Cellular PSMB4 Protein Suppresses Influenza A Virus Replication through Targeting NS1 Protein
Abstract
:1. Introduction
2. Materials and Methods
2.1. Yeast Two-Hybrid System
2.2. Plasmid Construction and DNA Transfection
2.3. Cell Culture
2.4. Co-Immunoprecipitation Assay
2.5. Western Blotting Analysis
2.6. Confocal Analysis
2.7. Virus Infection
2.8. Knockdown Experiments and Stable Cell Establishment
2.9. Luciferase Assay
2.10. Assay for Interferon Activity
2.11. Statistical Analysis
3. Results
3.1. Cellular PSMB4 Was Found to Interact with IAV NS1 Protein Using Yeast Two-Hybrid System
3.2. Interactions between PSMB4 and NS1 in Mammalian Cells
3.3. Neither IAV Infection nor NS1 Protein Modulates PSMB4 Expression Significantly
3.4. PSMB4 Reduces NS1 Protein Expression
3.5. PSMB4 Degraded NS1 in MG132-Independent Pathway
3.6. PSMB4 Suppressed NS1 Functions
3.7. PSMB4 Could Inhibit IAV Replication
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Shao, W.; Li, X.; Goraya, M.U.; Wang, S.; Chen, J.L. Evolution of Influenza A Virus by Mutation and Re-Assortment. Int. J. Mol. Sci. 2017, 18, 1650. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ji, Z.X.; Wang, X.Q.; Liu, X.F. NS1: A Key Protein in the “Game” Between Influenza A Virus and Host in Innate Immunity. Front. Cell. Infect. Microbiol. 2021, 11, 670177. [Google Scholar] [CrossRef] [PubMed]
- Krug, R.M. Functions of the influenza A virus NS1 protein in antiviral defense. Curr. Opin. Virol. 2015, 12, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, C.W.; Jeong, M.S.; Jang, S.B. Structure and Function of the Influenza A Virus Non-Structural Protein 1. J. Microbiol. Biotechnol. 2019, 29, 1184–1192. [Google Scholar] [CrossRef]
- Melen, K.; Kinnunen, L.; Fagerlund, R.; Ikonen, N.; Twu, K.Y.; Krug, R.M.; Julkunen, I. Nuclear and nucleolar targeting of influenza A virus NS1 protein: Striking differences between different virus subtypes. J. Virol. 2007, 81, 5995–6006. [Google Scholar] [CrossRef] [Green Version]
- Jureka, A.S.; Kleinpeter, A.B.; Tipper, J.L.; Harrod, K.S.; Petit, C.M. The influenza NS1 protein modulates RIG-I activation via a strain-specific direct interaction with the second CARD of RIG-I. J. Biol. Chem. 2020, 295, 1153–1164. [Google Scholar] [CrossRef]
- Twu, K.Y.; Noah, D.L.; Rao, P.; Kuo, R.L.; Krug, R.M. The CPSF30 binding site on the NS1A protein of influenza A virus is a potential antiviral target. J. Virol. 2006, 80, 3957–3965. [Google Scholar] [CrossRef] [Green Version]
- Marc, D. Influenza virus non-structural protein NS1: Interferon antagonism and beyond. J. Gen. Virol. 2014, 95, 2594–2611. [Google Scholar] [CrossRef]
- Kuo, R.L.; Li, L.H.; Lin, S.J.; Li, Z.H.; Chen, G.W.; Chang, C.K.; Wang, Y.R.; Tam, E.H.; Gong, Y.N.; Krug, R.M.; et al. Role of N Terminus-Truncated NS1 Proteins of Influenza A Virus in Inhibiting IRF3 Activation. J. Virol. 2016, 90, 4696–4705. [Google Scholar] [CrossRef] [Green Version]
- Nogales, A.; Martinez-Sobrido, L.; Topham, D.J.; DeDiego, M.L. Modulation of Innate Immune Responses by the Influenza A NS1 and PA-X Proteins. Viruses 2018, 10, 708. [Google Scholar] [CrossRef]
- Dubrow, A.; Lin, S.; Savage, N.; Shen, Q.; Cho, J.H. Molecular Basis of the Ternary Interaction between NS1 of the 1918 Influenza A Virus, PI3K, and CRK. Viruses 2020, 12, 338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuo, R.L.; Li, Z.H.; Li, L.H.; Lee, K.M.; Tam, E.H.; Liu, H.M.; Liu, H.P.; Shih, S.R.; Wu, C.C. Interactome Analysis of the NS1 Protein Encoded by Influenza A H1N1 Virus Reveals a Positive Regulatory Role of Host Protein PRP19 in Viral Replication. J. Proteome Res. 2016, 15, 1639–1648. [Google Scholar] [CrossRef] [PubMed]
