00 × 10−25	3.57 ± 0.59	5.76 ± 0.64
	LOC114277061	MYB88	4.00 × 10−120	5.17 ± 0.22	5.07 ± 0.18
	LOC114262164	MYB105	3.00 × 10−36	0.07 ± 0.02	0 ± 0.00
	LOC114308355	MYB4	2.00 × 10−54	16.89 ± 1.22	16.38 ± 1.37
	LOC114262089	MYB16	3.00 × 10−117	38.28 ± 1.45	40.24 ± 1.47
	LOC114322988	MYB86	3.00 × 10−89	3.88 ± 0.76	3.31 ± 0.45
	LOC114295878	MYB101	1.00 × 10−67	0.04 ± 0.00	0 ± 0.00
	LOC114277090	MYB5	8.00 × 10−114	17.56 ± 2.37	16.64 ± 1.56
	LOC114277091	MYB10	3.00 × 10−36	6.03 ± 0.84	3.83 ± 0.77
	LOC114316900	MYB35	5.00 × 10−110	0.04 ± 0.00	0.05 ± 0.00
	LOC114309279	MYB61	1.00 × 10−121	5.21 ± 1.24	5.52 ± 1.57
	LOC114292749	MYB2	1.00 × 10−114	0.05 ± 0.02	0 ± 0.00
	LOC114285525	MYB52	2.00 × 10−100	0.18 ± 0.07	0.63 ± 0.14
	LOC114297472	MYB15	3.00 × 10−83	1.78 ± 0.66	2.08 ± 1.57
	LOC114279142	MYB39	6.00 × 10−81	0.52 ± 0.13	0.64 ± 0.37
	LOC114276260	MYB98	2.00 × 10−67	0.34 ± 0.08	0.19 ± 0.04
	LOC114268476	MYB110	6.00 × 10−49	0.06 ± 0.02	0.11 ± 0.00
	LOC114281490	MYB111	1.00 × 10−53	3.71 ± 0.40	3.14 ± 0.32
ERF	LOC114312023	ERF2	2.00 × 10−68	1.19 ± 0.06	2.44 ± 0.09
	LOC114319131	ERF16	6.00 × 10−43	2.34 ± 0.04	2.69 ± 0.03
	LOC114260629	ERF18	1.00 × 10−57	0.88 ± 0.22	0.96 ± 0.35
	LOC114264712	ERF61	2.00 × 10−54	4.88 ± 0.14	7.69 ± 0.27
	LOC114288203	ERF109	9.00 × 10−53	1.41 ± 0.11	2.18 ± 0.17
	LOC114257849	ERF115	9.00 × 10−59	6.37 ± 0.28	11.76 ± 0.37
	LOC114275420	ERF3	1.00 × 10−38	2.55 ± 0.34	4.83 ± 0.95
	LOC114268064	ERF20	6.00 × 10−14	0.08 ± 0.00	0 ± 0.00
	LOC114284734	ERF118	1.00 × 10−8	22.04 ± 1.46	16.98 ± 1.87
	LOC114312929	ERF24	3.00 × 10−54	0.07 ± 0.00	0 ± 0.00
	LOC114294084	ERF26	2.00 × 10−19	2.11 ± 0.24	0.89 ± 0.16
	LOC114277320	ERF96	4.00 × 10−6	0.14 ± 0.00	0 ± 0.00
	LOC114290124	ERF114	3.00 × 10−44	0.99 ± 0.19	2.08 ± 0.42
	LOC114300795	ERF38	4.00 × 10−41	3.65 ± 0.79	4.38 ± 1.20
	LOC114255784	ERF34	3.00 × 10−27	15.04 ± 1.06	11.92 ± 1.11
MYC	LOC114283260	MYC2	0	62.66 ± 2.35	50.51 ± 1.97
bHLH	LOC114261778	bHLH96	9.00 × 10−95	12.53 ± 1.09	19.05 ± 1.81
	LOC114318495	bHLH162	2.00 × 10−28	3.66 ± 0.03	6.47 ± 1.54
	LOC114280978	bHLH123	8.00 × 10−91	1.94 ± 0.72	3.18 ± 0.94
	LOC114320661	bHLH96	9.00 × 10−95	47.71 ± 1.65	30.17 ± 1.87
	LOC114263002	bHLH74	2.00 × 10−172	17.44 ± 1.47	16.19 ± 1.75
	LOC114289221	bHLH120	5.00 × 10−31	0.69 ± 0.07	0.62 ± 0.00
	LOC114288662	bHLH110	4.00 × 10−78	6.09 ± 1.01	7.27 ± 1.25
	LOC114281839	bHLH111	7.00 × 10−81	0.48 ± 0.00	0.52 ± 0.08
bZIP	LOC114315402	bZIP1	7.00 × 10−22	1.09 ± 0.27	1.84 ± 0.62
	LOC114279212	bZIP2	4.00 × 10−93	3.59 ± 0.12	5.28 ± 0.31
	LOC114307154	bZIP11	0	23.78 ± 0.97	24.26 ± 0.84

).