- Pirincal, A.; Turan, K. Human DDX56 protein interacts with influenza A virus NS1 protein and stimulates the virus replication. Genet. Mol. Biol. 2021, 44, e20200158. [Google Scholar] [CrossRef] [PubMed]
- Thulasi Raman, S.N.; Zhou, Y. Networks of Host Factors that Interact with NS1 Protein of Influenza A Virus. Front. Microbiol. 2016, 7, 654. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, C.H.; Li, H.C.; Hung, C.H.; Lo, S.Y. Studying coronavirus-host protein interactions. Methods Mol. Biol. 2015, 1282, 197–212. [Google Scholar] [PubMed]
- Yang, C.H.; Li, H.C.; Shiu, Y.L.; Ku, T.S.; Wang, C.W.; Tu, Y.S.; Chen, H.L.; Wu, C.H.; Lo, S.Y. Influenza A virus upregulates PRPF8 gene expression to increase virus production. Arch. Virol. 2017, 162, 1223–1235. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.H.; Li, H.C.; Ku, T.S.; Wu, P.C.; Yeh, Y.J.; Cheng, J.C.; Lin, T.Y.; Lo, S.Y. Hepatitis C virus down-regulates SERPINE1/PAI-1 expression to facilitate its replication. J. Gen. Virol. 2017, 98, 2274–2286. [Google Scholar] [CrossRef] [PubMed]
- Ma, H.C.; Lin, T.W.; Li, H.; Iguchi-Ariga, S.M.; Ariga, H.; Chuang, Y.L.; Ou, J.H.; Lo, S.Y. Hepatitis C virus ARFP/F protein interacts with cellular MM-1 protein and enhances the gene trans-activation activity of c-Myc. J. Biomed. Sci. 2008, 15, 417–425. [Google Scholar] [CrossRef]
- Wang, S.; Huang, J.; He, J.; Wang, A.; Xu, S.; Huang, S.F.; Xiao, S. RPL41, a small ribosomal peptide deregulated in tumors, is essential for mitosis and centrosome integrity. Neoplasia 2010, 12, 284–293. [Google Scholar] [CrossRef] [Green Version]
- Montenegro-Venegas, C.; Fienko, S.; Anni, D.; Pina-Fernandez, E.; Frischknecht, R.; Fejtova, A. Bassoon inhibits proteasome activity via interaction with PSMB4. Cell. Mol. Life Sci. 2021, 78, 1545–1563. [Google Scholar] [CrossRef]
- Lalime, E.N.; Pekosz, A. The R35 residue of the influenza A virus NS1 protein has minimal effects on nuclear localization but alters virus replication through disrupting protein dimerization. Virology 2014, 458–459, 33–42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Loscher, M.; Fortschegger, K.; Ritter, G.; Wostry, M.; Voglauer, R.; Schmid, J.A.; Watters, S.; Rivett, A.J.; Ajuh, P.; Lamond, A.I.; et al. Interaction of U-box E3 ligase SNEV with PSMB4, the beta7 subunit of the 20 S proteasome. Biochem. J. 2005, 388, 593–603. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bard, J.A.M.; Goodall, E.A.; Greene, E.R.; Jonsson, E.; Dong, K.C.; Martin, A. Structure and Function of the 26S Proteasome. Annu. Rev. Biochem. 2018, 87, 697–724. [Google Scholar] [CrossRef] [PubMed]
- Salvatore, M.; Basler, C.F.; Parisien, J.P.; Horvath, C.M.; Bourmakina, S.; Zheng, H.; Muster, T.; Palese, P.; Garcia-Sastre, A. Effects of influenza A virus NS1 protein on protein expression: The NS1 protein enhances translation and is not required for shutoff of host protein synthesis. J. Virol. 2002, 76, 1206–1212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kramyu, J.; Narkpuk, J.; Jengarn, J.; Wanasen, N. Improved transient protein expression by pFluNS1 plasmid. Mol. Biotechnol. 2014, 56, 351–359. [Google Scholar] [CrossRef] [PubMed]