3. Discussion

3.1. Effects of Trichomes on Plant Stress Resistance

Trichomes play a vital protective role in plants. This study revealed that transgenic tobacco exhibited increased and elongated trichomes compared to the control. These epidermal structures, integral to specialized epidermal cells, significantly bolstered plant defenses against insects and pathogens, while enhancing resistance to freezing and other stressors [12]. In cotton, trichomes deterred bollworm hatching on leaves and petioles, thus mitigating bollworm damage [13]. Similarly, in tomatoes, the TF Wooly’s homologous structural domain regulated SlCycB2, a cell cycle protein gene, governing type I trichome development. Through mutation of the Y2001 NtCycB2 gene, the HY2001 line exhibited enhanced resistance to oxidative stress, aphids, and cold [14,15]. RNA-seq analysis of stem segment trichomes and leaves in tea plants revealed higher AFS gene expression in trichomes, indicating its pivotal role in trichome formation. Additionally, in Opisthopappus taihangensis, trichome density positively correlated significantly with terpenoid content, particularly α-farnesene [16,17,18]. In hops, both the HlAFS1 and HlAFS2 genes significantly influenced trichome growth and the aroma emitted by hops [19]. Glandular trichomes serve as production and storage organs for specialized metabolites like terpenes, crucial in plant defense. Transcriptome data from tomato trichomes reveal that MYC, bHLH, and WRKY can activate the S. lycopersicum terpene synthase promoter, facilitating trichome growth [20,21,22]. Furthermore, previous studies underscored the significance of, MYC, bHLH, and WRKY, along with terpenoids, in trichome growth and development, with their cis-elements found in the CsAFS2 promoter sequence. CsAFS2 may interact with MYC, bHLH, and WRKY to co-regulate trichome growth. Identified in tea plants from Chinese chestnut tea plantations, the AFS2 gene potentially influences tea trichome growth, enhancing both plant resistance and tea fragrance. The enhanced “hao xiang” (fragrance) in tea leaves is notable in intercropped plantations, suggesting CsAFS2’s role in regulating trichome development is vital for stress resistance and tea quality improvement in such systems.

3.2. The Combination Analysis of the CsAFS2 Gene and Transcription Factors

The CsAFS2 gene was typically regulated by transcription factors, with its promoter containing WRKY, MYB, MYC, and ERF cis-elements, suggesting interaction likelihood with these transcription factors. In apple, MdAFS expression correlates closely with MdMYC2 and MdERF3. Transformation experiments in apple callus demonstrated elevated MdAFS expression by MdMYC2 and MdERF3 [5]. In Indian sandalwood (Santalum album), ERF positively regulated SaAFS gene expression, enhancing low-temperature resistance via JA biosynthesis and signaling pathways [8]. In spearmint, MsMYB, specific to terpene biosynthesis, positively regulated terpene compound expression [23]. Analysis of the CsAFS2 promoter post-cloning revealed eight MYC and eight ERF cis-elements, implying significant association of CsAFS2 gene expression with MYC and ERF. However, the specific pathway through which MYC and ERF regulate enhanced the CsAFS2 gene expression required further research and validation.

3.3. Regulation of CsAFS2 Gene by Hormone Crosstalks

The CsAFS2 gene responded to various plant growth regulators. In this study, its expression notably increased in transgenic tobacco after treatments with MJ, ABA, ETH, GA3, and SA. The CsAFS2 promoter contains plant growth regulator response elements, including MJ-responsive cis-acting regulatory elements (CGTCA-motif, TGACG-motif), GA₃-responsive cis-acting elements (TATC-box), SA-responsive cis-acting elements (TCA-element), and an IAA response element (cttgtgt-box). This indicated crosstalk between the CsAFS2 gene and MJ, ABA, ETH, GA₃, and SA. In apple, analysis of the MdAFS gene promoter showed that MJ and ETH stimulated α-farnesene synthesis [1]. Research on tobacco heterologous genetic transformation of the apple AFS gene indicated that GA₃, IAA, MJ, and ABA promoted α-farnesene synthesis [7]. In citrus, MJ and SA increased AFS expression, enhancing cold resistance [24]. In Arabidopsis, AFS gene expression was promoted after exogenous MJ spraying, making MJ-sprayed lines more insect-resistant than non-MJ-sprayed lines, indicating crosstalk between MJ and AFS and increased plant insect resistance [25]. It is hypothesized that optimal levels of SA, MJ, ABA, and GA₃ are crucial in biotic and abiotic stress resistance, leading to terpenoid accumulation. Consequently, this study suggested that in tea plants, SA, MJ, ABA, and GA₃ regulate α-farnesene gene expression, thereby enhancing stress resistance. However, due to the complex interactions of plant hormones, further investigation into specific regulatory mechanisms in tea plants is necessary.