- Egorov, A.; Brandt, S.; Sereinig, S.; Romanova, J.; Ferko, B.; Katinger, D.; Grassauer, A.; Alexandrova, G.; Katinger, H.; Muster, T. Transfectant influenza A viruses with long deletions in the NS1 protein grow efficiently in Vero cells. J. Virol. 1998, 72, 6437–6441. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garcia-Sastre, A.; Egorov, A.; Matassov, D.; Brandt, S.; Levy, D.E.; Durbin, J.E.; Palese, P.; Muster, T. Influenza A virus lacking the NS1 gene replicates in interferon-deficient systems. Virology 1998, 252, 324–330. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rousseau, A.; Bertolotti, A. Regulation of proteasome assembly and activity in health and disease. Nat. Rev. Mol. Cell Biol. 2018, 19, 697–712. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, R.; Lu, S.; Deng, Y.; Yang, S.; He, S.; Cai, J.; Qiang, F.; Chen, C.; Zhang, W.; Zhao, S.; et al. PSMB4 expression associates with epithelial ovarian cancer growth and poor prognosis. Arch. Gynecol. Obstet. 2016, 293, 1297–1307. [Google Scholar] [CrossRef]
- Shi, J.; Liu, X.; Xu, C.; Ge, J.; Ren, J.; Wang, J.; Song, X.; Dai, S.; Tao, W.; Lu, H. Up-regulation of PSMB4 is associated with neuronal apoptosis after neuroinflammation induced by lipopolysaccharide. J. Mol. Histol. 2015, 46, 457–466. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; He, Z.; Xia, L.; Zhang, W.; Xu, L.; Yue, X.; Ru, X.; Xu, Y. PSMB4 overexpression enhances the cell growth and viability of breast cancer cells leading to a poor prognosis. Oncol. Rep. 2018, 40, 2343–2352. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, C.; Chen, J.; Liu, Y.; Zhang, J.; Ding, W.; Wang, S.; Bao, G.; Xu, G.; Sun, Y.; Wang, L.; et al. Upregulation of PSMB4 is Associated with the Necroptosis after Spinal Cord Injury. Neurochem. Res. 2016, 41, 3103–3112. [Google Scholar] [CrossRef]
- Zhou, D.M.; Liu, J.; Liu, F.; Luo, G.W.; Li, H.T.; Zhang, R.; Chen, B.L.; Hua, W. A novel FoxM1-PSMB4 axis contributes to proliferation and progression of cervical cancer. Biochem. Biophys. Res. Commun. 2020, 521, 746–752. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Liu, H.; Cui, M.; Liu, J.; Yi, R.; Niu, Y.; Chen, T.; Zhao, Y. Effect of the HBV whole-X gene on the expression of hepatocellular carcinoma associated proteins. J. Microbiol. Immunol. Infect. 2016, 49, 335–343. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cui, F.; Wang, Y.; Wang, J.; Wei, K.; Hu, J.; Liu, F.; Wang, H.; Zhao, X.; Zhang, X.; Yang, X. The up-regulation of proteasome subunits and lysosomal proteases in hepatocellular carcinomas of the HBx gene knockin transgenic mice. Proteomics 2006, 6, 498–504. [Google Scholar] [CrossRef]
- Rossi, F.; Evstafieva, A.; Pedrali-Noy, G.; Gallina, A.; Milanesi, G. HsN3 proteasomal subunit as a target for human immunodeficiency virus type 1 Nef protein. Virology 1997, 237, 33–45. [Google Scholar] [CrossRef] [Green Version]
- Enosi Tuipulotu, D.; Netzler, N.E.; Lun, J.H.; Mackenzie, J.M.; White, P.A. RNA Sequencing of Murine Norovirus-Infected Cells Reveals Transcriptional Alteration of Genes Important to Viral Recognition and Antigen Presentation. Front. Immunol. 2017, 8, 959. [Google Scholar] [CrossRef] [Green Version]
- Yang, C.H.; Li, H.C.; Ku, T.S.; Wu, C.H.; Sim, K.C.; Lo, S.Y. MicroRNA-Independent Modulation of DICER1 Expression by hAgo2. Mol. Cell. Biol. 2020, 40, e00221-20. [Google Scholar] [CrossRef]
- Yu, L.; Chen, Y.; Tooze, S.A. Autophagy pathway: Cellular and molecular mechanisms. Autophagy 2018, 14, 207–215. [Google Scholar] [CrossRef] [Green Version]
- Widjaja, I.; de Vries, E.; Tscherne, D.M.; Garcia-Sastre, A.; Rottier, P.J.; de Haan, C.A. Inhibition of the ubiquitin-proteasome system affects influenza A virus infection at a postfusion step. J. Virol. 2010, 84, 9625–9631. [Google Scholar] [CrossRef] [PubMed]
- Ueda, M.; Yamate, M.; Du, A.; Daidoji, T.; Okuno, Y.; Ikuta, K.; Nakaya, T. Maturation efficiency of viral glycoproteins in the ER impacts the production of influenza A virus. Virus Res. 2008, 136, 91–97. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence |
---|---|
WSN33NS-S | 5′-CGGAATTCATGGATCCAAACACTGT-3′ |
WSN33NS-AS3 | 5′-TGCTCTAGAAACTTCTGACCTAATTGT-3′ |
WSN33NS-74S | 5′-CGGAATTCATGGATGAGGCACTCAAAAT-3′ |
WSN33NS-73AS | 5′-TGCTCTAGAAGATTCTTCCTTCAGAAT-3′ |
BDNS1-AS | 5′-CTATTAAACTTCTGACCTAATTGT-3′ |
BDNS1-73AS | 5′-CTATTAAGATTCTTCCTTCAGAAT-3′ |
PSMB4-ADS | 5′-CCGAATTCGCATGGAAGCGTTTTTGGG-3′ |
PSMB4-ADAS | 5′-CCGCTCGAGTCATTCAAAGCCACTGAT-3′ |
PSMB4-73S | 5′-CCGAATTCGCATGGGATCCTACGGCTCCTT-3′ |
PSMB4-72AS | 5′-CCGCTCGAGTTACACCATGTCTGCGGCAAT-3′ |
6XHA | Gene Sequence: AAGCTTATGTACCCCTACGACGTGCCCGACTACGCCGGCTATCCTTACGATGTGCCTGATTACGCCATGGGCTACCCCTATGATGTCCCCGATTATGCCCACATGTATCCTTATGACGTCCCAGACTATGCTGGCTACCCATATGACGTGCCAGATTACGCTATGGGGTATCCATACGACGTTCCGGATTATGCCGGATCC |
Name | Type | Company |
---|---|---|
Anti-beta-actin | Rabbit polyclonal Ab | Proteintech (Rosemont, IL, USA) |
Anti-GFP | Mouse monoclonal Ab | Santa Cruz Biotechnology (Dallas, TX, USA) |
Anti-IAV NS1 | Goat polyclonal Ab | Santa Cruz Biotechnology (Dallas, TX, USA) |
Anti-myc tag | Mouse monoclonal Ab | EMD Millipore Corp. (Billerica, MA, USA) |
Anti-V5 tag | Mouse monoclonal Ab | Bio-Rad Laboratories Inc. (Hercules, CA, USA) |
Anti-ERK2 | Rabbit polyclonal Ab | Santa Cruz Biotechnology (Dallas, TX, USA) |
Anti-PSMB4 | Mouse monoclonal Ab | Abnova (Taipei, Taiwan) |
Anti-PSMB4 | Rabbit polyclonal Ab | ABclonal Inc. (Woburn, MA, USA) |
Anti-PSMB4 | Mouse monoclonal Ab | Santa Cruz Biotechnology (Dallas, TX, USA) |
Anti-IAV M1 | Mouse monoclonal Ab | Bio-Rad Laboratories Inc. (Hercules, CA, USA) |
Goat anti-mouse IgG, HRP-conjugated | Perkin Elmer (Waltham, MA, USA) | |
Goat anti-rabbit IgG, HRP-conjugated | Perkin Elmer (Waltham, MA, USA) | |
Goat anti-rabbit IgG, AP-conjugated | Perkin Elmer (Waltham, MA, USA) | |
Mouse anti-V5 mAB, FITC-conjugated | Invitrogen (Waltham, MA, USA) | |
Goat anti-mouse, rhodamine-conjugated | Chemicon (Temecula, CA, USA) | |
Donkey anti-goat, FITC-conjugated | Santa Cruz Biotechnology (Dallas, TX, USA) | |
Goat anti-mouse, cy3-conjugated | Jackson lab (Bar Harbor, ME, USA) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, C.-H.; Hsu, C.-F.; Lai, X.-Q.; Chan, Y.-R.; Li, H.-C.; Lo, S.-Y. Cellular PSMB4 Protein Suppresses Influenza A Virus Replication through Targeting NS1 Protein. Viruses 2022, 14, 2277. https://doi.org/10.3390/v14102277
Yang C-H, Hsu C-F, Lai X-Q, Chan Y-R, Li H-C, Lo S-Y. Cellular PSMB4 Protein Suppresses Influenza A Virus Replication through Targeting NS1 Protein. Viruses. 2022; 14(10):2277. https://doi.org/10.3390/v14102277
Chicago/Turabian StyleYang, Chee-Hing, Che-Fang Hsu, Xiang-Qing Lai, Yu-Ru Chan, Hui-Chun Li, and Shih-Yen Lo. 2022. "Cellular PSMB4 Protein Suppresses Influenza A Virus Replication through Targeting NS1 Protein" Viruses 14, no. 10: 2277. https://doi.org/10.3390/v14102277