3.4. CsAFS2 Might Enhance Insects and Cold Resistance in Plants by Releasing α-Farnesene

The AFS gene significantly enhanced plant resistances, and played a vital role in plant growth and development. The SaAFS gene from Santalum album introduced into Arabidopsis thaliana generated significant cold tolerance via JA biosynthesis and signaling pathways. Tea geometrid poses a severe threat to tea plant growth [8]. When tea plants face tea geometrid attacks, they emit numerous volatiles to repel them, with α-farnesene being pivotal among these [26]. Aphids, significant agricultural pests, are disrupted by α-farnesene, the primary component of aphid alarm pheromones, prompting their dispersal from host plants [27]. Application of ASM (Acibenzolar-S-methyl) to apples triggers a substantial release of α-farnesene, bolstering apple resistance against aphid infestations [28]. Previous studies indicated that α-farnesene is released in response to low temperature and insect pests, playing a crucial role in plant resilience against biotic and abiotic stresses. AFS acts as the primary enzyme regulating α-farnesene synthesis; thus, over-expression of CsAFS2 leads to the accumulation of α-farnesene in transgenic tobacco. Consequently, CsAFS2 enhanced tobacco resistance to low temperature and aphids by modulating the expression of protective enzymes, cold resistance-related genes, and insect resistance-related genes. Subsequent investigations will compare α-farnesene levels in transgenic and wild-type tobacco to further validate the role of CsAFS2 and α-farnesene in plant resistances.

4. Materials and Methods

4.1. Plant Materials and Growth Conditions

The tender leaves (second leaves from top) from the cultivar C. sinensis ‘Yunkang No.10’, grown in a tea plantation alongside Chinese chestnut in Kunming, were promptly frozen in liquid nitrogen and stored at −80 °C. As Camellia sinensis lacks a robust homologous transformation system, tobacco served as the model plant for heterologous genetic transformation. Tobacco cultivation occurred in a tissue culture room maintained at a consistent 25 °C, with daily light exposure lasting 10–12 h and a 65%–75% humidity range.

A total of seven different cultural media were utilized in this study. YEB 1 (Agrobacterium rhizogenes liquid medium), comprising YEB + 100 mg/L Rif (Rifampin) + 100 mg/L Kan (Kanamycin) + 6.5 g/L Agar), and YEB 2, comprising YEB + 100 mg/L Rif + 100 mg/L Kan, were applied for spreading and shaking bacteria during the transformation step. MS (Murashig and Skoog medium) 1: 3% MS + 6.5 g/L Agar + 30 g/L sucrose was employed for infection in the genetic transformation process. MS 2: 3% MS + 2.25 mg/L 6-BA (6-Benzylamino purine) + 0.3 mg/L NAA (Naphthylacetic acid) + 6.5 g/L Agar was used in the genetic transformation. MS 3: 3% MS + 2.25 mg/L 6-BA + 0.3 mg/L NAA + 20 mg/L Hyg (Hygromycin) + 400 mg/L Cef (Cephalosporin) + 6.5 g/L Agar served for the preliminary screening of transformants obtained through genetic transformation. Finally, MS 4: 3% MS + 0.1 mg/L 6-BA + 0.1 mg/L NAA + 20 mg/L Hyg + 400 mg/L Cef + 6.5 g/L Agar was utilized for the rooting culture of transgenic tobacco.

4.2. Expression of AFS1, AFS2, AFS3, and AFS4 Genes under Different Plant Growth Regulators and Low Temperature

Transcriptome data analysis revealed the presence of AFS1, AFS2, AFS3, and AFS4 genes in tea plants from plantations intercropped with Chinese chestnut, compared to those in pure tea plantations. NCBI Primer-BLAST facilitated the design of qPCR primers for AFS1, AFS2, AFS3, AFS4, and Actin genes, which were synthesized by Sangon Biotech (Shanghai, China). Samples, including untreated leaves as controls, were collected after 2 h of treatment. Cold resistance analysis involved exposing tea plant leaves to 4 °C for varying durations: 0, 10, 30, 60, and 120 min. RNA extraction and cDNA synthesis were performed on these treated leaves for subsequent qPCR analysis. Utilizing the 2^−ΔΔCt method, relative expression levels of the AFS2 gene were quantified under different plant growth regulators, high-salt, drought, and low-temperature treatments.

4.3. The CsAFS2 Gene Cloning

RNA was extracted following Magen’s RNA extraction kit protocol (Magen Biotech, Guangzhou, China). Specific cloning primers P1-F and P1-R were designed using the NCBI online platform. The cDNA, obtained from reverse transcription, served as a template for CsAFS2 full-length sequence amplification. Gel recovery kit was used to purify the destination bands (Tiangen Biotech, Beijing, China). The target band was ligated into a cloning vector and transformed into E. coli receptor cells.

4.4. The CsAFS2 Gene Promoter Cloning and Sequence Analysis

DNA was extracted from tea plant leaves using the TIANGEN DNA Secure Plant Kit (Tiangen Biotech, Beijing, China). The extracted DNA underwent 1.0% agarose gel electrophoresis evaluation. Specific cloning primers P11-F and P11-R, designed via NCBI online, amplified the target fragment using diluted DNA as a template according to the PCR amplification system. Electrophoresis analyzed PCR products, and gel DNA recovery kit (TAKARA^TM Gel DNA Recovery Kit) purified the destination bands. The target band was ligated into a cloning vector and transformed into E. coli receptor cells. Positive colonies underwent sequencing; the obtained sequence, named CsAFS2pro, was analyzed on New PLACE for promoter action elements. The pCsAFS2:GUS expression vector was constructed by ligating the GUS gene with a 277 bp fragment containing main functional elements in the promoter, transferred into Agrobacterium EHA105, and transformed into tobacco via Agrobacterium-mediated transformation.

4.5. Construction of Overexpression Vectors, Genetic Transformation and Identification of Transgenic Lines

The BamHI and PstI enzymes were utilized for targeting specific genes, followed by linearizing cloning vectors via agarose gel electrophoresis, cutting gels, and DNA recovery (TAKARA^TM Gel DNA Recovery Kit). The resulting cleavage product was then purified using a purification kit. Subsequently, the target fragment was ligated into the pCAMBIA1300-35S vector, which was further transformed into E. coli for screening positive clones and subsequent sequencing The extracted plasmids were then introduced into Agrobacterium tumefaciens GV3101.

Tobacco leaf discs, each measuring 0.5 cm × 0.5 cm, were subjected to a 10 min incubation with Agrobacterium-infused MS1 media. Post-infestation, the leaves were drained of surface sap and placed dorsal side up onto MS2 media for co-culturing in darkness. After 48 h on MS2 media, the leaves were transferred dorsal side down onto MS3 media to induce resistant buds and screen cultures. Upon reaching 1–2 cm, the resistant buds were isolated and transferred to MS4 media. Upon consistent growth to 3–5 cm, they were moved to MS5 media for rooting. Transgenic tobacco DNA was then extracted, and primers for hygromycin transferase and cas genes were designed for PCR screening of positive lines. All positive lines were further analyzed for expression using qPCR to identify those with higher expression levels. Additionally, the empty vector pCAMBIA1300-35S was transformed into tobacco plants as a control.

4.6. Observations on the Phenotype of Transgenic Tobacco

Tobacco trichomes length and density were observed using the freehand slicing method and an electron microscope (LEICA DM2000).

4.7. Low-Temperature Stress in Transgenic Tobacco

Six-week-old T2 generation control tobacco plant and the transgenic tobacco field seedlings with uniform growth were subjected to 4 °C in a constant light incubator for 0, 2, 6, 12, and 24 h. Three biological replicates were performed for each line. Following low-temperature treatment, tobacco phenotypes were assessed, and leaves were stored at −80 °C.

4.8. Aphid Feeding Stress in Transgenic Tobacco

Six-week-old T2 generation control tobacco plant and transgenic tobacco field seedlings with uniform growth were selected. Twenty numbers of the 4th instar larvae of aphids were placed to feed on the second mature leaf from top to bottom for durations of 0, 2, 6, 12, and 24 h. Three biological replicates were conducted for each line. Tobacco phenotypes were observed, and combined samples of the 3rd and 4th tobacco leaves from top to bottom were collected and stored at −80 °C for subsequent analysis.

4.9. Determination of Physiological and Biochemical Indices of Transgenic Tobacco

The soluble protein content was assessed via the Coomassie Brilliant Blue G-250 method, soluble sugar content via anthrone colorimetry, and malondialdehyde content through thiobarbituric acid colorimetry. The free proline content was determined using the acid ninhydrin method. CAT, POD, and SOD activities were detected via UV absorption, guaiacol, and riboflavin NBT methods, respectively. Each parameter underwent three tests, and their average values were recorded.

4.10. Expression Analysis of Stress-Related Genes in Transgenic Tobacco

qRT-PCR primers for tobacco cold resistance genes NtCBF1, NtDREB2B, NtCBF3, and NtCOR4 (

Table 3. The qPCR primers for cold resistance genes.

Gene Name	GenBank No.	Forward Primer (5′–3′)	Reforward Primer (5′–3′)
NtCBF1 [29]	NP001312156	GGATGAGGAGACGCTATTCTG	TGTGAACACTGAGGTGGAGG
NtCBF3 [30]	NP001312741	TGTGAACACTGAGGTGGAGG	CCTCCTCGTCCATAAACAA
NtDREB2B [31]	EU727156	CGGCCGCCCATCTGAGTC	AGGTGGAGGCAGCATTAGTC
NtCOR4 [32]	NW015826227.1	TGTCATCGAAAAGCTTCACCGA	TGTCATCGAAAAGCTTCACCGA
EF1α [33]	NM001326165	TGGTTGTGACTTTTGGTCCCA	ACAAACCCACGCTTGAGATCC

), and four tobacco insect resistance genes NtChiA, NtTD, NtCPI1, and NtCAF1 (

Table 4. The qPCR primers for insects resistance genes.

Gene Name	GenBank No.	Forward Primer (5′–3′)	Reforward Primer (5′–3′)
NtChiA [34]	P08252.2	GGCCTTGTGGAAGAGCCATA	CCAAATCCAGGGAGGCGATT
NtCPI1 [35]	KF0S7988	TCTGGAGTTCGGAAAGGTTGTT	CAGACCTTGGCTTCGTATGCT
NtTD [36]	AAG59585.1	ACATGGGTCAAGTTAGGCGG	TATAGGGGTGGCAAATGGGC
NtCAF1 [37]	NP001312482.1	ATCATCATCACGCGGTCGAA	TTTTGCTGAAAGCTGCCGAC
EF1α [33]	NM001326165	TGGTTGTGACTTTTGGTCCCA	ACAAACCCACGCTTGAGATCC

) were designed and synthesized by the Sangon Biotech (Shanghai, China). The RNA extracted from tobacco leaves stressed by low temperature and aphid feeding was quality-checked, reverse-transcribed into the cDNA, and then subjected to qRT-PCR. The expression of cold and insect resistance genes in the stress-treated control tobacco plant and the transgenic tobacco was analyzed.

4.11. Statistical Analysis and Graphing of Data

Data were processed, analyzed, and charted using the IBM SPSS Statistics 22.0, GraphPad Prism 9, Adobe Illustrator 2023, and Photoshop 2023 software packages, Duncan’s multiple range test was utilized for examining significant differences between groups, one-way ANOVA was used for multiple comparisons, and all data were presented as mean ± standard error of the mean. A p < 0.05 indicated significance.

5. Conclusions

The CsAFS2 gene significantly enhances plant resistance to low temperatures and insects. In our study, we found that tea plant quality in Chinese chestnut-tea intercropped plantations surpassed that in pure tea plantations. We explored the tea plants’ resistance mechanism in these intercropped plantations, focusing on the CsAFS2 gene.

We mapped out the mechanism of the CsAFS2 gene in the chestnut-tea intercropped system (Figure 10), highlighting its role as a responder to low temperatures and biotic stress. In this environment, changes in light and allelopathic effects may alter hormonal levels in tea plants, triggering the activation of the CsAFS2 gene. This activation is facilitated by the interaction of the CsAFS2 promoter with transcription factors such as WRKY, MYB, MYC, bHLH, and ERF. CsAFS2 enhances protective enzyme activity, thereby improving plant stress resistance. This leads to increased expression of cold-resistant genes such as CBF and insect-resistant genes like CPI, promoting tea plant health in chestnut-tea intercropped plantations. Additionally, CsAFS2 influences trichome growth and density, enhancing cold and insect resistance as well as fragrance in tea plants. Further research is needed to elucidate how CsAFS2 interacted with plant growth regulators and transcription factors such as WRKY, MYB, MYC, bHLH, and ERF to enhance cold and insect resistance in tea plants. Understanding these interactions is crucial for uncovering resistance improvement mechanisms in intercropped tea plantations with Chinese chestnut.